| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, November 2006, p. 8347-8356, Vol. 26, No. 22
0270-7306/06/$08.00+0 doi:10.1128/MCB.00981-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Department of Molecular Genetics and Biochemistry, University of Pittsburgh, Pittsburgh, Pennsylvania 15213,1 Department of Human Genetics, University of Pittsburgh, Pittsburgh, Pennsylvania 15213,2 Department of Pediatrics, University of Pittsburgh, Pittsburgh, Pennsylvania 152133
Received 1 June 2006/ Returned for modification 31 July 2006/ Accepted 28 August 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The aforementioned ICs coincide with differentially methylated domains (DMDs) (11, 23, 24). Prominent DMDs associated with the Snurf/Snrpn, Kcnq1 (called KvDMR), and Igf2r (called DMD2) gene clusters in the mouse are highly methylated on the maternal allele and unmethylated on the paternal allele. There is strong evidence that these different epigenetic states are first established in the gametes and then maintained during embryogenesis (9, 14, 26). The DMD sequences of the Snurf/Snrpn, Igf2r, and Kcnq1 genes have several common features including promoter elements, CpG islands, and imperfect tandem repeats (Fig. 1A; CpG islands not shown). These three DMDs contain six to nine tandem repeats, ranging in size from 18 to 170 bp and containing 1 to 14 CpG dinucleotides per repeat copy (Fig. 1A) (20). Within a given DMD the repeated copies are, on average, 50% to 73% similar to one another, and the array of tandem repeats spans 600 bp to 700 bp of genomic sequence (including intervening sequence). There is no obvious sequence similarity among the three mouse DMDs. To determine the roles of these DMD features in genomic imprinting, DMD sequences were analyzed in a mouse model system based on the imprinted RSVIgmyc transgene (Fig. 1B) (5, 6, 21).
|
An alternative approach to analyzing small sequence elements for their imprinting role is to move the sequences into a heterologous context. This is a standard, time-honored approach for studying and defining cis-regulatory sequences, and many investigators have applied such an approach to genomic imprinting by generating mouse transgenes. Generally, large bacterial artificial chromosome- or yeast artificial chromosome-sized transgenes centered over DMDs are consistently imprinted with the same parent-specific methylation and transcriptional expression as the endogenous gene (1, 27). Attempts to develop much smaller, consistently imprinted transgenes from the same endogenous imprinted genes that contain DMDs have not succeeded (19, 27). Presumably, a critical non-DMD sequence(s) or the appropriate genomic context is lost in the smaller transgenes. If consistently imprinted, these smaller transgenes would be manageable experimental systems to study the function of putative imprinting sequences from many different genes. For these reasons, we developed a transgene system based on the small RSVIgmyc transgene to identify functionally important imprinting sequences (5, 6, 21).
We previously showed that a portion of the Igf2r DMD2 containing tandem repeats restored imprinting to the Ig/myc transgene, a nonimprinted version of RSVIgmyc in which its DMD sequences have been excised (21). Other DMD sequences, particularly the promoter region of the Snurf/Snrpn gene, were not able to restore transgene imprinting. These findings on the analysis of transgenes comprised solely of mouse genomic sequences suggest that the tandem repeats found within mouse DMDs are cardinal elements of the imprinting mechanism (21). To explore this issue further, we generated additional Igf2r- and Snurf/Snrpn-containing transgenes, as well as Kcnq1-containing transgenes, and studied their parent-specific methylation and expression in mice.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Transgenic mice. Transgene fragments for injection were removed from the pKS+ plasmid by NotI digestion and gel isolated using a QiaexII kit (QIAGEN). Fragments for injection were resuspended to a concentration of 5 µg/ml in TE buffer (5 mM Tris-Cl, pH 8, 0.2 mM EDTA, pH 8) and injected into pronuclei of fertilized eggs. All transgenic mouse lines were generated in the inbred FVB/N strain background (Taconic).
Southern blot analysis of DNA methylation.
Genomic DNAs were obtained from tail biopsies performed at the time of weaning (3 to 4 weeks of age) (21). Resulting DNAs were digested with HpaII (New England Biolabs), electrophoresed on a 1% agarose gel, and transferred to Genescreen nylon membrane (NEN, Boston, MA). DNAs were hybridized with a 32P-labeled probe to the C
region of the transgene (Fig. 1B). Southern blots were washed in 2x SSC (1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate) with 0.1% sodium dodecyl sulfate at room temperature and with 0.1x SSC with 0.1% sodium dodecyl sulfate at 65°C.
Bisulfite genomic sequencing. Bisulfite genomic sequencing was performed as previously described (7). Following bisulfite treatment, the DMD sequences were amplified with PCR primers flanking the DMD (within the Ig and c-myc sequences). This design allowed all transgene constructs, with the exception of the Snrpn/eGFP transgene, to be amplified with the same primers. Transgene-specific primers were also designed for the Snrpn/eGFP construct. Primer sequences are available upon request.
Collection of preimplantation embryos. Preimplantation embryos were collected in M2 medium (Specialty Media) following natural matings. Blastocyst stage embryos were flushed from the uterine horns at 3.5 days postcoitum (dpc). Preimplantation embryos at the two-cell stage were removed from the oviducts at 1.5 dpc; four-cell embryos, eight-cell embryos, and morulae were isolated from the oviducts between 2 to 3 dpc. Meiosis II oocytes were collected from the oviducts of superovulated female mice 24 h after injection with human choriogonadotropin. Hyaluronidase was used to remove cumulus cells. All oocytes and preimplantation embryos were washed in M2 medium followed by 1x phosphate-buffered saline. DNA was collected from pools of 30 to 100 preimplantation embryos by proteinase K digestion.
RNA isolation and RT-PCR. Brains were dissected from adult mice and stored in RNALater stabilization reagent (QIAGEN). Brain tissue was homogenized using a Minibeadbeater (BioSpec Products) and zirconia/silica beads (BioSpec Products). Total RNA was extracted using an RNeasy MiniKit (QIAGEN). Reverse transcription was performed on 1 µg of total brain RNA, using oligo(T) hexamers and 200 U of Moloney murine leukemia virus reverse transcriptase (Promega) at 37°C for 1 h. The eGFP/cMyc transcript was PCR amplified from brain cDNA with Taq Polymerase (Invitrogen). The primers were Snex1a (GATGCCAGACGCTTGGTTCTG) and Mex2b (CGTAGCGACCGCAACATAGG). The hypoxanthine guanine phosphoribosyl transferase (Hprt) transcript was PCR amplified as a positive control with the primers HprtF (TCTCATGCCGACCCGCAGTCC) and HprtR (ATTCAACTTGCGCTCATCTTA).
| RESULTS |
|---|
|
|
|---|
To demonstrate that the SnrpnR/Igmyc parental allele methylation differences evident on Southern blots (Fig. 1C) reflect methylation differences within the SnrpnR/Igmyc tandem repeats, we analyzed the methylation of the tandem repeats using the bisulfite genomic sequencing method. Bisulfite genomic sequencing primers were designed within the transgene sequences flanking the repeats to distinguish the transgene DMD sequences from endogenous Snurf/Snrpn sequence. One of the three SnrpnR/Igmyc lines was analyzed in this way, and its DMD-derived repeat sequences were differentially methylated (Fig. 1D). In adult tissue the maternal alleles of the transgene were methylated at 99.7% of CpG dinucleotides analyzed. In contrast, only 10.5% of CpGs on paternally inherited transgene alleles were methylated.
The parent-specific methylation observed on the SnrpnR/Igmyc transgene DMD in adult tissues was also seen in preimplantation embryos. The DMD of the maternally inherited transgene was methylated in all stages examined, namely, four-cell embryos, eight-cell embryos, morulae, and blastocysts (Fig. 1E). Because endogenous Snurf/Snrpn and RSVIgmyc DMD methylation is established in oocytes, we interpret these results to indicate that the imprinted SnrpnR/Igmyc transgene derives its maternal allele methylation from the gamete and then maintains it throughout preimplantation development. In contrast, the DMD of the paternally inherited SnrpnR/Igmyc transgene was unmethylated in all stages examined, namely, the eight-cell and blastocyst stages. Methylation on the paternal transgene allele was not examined in other preimplantation stages or in sperm. These data are consistent with the notion that gamete-derived methylation is actively maintained during preimplantation development, a developmental period in which much genomic, but not DMD, methylation is lost (6, 16).
To further test the role of DMD-associated tandem repeats in genomic imprinting, the repeat region from the Kcnq1 DMD was used to generate the Kcnq1/Igmyc transgene. Maternal Kcnq1/Igmyc alleles were methylated, and paternal alleles were undermethylated when analyzed by Southern blotting (Fig. 1C). This pattern of transgene imprinting was also found in a separate transgenic mouse line generated with the same transgene construct (data not shown). Imprinting of the Kcnq1/Igmyc transgene was not affected by the orientation of the tandem repeat array within the Ig/myc transgene, as the opposite orientation of the Kcnq1 tandem repeats produced consistently imprinted transgenes (data not shown). We conclude from the imprinting of Snrpn- and Kcnq1-containing transgenes that tandem repeats are likely important for parent-specific methylation of DMD sequences.
Snurf/Snrpn tandem repeats control expression of a linker reporter gene. To determine if methylation on the Snurf/Snrpn repeat sequences is able to silence a linked promoter, a genomic fragment containing the Snurf/Snrpn first exon, 800 bp of upstream sequence, and the tandem repeats was coupled to a genomic c-myc reporter construct. GFP coding sequence was inserted in frame into c-myc coding sequence to distinguish the transgene-specific transcript from endogenous c-myc expression (Fig. 2A). One Snrpn/eGFP transgenic line was created and analyzed for expression and methylation. The transgene-specific transcript predicted by splicing of Snurf/Snrpn and c-myc exons is shown in Fig. 2B. A paternal-specific transcript was detected in adult brain of transgenic mice, indicating that the transgene was imprinted (Fig. 2B). We used bisulfite genomic sequencing to determine the methylation of transgene Snurf/Snrpn repeats adjacent to c-myc sequences; only the silenced maternal allele of the Snrpn/eGFP transgene was methylated in this region (Fig. 2C). Thus, the tandem repeats and promoter of a DMD can establish an imprinted transcriptional unit when moved to a heterologous position 5' of a c-myc reporter gene. We conclude that the Snurf/Snrpn intronic tandem repeats are a key element for imprinting the reporter construct for a number of reasons: the endogenous c-myc gene is not imprinted (8); deletion of the endogenous Snurf/Snrpn promoter had no effect on imprinting within the gene cluster (4); the Snurf/Snrpn promoter alone in the Ig/myc transgene was not imprinted (21); and the Snurf/Snrpn tandem repeats in the Ig/myc transgene were consistently imprinted (Fig. 1).
|
|
Identification of a minimal Igf2r DMD imprinting element. We have designated the 459-bp region of Igf2r that possesses the ability to establish an imprinted transgene locus the differential methylation element (DME) of the Igf2r DMD2. The DME was used as a starting point to define the minimal Igf2r DMD sequence needed to generate an imprint. Five transgenes were generated that eliminated portions of the DME sequence (Fig. 1A and Fig. 4A). At the 5' end of the DME, an 83-bp segment that contained two CpG dinucleotides was removed, leaving a sequence equivalent to two unit copies of the TR2+3 repeat. In each of three independently generated DME2/Igmyc transgenic lines, maternal alleles were heavily methylated, and paternal alleles were undermethylated (Fig. 3A and C). Thus, the DME2/Igmyc transgene retained the imprinting function of the DME.
|
Two additional transgenes clearly lost the imprinting function of the DME. The DME1.5L/Igmyc transgene contained just under 1.5 unit copies of the TR2+3 repeat at the 5' end of the DME, and the DME1/Igmyc transgene contained a single complete unit copy of the TR2+3 repeat at the center of the DME. Two transgenic lines were generated for each construct. In all four transgenic lines, the maternal and paternal transgene alleles acquired comparable levels of methylation (Fig. 4D and E). Therefore, we conclude that there is no identifiable sequence element smaller than the 376-bp DME2 that completely restores Ig/myc imprinting. Different sequences were removed from DME2 in generating the DME1/Igmyc, the DME1.5L/gmyc, and the DME1.5C/Igmyc transgenes, yet these transgenes were either not imprinted or only partially imprinted.
DME2 CpG dinucleotides are required for transgene imprinting. The imprinting function of the DME2/Igmyc transgene was unambiguously lost when it was reduced to one unit copy (DME1/Igmyc). This result could be due to a loss of one unit copy of the repeat or to a loss of CpG dinucleotides commensurate with the reduction in size. Based on this reasoning, we constructed a version of the DME2 transgene that eliminated a portion of its CpG dinucleotides but retained its size. The CpG dinucleotides within the central DME1 sequence were retained, and the remaining 15 CpGs were changed to TpGs by site-directed mutagenesis to generate the DME2-CG/Igmyc transgene. This left a DME2-CG sequence that contained 15 fewer CpG dinucleotides but was otherwise identical to the original DME2 (95% of the sequence remained unchanged). One DME2-CG/Igmyc transgenic line was created and analyzed for allele-specific methylation by bisulfite genomic sequencing (Fig. 4F). Both maternal and paternal transgene alleles showed comparable levels of methylation. These results are consistent with a specific CpG dinucleotide requirement for DME2/Igmyc imprinting and suggest that a DME2 transgene that keeps all CpG dinucleotides, but eliminates tandem repetitiveness, would remain imprinted.
Dnmt1o and Dnmt3L are required for DME2/Igmyc imprinting.
To determine if the same molecular machinery controlling the imprinting of endogenous genes governs DME2/Igmyc imprinting, we studied the effect of Dnmt1o methyltransferase deficiency and Dnmt3L protein deficiency on DME2/Igmyc imprinting (2, 12, 13). Homozygous Dnmt1
1o/
1o female mice or heterozygous Dnmt1
1o/+ female mice carrying the DME2/Igmyc transgene were mated to wild-type FVB/N males, and methylation of the transgene was analyzed in embryonic day 9.5 (E9.5) embryos. In an embryo obtained from a Dnmt1
1o/+ heterozygous female, the maternal DME2/Igmyc allele was methylated on every allele examined (Fig. 5A, top). In contrast, in an embryo obtained from a Dnmt1
1o/
1o homozygous mutant female, there were two types of maternal alleles (Fig. 5A, bottom). Seven of 11 sequenced alleles had the high level of methylation normally seen on a wild-type Dnmt1 background. No methylation, or a very low level of methylation, was seen on the remaining maternal DME2/Igmyc alleles. Such a distribution of methylated and unmethylated maternal alleles was also seen at endogenous imprinted loci in embryos that developed in the absence of Dnmt1o protein. We conclude from this analysis that DME2/Igmyc imprinting requires Dnmt1o protein from the oocyte, much as oocyte-derived Dnmt1o is required for the imprinting of endogenous genes.
|
Developmental function of the minimal DME2 element. We have shown that the DME2/Igmyc transgene requires Dnmt3L and Dnmt1o proteins, present in oocytes and in preimplantation embryos, for the differential methylation on its DME2 element. These observations suggest that the transgene's DME2 sequences are needed for the germ line establishment and/or early embryonic maintenance of DME2/Igmyc imprinting. We analyzed the methylation of maternal and paternal alleles of DME1/Igmyc and DME2/Igmyc transgenes in the gametes and in preimplantation embryos. The DME1/Igmyc transgene is a nonimprinted mutant version of the imprinted DME2/Igmyc transgene. Abnormalities in the establishment and/or inheritance of methylation of the nonimprinted DME1/Igmyc transgene, in comparison to methylation on the imprinted DME2/Igmyc transgene, should identify the developmental times at which DME2 sequences are required for genomic imprinting.
The maternal and paternal differences in DME2/Igmyc transgene methylation were evident in the gametes (Fig. 5C). Moreover, these gametic methylation states were maintained in eight-cell embryos and preimplantation blastocysts (Fig. 5C). At the blastocyst stage, each maternal allele was methylated at over 60% of CpG dinucleotides. By comparison, paternal DME2/Igmyc alleles were methylated in blastocysts at only 0.7% of CpG dinucleotides. These data demonstrate that the two distinct epigenetic states of the DME2/Igmyc parental alleles are established and maintained in the same manner as the imprinted SnrpnR/Igmyc transgene (Fig. 1E) and many endogenous imprinted genes (14, 26).
The maternal and paternal alleles of the nonimprinted DME1/Igmyc transgene were partially methylated to approximately equal levels in adult tissue (Fig. 2F). Specifically, 68% of CpG dinucleotides on maternal alleles were methylated, and 55.5% of CpG dinucleotides of paternal alleles were methylated in adult transgene carriers. Paternal transgene alleles were unmethylated in sperm, indicating that the partially methylated paternal state developed entirely during postzygotic development (Fig. 5D). Because only 1.25% of CpGs were methylated on paternal alleles in blastocysts collected at 3.5 dpc, the paternal allele methylation was established de novo at a later blastocyst stage or following implantation. Although the precise time of acquisition of this methylation is unknown, the level of 65.5% methylation of paternal DME1/Igmyc alleles at E9.5 (Fig. 5D) is approximately the same as the level in adult paternal carriers, indicating that the acquisition occurred between E3.5 and E9.5 of development.
The time course of the acquisition of the adult methylation of the maternal DME1/Igmyc was different from that of the paternal allele. Maternal alleles were highly methylated in oocytes. Notably, the obvious epigenetic differences between DME1/Igmyc alleles in sperm (unmethylated) and oocytes (methylated) indicate that imprinting is established on the DME1/Igmyc transgene. The perpetuation of the methylation on oocyte-derived alleles was examined by measuring the methylation of maternal DME1/Igmyc alleles at different preimplantation stages (Fig. 5D). The maternal allele was highly methylated in eight-cell embryos to a level comparable to the level seen in oocytes. However, in blastocysts two epigenetic forms of DME1/Igmyc alleles were found. Five of 15 maternal DME1/Igmyc alleles examined were unmethylated at all 16 CpG dinucleotides. All other maternal alleles were nearly completely methylated. Interestingly, the unmethylated alleles acquired significant methylation after the blastocyst stage, as almost all maternal DME1/Igmyc alleles were partially methylated in the adult.
| DISCUSSION |
|---|
|
|
|---|
|
Role of the genomic context of the epigenetic maintenance signal in genomic imprinting. Small DMDs of endogenous imprinted gene clusters function within a large genomic context of different chromatin conformations and different levels of transcriptional activity of several genes. These characteristics complicate the analysis of function for any small sequence element residing within that genomic context. The significant influence that genomic context has on imprinting can best be appreciated by the collection of transgenes built around the Igf2r DMD2. Consistent imprinting was achieved with a 300-kb transgene construct whose imprinting was dependent upon DMD2 (27). However, smaller Igf2r transgenes were often not imprinted or were inconsistently imprinted. A transgene containing 44 kb of sequence surrounding the Igf2r DMD2 was imprinted in one of three transgenic lines, and smaller transgenes of 3 kb, 9 kb, and 14 kb were not imprinted (22, 27). These results indicate that the ability of DMD2 to attain the correct parent-specific methylation can be found in greater than 40 kb but less than 300 kb of surrounding sequence. From the analysis of our Igf2r-containing transgenes, we conclude that the DME element is required for imprint maintenance and not for imprint establishment. The much larger genomic context surrounding a DMD would provide the signal to establish gametic methylation differences on that DMD (21). Loss of all or a significant portion of this genomic context would therefore preclude the establishment of gametic methylation differences.
In moving the DMD sequences from endogenous genes into the Ig/myc model transgene, we have significantly reduced the size of the genomic context required for transgene imprinting. The genomic environment provided by this transgene results in consistent imprinting upon addition of endogenous DMD sequences. Therefore, we are able to address a specific function of the DMD sequences, namely their ability to maintain parent-specific DNA methylation patterns. This provides a decided advantage over deleting the sequences from their endogenous genomic context and monitoring the effect, particularly when the goal is to monitor small changes in methylation at early preimplantation stages.
Roles of DMD tandem repeats and CpG dinucleotides in genomic imprinting. The Snurf/Snrpn, Kcnq1, and Igf2r DMDs all contain unique tandem repeats. In all three cases the imperfect tandem repeats are important for creating a differentially methylated transgene locus, and for Snurf/Snrpn the tandem repeats are important for the imprinted expression of a heterologous reporter gene from the adjacent Snurf/Snrpn promoter. In defining the minimal sequence required to create a differentially methylated transgene containing Igf2r DMD sequences, we established that no sequence containing less than two unit copies of the repeat was capable of reproducibly creating an imprinted locus. This result suggests that the repeated nature of the DMD sequence is critical.
Importantly, the tandem repeats of the Igf2r DMD2 are within a region rich in CpG dinucleotides. Because the positions of many CpGs are conserved among adjacent unit copies of the TR2+3 repeats (21), an ordered arrangement of CpGs is obtained in the DME tandem repeats. Moreover, a similar ordered arrangement of CpG dinucleotides is imposed by tandem repeats of the Snurf/Snrpn and Kcnq1 DMDs (20). It is interesting to speculate that, once differential DMD methylation is established in the gametes, the maintenance of the methylated state on the maternal allele would be governed by the regular pattern of methylated CpGs, and the maintenance of the unmethylated state on the paternal allele is governed by the similar arrangement of unmethylated CpGs. In this way the two distinct epigenetic states of the DME2 element direct their own perpetuation during embryogenesis.
The CpG dinucleotide content of the tandem repeats changes across the 560-bp repeated region of the Igf2r DMD2; TR1 repeats have a low CpG content compared to the TR2+3 repeats (21). We can speculate that the low CpG content of the TR1 repeats is related to the inability of the TR1 repeats to imprint the Ig/myc transgene, and the high CpG content of the TR2+3 repeats is related to their ability to imprint Ig/myc. In this regard, it is interesting that the CpG content varies across the repeated regions of both the Snurf/Snrpn and the Kcnq1 DMDs (20). Certain tandem repeats lie within CpG-rich DMD regions, whereas other repeats lie in relatively CpG-poor regions. We would predict from this observed variation that only particular subsets of Snurf/Snrpn and Kcnq1 tandem repeats govern the maintenance of the parent-specific DMD methylation.
If CpG dinucleotide content and/or position within an epigenetic maintenance element is indeed essential for imprinting, then these CpGs and their direct interaction with maintenance methyltransferases may alone determine the maintenance of parental imprinted methylation states. Such a model would require an innate ability of the Dnmt1 maintenance methyltransferase to distinguish sequence or structural features of genomic DNA. Although no such distinguishing ability of Dnmt1 has been defined, this possibility has not been directly addressed in vivo. It may be important to address this particular issue during preimplantation development, a period in which the maintenance of imprinted methylation patterns may be most important.
| ACKNOWLEDGMENTS |
|---|
We thank Leonardo D'Aiuto for helpful comments on the manuscript.
| FOOTNOTES |
|---|
Published ahead of print on 5 September 2006. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Arnaud, P., K. Hata, M. Kaneda, E. Li, H. Sasaki, R. Feil, and G. Kelsey. 2006. Stochastic imprinting in the progeny of Dnmt3L/ females. Hum. Mol. Genet. 15:589-598.
3. Bielinska, B., S. M. Blaydes, K. Buiting, T. Yang, M. Krajewska-Walasek, B. Horsthemke, and C. I. Brannan. 2000. De novo deletions of SNRPN exon 1 in early human and mouse embryos result in a paternal to maternal imprint switch. Nat. Genet. 25:74-78.[CrossRef][Medline]
4. Bressler, J., T. F. Tsai, M. Y. Wu, S. F. Tsai, M. A. Ramirez, D. Armstrong, and A. L. Beaudet. 2001. The SNRPN promoter is not required for genomic imprinting of the Prader-Willi/Angelman domain in mice. Nat. Genet. 28:232-240.[CrossRef][Medline]
5. Chaillet, J. R., D. S. Bader, and P. Leder. 1995. Regulation of genomic imprinting by gametic and embryonic processes. Genes Dev. 9:1177-1187.
6. Chaillet, J. R., T. F. Vogt, D. R. Beier, and P. Leder. 1991. Parental-specific methylation of an imprinted transgene is established during gametogenesis and progressively changes during embryogenesis. Cell 66:77-83.[CrossRef][Medline]
7. Clark, S. J., J. Harrison, C. L. Paul, and M. Frommer. 1994. High sensitivity mapping of methylated cytosines. Nucleic Acids Res. 22:2990-2997.
8. Davis, A. C., M. Wims, G. D. Spotts, S. R. Hann, and A. Bradley. 1993. A null c-myc mutation causes lethality before 10.5 days of gestation in homozygotes and reduced fertility in heterozygous female mice. Genes Dev. 7:671-682.
9. Engemann, S., M. Strodicke, M. Paulsen, O. Franck, R. Reinhardt, N. Lane, W. Reik, and J. Walter. 2000. Sequence and functional comparison in the Beckwith-Wiedemann region: implications for a novel imprinting centre and extended imprinting. Hum. Mol. Genet. 9:2691-2706.
10. Fitzpatrick, G. V., P. D. Soloway, and M. J. Higgins. 2002. Regional loss of imprinting and growth deficiency in mice with a targeted deletion of KvDMR1. Nat. Genet. 32:426-431.[CrossRef][Medline]
11. Glenn, C. C., S. Saitoh, M. T. Jong, M. M. Filbrandt, U. Surti, D. J. Driscoll, and R. D. Nicholls. 1996. Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. Am. J. Hum. Genet. 58:335-346.[Medline]
12. Hata, K., M. Okano, H. Lei, and E. Li. 2002. Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 129:1983-1993.
13. Howell, C. Y., T. H. Bestor, F. Ding, K. E. Latham, C. Mertineit, J. M. Trasler, and J. R. Chaillet. 2001. Genomic imprinting disrupted by a maternal effect mutation in the Dnmt1 gene. Cell 104:829-838.[CrossRef][Medline]
14. Lucifero, D., C. Mertineit, H. J. Clarke, T. H. Bestor, and J. M. Trasler. 2002. Methylation dynamics of imprinted genes in mouse germ cells. Genomics 79:530-538.[CrossRef][Medline]
15. Mancini-Dinardo, D., S. J. Steele, J. M. Levorse, R. S. Ingram, and S. M. Tilghman. 2006. Elongation of the Kcnq1ot1 transcript is required for genomic imprinting of neighboring genes. Genes Dev. 20:1268-1282.
16. Monk, M. 1990. Changes in DNA methylation during mouse embryonic development in relation to X-chromosome activity and imprinting. Philos. Trans. R. Soc. Lond. B 326:299-312.[Medline]
17. Neumann, B., P. Kubicka, and D. P. Barlow. 1995. Characteristics of imprinted genes. Nat. Genet. 9:12-13.[CrossRef][Medline]
18. Nicholls, R. D., and J. L. Knepper. 2001. Genome organization, function, and imprinting in Prader-Willi and Angelman syndromes. Annu. Rev. Genomics Hum. Genet. 2:153-175.[CrossRef][Medline]
19. Pfeifer, K., P. A. Leighton, and S. M. Tilghman. 1996. The structural H19 gene is required for transgene imprinting. Proc. Natl. Acad. Sci. USA 93:13876-13883.
20. Reinhart, B., and J. R. Chaillet. 2005. Genomic imprinting: cis-acting sequences and regional control. Int. Rev. Cytol. 243:173-213.[CrossRef][Medline]
21. Reinhart, B., M. Eljanne, and J. R. Chaillet. 2002. Shared role for differentially methylated domains of imprinted genes. Mol. Cell. Biol. 22:2089-2098.
22. Sleutels, F., and D. P. Barlow. 2001. Investigation of elements sufficient to imprint the mouse Air promoter. Mol. Cell. Biol. 21:5008-5017.
23. Smilinich, N. J., C. D. Day, G. V. Fitzpatrick, G. M. Caldwell, A. C. Lossie, P. R. Cooper, A. C. Smallwood, J. A. Joyce, P. N. Schofield, W. Reik, R. D. Nicholls, R. Weksberg, D. J. Driscoll, E. R. Maher, T. B. Shows, and M. J. Higgins. 1999. A maternally methylated CpG island in KvLQT1 is associated with an antisense paternal transcript and loss of imprinting in Beckwith-Wiedemann syndrome. Proc. Natl. Acad. Sci. USA 96:8064-8069.
24. Stoger, R., P. Kubicka, C. G. Liu, T. Kafri, A. Razin, H. Cedar, and D. P. Barlow. 1993. Maternal-specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. Cell 73:61-71.[CrossRef][Medline]
25. Thorvaldsen, J. L., K. L. Duran, and M. S. Bartolomei. 1998. Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev. 12:3693-3702.
26. Warnecke, P. M., J. R. Mann, M. Frommer, and S. J. Clark. 1998. Bisulfite sequencing in preimplantation embryos: DNA methylation profile of the upstream region of the mouse imprinted H19 gene. Genomics 51:182-190.[CrossRef][Medline]
27. Wutz, A., O. W. Smrzka, N. Schweifer, K. Schellander, E. F. Wagner, and D. P. Barlow. 1997. Imprinted expression of the Igf2r gene depends on an intronic CpG island. Nature 389:745-749.[CrossRef][Medline]
28. Zwart, R., F. Sleutels, A. Wutz, A. H. Schinkel, and D. P. Barlow. 2001. Bidirectional action of the Igf2r imprint control element on upstream and downstream imprinted genes. Genes Dev. 15:2361-2366.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|