| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Neil McLaughlin,1
Kim Lindstrom,2
Toshio Tsukiyama,2 and
David J. Clark1*
Laboratory of Molecular Growth Regulation, National Institute of Child Health and Human Development, National Institutes of Health, Building 6A, Room 2A14, 6 Center Drive, Bethesda, Maryland 20892,1 Division of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, Washington 981092
Received 19 April 2006/ Returned for modification 30 May 2006/ Accepted 3 September 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
It is now apparent that ATP-dependent chromatin remodeling machines can be grouped into several functional classes (2). One class includes the SWI/SNF and RSC complexes, which are capable of mobilizing nucleosomes and driving a conformational change in the nucleosome to create the remodeled state (24, 31). A second class is defined by the ISWI group of complexes, exemplified in budding yeast by the Isw1 and Isw2 complexes, which are capable of mobilizing nucleosomes to create arrays with characteristic spacing but cannot remodel nucleosome structure (19, 39). A third class of complex is defined by the Swr1 complex, which remodels chromatin by catalyzing replacement of H2A with a variant form, H2AZ (see reference 11 for a review). It is becoming clear that the regulation of at least some and perhaps all yeast genes, including HIS3, involves more than one remodeling complex (35).
HIS3 encodes an enzyme required for the biosynthesis of histidine (32). The transcription of HIS3 is activated in response to amino acid starvation via the Gcn4p activator (5, 6, 23). There is a single high-affinity binding site for Gcn4p in the HIS3 promoter. The activation of HIS3 by Gcn4p involves contributions from the SWI/SNF ATP-dependent chromatin remodeling machine (9, 22), the mediator complex (23), and the Gcn5p (13, 14) and Esa1p (25) histone acetyltransferase complexes. The HIS3 promoter also contains a poly(dA-dT) element, which stimulates Gcn4p-activated transcription by virtue of its intrinsic DNA structure (8, 17), perhaps by increasing the accessibility of nucleosomal DNA target sites (1).
Inspired by the work of Thoma and colleagues (37), we have developed a model system for purifying yeast genes as plasmid chromatin (10, 29). In a study of the chromatin structure of a purified TRP1ARS1 plasmid containing the HIS3 gene, we demonstrated that the plasmid chromatin exists in two alternative structural states which, for simplicity, are referred to as remodeled and unremodeled chromatin (9). HIS3 plasmid chromatin from uninduced cells is predominantly composed of fully supercoiled chromatin that is generally protected from cleavage by restriction enzymes, indicating that it has a canonical chromatin structure, with a minor component corresponding to remodeled chromatin. In contrast, induced chromatin is predominantly composed of remodeled chromatin, characterized by a much reduced level of negative supercoiling, decreased compaction, and increased sensitivity to restriction enzymes, indicating a highly accessible chromatin structure. Since the formation of remodeled chromatin requires both Gcn4p and the SWI/SNF remodeling machine, it has been suggested that Gcn4p recruits the SWI/SNF complex to the HIS3 promoter, where it directs the remodeling of a chromatin domain defined by the HIS3 gene, facilitating transcription (9).
We are
interested in examining the structural consequences of interplay among
remodeling machines. To address this interest, we have begun to study
the effects of remodelers on HIS3 chromatin. Here, we have
compared the positions of nucleosomes on the HIS3 gene in
uninduced and induced wild-type, gcn4
,
snf2
, and isw1
chromatin. Our
studies reveal that extensive nucleosome movements occur on gene
activation and that these require both the Gcn4p activator and the
SWI/SNF complex. The Isw1 complex plays a more subtle role in
determining nucleosome positions on HIS3. We found evidence
for long-range order in the chromatin structure, even though it is
composed of multiple alternative nucleosomal arrays. We propose that
the net effect of the interplay among remodeling machines at
HIS3 is to create a highly dynamic chromatin
structure.
| MATERIALS AND METHODS |
|---|
|
|
|---|
, and snf2
) have been
described previously (9).
YTT186 (MATa ade2-1 can1-100
his3-11,15 leu2-3,112
trp1-1 ura3-1
RAD5+isw1
::ADE2)
(40) was transformed with
TA-HIS3 as described previously
(9). Strains used for
chromatin immunoprecipitation (ChIP) experiments were based on the
untagged wild-type strain W1588-4C (MATa
ade2-1 can1-100 his3-11,15
leu2-3,112 trp1-1 ura3-1
RAD5+)
(40). W1588-4C, YTT1448
(ISW1-3FLAG::KanMX), and
YTT1722
(SNF2-3FLAG::KanMX) were
converted to his+ by the repair of the chromosomal
HIS3 locus using the 982-bp EcoRI fragment containing
HIS3 from pGEM-TA-HIS3B
(9); transformants were
selected on plates lacking histidine. The repair of the HIS3
locus was confirmed by Southern blotting. These strains were designated
YDC111, YDC112, and YDC113, respectively. YDC112 and YDC113 were
transformed to
gcn4
::URA3 by using an
XhoI digest of p385 to obtain YDC172 and YDC173, respectively. p385 was
constructed by inserting the 1,162-bp SmaI-PmeI URA3 fragment
from pNEB-URA3 (29) at
the MscI site inside the GCN4 coding region in pBS-GCN4. This
plasmid contained GCN4 as an NdeI-XhoI insert obtained by PCR
using yeast genomic DNA with CATATGTCCGAATATCAGand CTCGAGGCGTTCGCCAAC as primers in pBluescript
II SK(+). YDC188 (ISW1-3FLAG
snf2
::URA3) was obtained by
transforming YDC112 using the 1,648-bp
snf2
::URA3 XhoI fragment
from p435. The
snf2
::URA3 fragment was
made by PCR using pLY21
(15) as a template with
CTCGAGTCGCGATATGTTAAAACCGCG and
CTCGAGTCCGCTTCATCTGTG as primers and TA cloned
into pCRIITOPO (Invitrogen) to give p435. YDC180
(SNF2-3FLAG
isw1
::ADE2) was obtained by
transforming YDC113 with a 3.1-kb fragment containing
isw1
::ADE2 derived by
PCR using genomic DNA from YTT186 with
GGCGCGGGTACCGTGCACCGTATCCTCCATAGC and
GGCGCGGGTACCGGACCAAGAAATCCAAAGCCTG as primers.
For ChIP for Gcn4p, YDC172 (SNF2-3FLAG
gcn4
::URA3) was transformed
either with pRS415, a centromeric LEU2 vector (Stratagene), to
obtain YDC197 or with p448 (pRS415 carrying GCN4 with 13
C-terminal myc tags) to obtain YDC196. p448 was constructed by
transferring the 2.4-kb SalI-PvuII fragment containing the
13-myc-tagged GCN4 gene from pSK1
(35) to pRS415 cut with
SalI and SmaI. A strain with a single base deletion in the Gcn4p
binding site (YDC246, SNF2-3FLAG
gcn4
::URA3
his3::ADE2 pRS-Gcn4-myc [p448]) was
constructed by the transformation of YDC196 with an EcoRI digest of
p522, resulting in the disruption of HIS3 by the insertion of
ADE2. p522 was constructed by the insertion of an AvrII
fragment containing ADE2, which was derived by PCR using yeast
genomic DNA and
GGCGCGCCTAGGTTCTTGAATAATACATAACTTTTCTTAAAAG and
GGCGCGCCTAGGGATCTTATGTATGAAATTCTTAAAAAAGG as
primers, into the AvrII site within the HIS3 open reading
frame (ORF) in p517, with ADE2 and HIS3 in opposing
orientations. p517 is pGEM-TAHIS3B with a deletion of the T residue in
the Gcn4p binding site in the HIS3 promoter
(ATGACTC [the
deleted residue is underlined]) described previously
(9). Transformants were
selected on plates containing synthetic complete medium lacking leucine
and adenine; the his phenotype was confirmed. The
presence of the point deletion in the HIS3 promoter was
confirmed by showing the loss of the FokI site (Southern blotting) and
by FokI digestion of a HIS3 promoter fragment obtained by PCR
from genomic DNA. YDC247 is identical to YDC246, except that the
HIS3 promoter is wild type. All strains were confirmed by
Southern blotting.
Plasmid chromatin purification and monomer extension.
Plasmid chromatin was purified from
late-log-phase cells grown in synthetic complete medium lacking
tryptophan (uninduced) or both tryptophan and histidine (induced) as
described previously (9).
Micrococcal nuclease (MNase) digestions of TA-HIS3 chromatin were
performed as described previously
(4). The monomer extension
protocol has been described previously
(10). Briefly, 20 ng of
purified TA-HIS3 chromatin was digested to nucleosome core particles in
10 mM HEPES-KOH (pH 7.9), 125 mM KCl, 2.5 mM MgCl2, 1 mM
dithiothreitol, 2.5 mM CaCl2 for 5 min at 30°C with
0.05 to 0.1 U/µl of MNase (Worthington). The digestion was
stopped by the addition of EDTA to 20 mM and sarcosyl to 0.5%. DNA was
extracted, and core particle DNA (147 to 160 bp) was purified from a 3%
(wt/vol) agarose gel. Core DNA was end labeled using T4 polynucleotide
kinase and [
-32P]ATP, denatured in 0.2 M NaOH,
neutralized with 3 M sodium acetate, and precipitated. Labeled core DNA
was annealed to single-stranded pGEM-TAHIS3B
(9) acting as template and
extended with Superscript II RNase H reverse
transcriptase (Invitrogen), in the presence or absence of an
appropriate restriction enzyme. With the plus strand of pGEM-TAHIS3B as
a template, EcoRV, XbaI, PmlI, MscI, or BglI was used for mapping. With
the minus strand of pGEM-TAHIS3B strand as a template, DraIII, BglI,
NdeI, PmlI, or NaeI was used. Extension products were resolved in 6%
denaturing polyacrylamide gels.
Indirect end-labeling analysis. Nuclei were prepared from yeast cells grown to mid-log phase in synthetic medium and digested with MNase as described previously (4). The DNA was purified, digested with BamHI, and electrophoresed in long 1.5% (wt/vol) agarose gels. The gels were blotted and probed with a DED1 fragment corresponding to nucleotides +53 to +328 with respect to the DED1 start codon and labeled by random priming. The markers were prepared by mixing separate restriction digests of a 1,757-bp PCR fragment corresponding almost exactly to the genomic BamHI fragment containing HIS3 (the restriction enzymes used were HaeII, BsaBI, MscI, BglI, NheI, PstI, NsiI, XhoI, and AflII).
Chromatin immunoprecipitation. ChIP experiments were based on the method of McConnell et al. (18). One liter of cells was grown to an optical density at 600 nm of about 0.5. For the induction with 3-aminotriazole (3-AT; Aldrich), cells at an initial A600 of 0.25 were grown for 2 to 4 h at 30°C. For the induction of strains YDC246 and YDC247 (which are his), cells were grown in synthetic complete medium containing histidine to an optical density of about 0.5, collected by rapid filtration, resuspended in medium lacking histidine for 1 h, and then induced with 3-AT for 20 min. Cells were fixed with 1% formaldehyde for 20 min at room temperature on a shaker at 125 rpm by the addition of a one-tenth volume of 11% formaldehyde in 0.1 M NaCl, 50 mM HEPES-K, pH 7.6, 1 mM Na-EDTA. The reaction was stopped with 200 ml 2.5 M glycine and shaken for 5 min. Fixed cells were collected by vacuum filter, washed with 20 mM Tris-HCl, pH 8.0, 0.15 M NaCl, and stored in 2 aliquots at 80°C. For the preparation of cross-linked chromatin, fixed cells from a 500-ml culture were resuspended in 1 ml 0.1 M Tris-HCl, pH 8.0, 20% glycerol with protease inhibitors lacking EDTA (Roche), mixed with an equal volume of glass beads (acid washed; 425 to 600 µm; catalog no. G-8772; Sigma), and shaken vigorously for 40 min at 4°C. The lysate was diluted with 2 ml cold FA buffer (50 mM HEPES-K, pH 7.6, 0.15 M NaCl, 1 mM Na-EDTA, 1% Triton X-100, and 0.1% sodium deoxycholate with protease inhibitors as described above) and spun (1 min, 14,000 rpm, 4°C). The pellet was resuspended in 2 ml FA buffer and spun again; this wash was repeated. The pellet was resuspended in 1 ml FA buffer in a round-bottomed 14-ml tube placed in ice water for sonication using a Misonix Sonicator 3000 (14 pulses of 30 s separated by 30-s pauses for cooling; the power output setting was 2.5 for 6 W). The sample was diluted with 1.8 ml FA buffer and spun (14,000 rpm, 1 h, and 4°C). The supernatant containing the fragmented fixed chromatin was aliquoted and stored at 80°C. DNA concentrations were measured using the Hoechst assay. The average size of the DNA was 400 to 500 bp. For the IP reactions, two batches of protein G magnetic beads (catalog no. 100.04; Dynal), each with 20 µl suspension per IP sample were washed three times with 1 ml 5 mg/ml bovine serum albumin (BSA) (immunoglobulin G-free; catalog no. A-9085; Sigma) in phosphate-buffered saline (PBS) and incubated overnight with or without (mock) antibody on a rotator at 4°C. The monoclonal antibodies used were M2-anti-FLAG (5 µg/sample; catalog no. F-3165; Sigma) and anti-myc 9E10 (1 µg antibody/sample; catalog no. sc-40; Santa Cruz). The beads were washed twice with BSA-PBS and resuspended in 30 µl BSA-PBS per sample. Equal amounts of chromatin (11 µg DNA) were adjusted to 55 µg DNA/ml (600 µl) with FA buffer, spun (14,000 rpm, 15 min, and 4°C), and filtered (0.45-µm Ultra-free MC low binding filter; Millipore) to remove insoluble material. Input samples (60 µl) were removed; the cross-links were reversed by incubation at 65°C overnight in 5 mM Na-EDTA, 0.5% sodium dodecyl sulfate, followed by digestion with proteinase K at 50 µg/ml for 4 h at 55°C; the DNA was purified. IP samples (220 µl) were mixed with 30 µl beads with or without (mock) antibody on a rotator (90 min at room temperature). The beads were subjected to a series of 1-ml washes (5 min each on a rotator at room temperature): three washes with FA buffer, three with FA buffer containing 0.5 M NaCl, and two with radioimmunoprecipitation assay buffer (10 mM Tris-HCl, pH 8.0, 0.25 M LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM Na-EDTA, and protease inhibitors). FLAG samples were eluted with 3-FLAG peptide (catalog no. F-4799; Sigma) at 5 mg/ml in 0.1 M HEPES-K, pH 7.6, 20% glycerol, 0.1 M KCl, 0.6 mM Na-EDTA, 2 mM MgCl2, 0.02% NP-40; 10 µl peptide was added to the drained beads and mixed; and 40 µl radioimmunoprecipitation assay buffer was added, and the elutions were placed in an Eppendorf Thermomixer (1,200 rpm for 30 min at 22°C). The elution was repeated, the eluates were pooled, the cross-links were reversed, and the purified DNA was dissolved in 25 µl of 10 mM Tris-HCl, pH 8.0, 0.1 mM Na-EDTA. Myc-antibody IPs were eluted with 120 µl of 50 mM Tris-HCl, pH 8.0, 5 mM Na-EDTA, 0.5% sodium dodecyl sulfate. For the quantification of DNA in the IP samples by PCR with internal control, 2.5 µl DNA was mixed with 22.5 µl of 2 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 0.2 µM each radiolabeled primer, and 0.5 U Pt Taq polymerase (Invitrogen) in Pt Taq buffer (all components were mixed together before DNA was added). Dilutions (1:100 and 1:500) of input DNA were assayed. Primers for PCR were the HIS3 promoter (CTTGGCCTCCTCTAGTACACTC and CATTTGTAATACGCTTTACTAGGGC, yielding a 238-bp fragment), HIS3 ORF (GACCATCACACCACTGAAGACT and AAAGTGCCTCATCCAAAGGCG; 120 bp), POL1 ORF (GCTCTGGTAGGCTGATATGTGA and GGGCCATTGTCATACTATTTACATC; 180 bp), and ARG1 promoter (ACGGCTCTCCAGTCATTTAT and GCAGTCATCAATCTGATCCA; 163 bp) (35). Different HIS3 promoter primers (CTTAGCGATTGGCATTATCACATAATG and GCCTTCGTTTATCTTGCCTGC; 102 bp), with Int-V (12) as internal control (CTTCCTGGCTGTCAGAATATGGG and CACCCCGAAGCTGCTTTCACAATAC; 153 bp), were also used (see Fig. 5E). One primer of each pair was end labeled using T4 kinase (USB). The PCRs were stopped with an equal volume of 20 mM Tris-HCl, pH 8.0, 10 mM Na-EDTA, 20% glycerol containing 0.5 µg of an MspI digest of pBR322 as carrier and analyzed in a denaturing 6% (19:1) polyacrylamide gel. The data were quantified using a phosphorimager.
|
| RESULTS |
|---|
|
|
|---|
|
cells, which lack the
Gcn4p activator and so provide basally expressing chromatin. There is
an approximately fivefold induction of HIS3 in synthetic
medium lacking histidine relative to that of gcn4
cells
(9). Mapping nucleosome positions using the monomer extension technique. An advantage of the high-copy plasmid system is that plasmid chromatin can be purified in sufficient quantities to perform high-resolution monomer extension mapping of the precise locations of the nucleosomes. The monomer extension method (41) is based on the protection of 147 bp of DNA in the nucleosome core particle from digestion by MNase. Since this is the operational definition of the nucleosome, the method provides information about nucleosome positions. This contrasts with the standard technique, mapping by indirect end labeling, which requires relatively early MNase digestion times and therefore measures relative protection rather than nucleosome positions since, under these conditions, nucleosomes are not trimmed to their borders (further discussed below).
The monomer extension method involves the complete digestion of purified plasmid chromatin to nucleosome core particles using MNase (Fig. 1B). Briefly, the nucleosomal DNA is used as a primer and single-stranded target plasmid DNA is used as a template in a primer extension reaction. The product DNA is digested with a restriction enzyme having a unique site in the plasmid, and a map is produced from the sizes of the product bands, which represent the distance of the far border of each nucleosome to the restriction site. More specifically, nucleosomal DNA (145 to 160 bp) is purified from a gel and end labeled with T4 polynucleotide kinase. Labeled core DNA is annealed to single-stranded template plasmid and used as a primer for extension using a DNA polymerase. The template plasmid in our case (pGEM-TAHIS3) contains the entire TA-HIS3 plasmid sequence as an insert. Single-stranded DNA must be used as the template because both strands of core particle DNA would anneal if the template were double stranded; this would result in extension in both directions, confounding interpretation. The replicated DNA is then digested with a restriction enzyme which has a unique site in the insert to be mapped (i.e., TA-HIS3). The DNA fragments produced are resolved and measured accurately in long sequencing gels. Long stretches of chromatin can be mapped in great detail in one reaction, and nucleosome positions can be quantified relative to one another.
To map HIS3 chromatin, the product DNA was digested with XbaI, which has a single site in pGEM-TAHIS3, located within the TRP1 gene (Fig. 1A). The XbaI site was chosen because almost all of HIS3 can be mapped in a single reaction. The lengths of the resulting DNA fragments were determined accurately in sequencing gels; each band represents a nucleosome border, defining the distance from the far border of the nucleosome to the XbaI site. A control reaction designed to detect any sequence-dependent pausing/termination by reverse transcriptase involved an identical reaction except for the omission of XbaI; there should be no bands in the control other than the long extension products.
The monomer extension technique is not yet widely used, so it is worthwhile to discuss some technical points. A slight underdigestion of chromatin by MNase results in core particles that are not completely trimmed to 147 bp. Consequently, bands within about 15 bp of one another might represent different degrees of trimming of the same positioned nucleosome. For this reason, clusters of bands within 15 bp were counted as the same nucleosome in our analysis. If core particles are heavily overdigested by MNase, nicks begin to appear. Labeled core DNA was routinely checked in denaturing gels: the size range was typically 140 to 160 bp with very little nicking. In any case, nicking would not affect the result because kinase does not label nicks and end-labeled nicked DNA strands liberated on denaturation of nucleosomal DNA would give the correct result on extension. Proteins other than nucleosomes which might be bound to the minichromosome will not interfere with nucleosome mapping unless they protect 140 to 160 bp of DNA against extensive digestion by MNase because nucleosomal DNA is subsequently gel purified. Major contributions from nonhistone proteins would appear as nucleosome-free gaps in the map.
The transcriptional activator Gcn4p directs the disruption of a predominant nucleosome array on HIS3.
HIS3
plasmid chromatin was purified from uninduced and induced wild-type
cells and from gcn4
cells grown in the absence of
histidine. Their chromatin structures were compared by monomer
extension mapping relative to the XbaI site inside the TRP1
open reading frame. In uninduced and induced wild-type cells, a very
complex chromatin structure was observed (Fig.
1C, lanes 5 and 7). Many
bands of various intensities were observed; each band indicates the
downstream border of a nucleosome with respect to the XbaI site. These
bands were not the result of problems with elongation by the reverse
transcriptase because no bands were observed without XbaI digestion
(Fig. 1C, lanes 4, 6, and
8). Theoretically, the HIS3 gene could accommodate a maximum
of about six uniquely positioned nucleosomes if packed close together.
However, there were many more than six bands in uninduced and induced
chromatin and neighboring bands were much less than 147 bp apart (the
size of a nucleosome). Thus, the monomer extension map revealed the
presence of many overlapping nucleosome positions on the HIS3
gene. Since nucleosomes cannot physically overlap, these positions
represent alternative positions and the chromatin structure observed
must represent the superimposition of several alternative chromatin
structures. It is concluded that the HIS3 gene can exist in
any of several overlapping nucleosomal arrays in wild-type
cells.
It should be noted that the structure of uninduced
wild-type chromatin was quite variable (unlike that of induced
chromatin); in most experiments, multiple overlapping positions were
observed as shown here (Fig.
1C, lane 5) but, in some
experiments, a more ordered structure, similar to that of
gcn4
chromatin (see below), was observed (not shown).
This variability was probably due to variable degrees of HIS3
induction in uninduced cells
(9). It is important to
understand that, although the monomer extension maps were very complex,
the same bands were observed in all mapping experiments; it was their
intensities that varied, indicating that nucleosomes were redistributed
among a large but fixed number of possible alternative
positions.
The chromatin structure of HIS3 expressed at
basal levels was analyzed by mapping TA-HIS3 chromatin derived from
gcn4
cells. This had a more ordered structure over
most of the HIS3 gene (Fig.
1C, lane 9): an array of
predominant positions was apparent (labeled D1 to D5). Many relatively
minor alternative positions were also detected, representing a
significant fraction of the total nucleosomes (labeled A1 to A28). D1,
D2, and, to a lesser extent, D3 were clearly stronger than their
neighboring overlapping positions (Fig.
1D), but there was more
ambiguity in the region of the D4 and D5 nucleosomes; D4 was only
marginally stronger than the nearby A22 nucleosome, and D5 was weaker
than A25. D4 and D5 were included in the predominant array rather than
A22 and A25 because the latter pair of positions overlap one another
and A25 overlaps D4. Also, in some mapping experiments (e.g., see Fig.
3), D5 was stronger than
A25. In uninduced and induced wild-type cells, the D positions were
less prominent and some of the A positions were enhanced such that they
were of intensities similar to those of the D positions (e.g., A5, A7,
A9, A11, A12, and A15) (Fig.
1C, lanes 5 and 7). Thus,
in wild-type cells, the predominant array was only one of several
possible alternative nucleosome arrays. The nucleosome positions
corresponding to the bands observed are shown in detail in Fig.
2A.
|
|
chromatin was
"scrambled" in wild-type chromatin, with D nucleosomes
displaced to alternative A positions. However, a strong nucleosomal
repeat was preserved in TA-HIS3 chromatin from wild-type and
gcn4
cells (Fig.
2B), indicating that the
chromatin was still highly ordered. The repeat lengths of wild-type,
gcn4
, and isw1
TA-HIS3 chromatin
were about 165 bp, as expected
(38). Taken together, the
repeat length and the monomer extension mapping data suggested that
nucleosomes are arranged in alternative arrays, with an average spacing
of about 165 bp. Consistent with this interpretation, the A nucleosomes
can be arranged into several alternative arrays of nonoverlapping
positions with predicted repeats of about 170 bp (Fig.
2C). The arrangements
shown are not the only possibilities; some nucleosomes could be
alternatives in other arrays, and more arrays can be drawn if a
nucleosome is allowed to appear in more than one
array. Nucleosomes on the HIS3 promoter were mapped in separate experiments using different restriction enzymes (not shown). Although some nucleosomes were detected on the HIS3 promoter (A1 to A4), these were all quantitatively relatively minor, indicating that nucleosome positions containing the TATA boxes, the Gcn4p binding site, and/or the poly(dA-dT) site were not usually occupied (see Discussion). The predominant nucleosome on the HIS3 promoter, D1, covered the transcription start sites but not the TATA boxes or the Gcn4p binding site; there was no predominant position covering these regulatory elements, leaving the Gcn4p binding site relatively nucleosome free.
We conclude that, in the absence of the Gcn4p transcriptional activator, the HIS3 gene was organized into a predominant array of nucleosomes superimposed on a significant background of multiple alternative positions. In wild-type cells, the D positions were still present but no longer predominant; the chromatin structure was much less ordered, presumably because Gcn4p is part of a system for mobilizing nucleosomes from the D positions to the alternative A positions.
The mobilization of nucleosomes on the HIS3 gene requires the SWI/SNF remodeling complex. It seemed likely that the mobilization of nucleosomes from the D to the A positions was due to the recruitment of a remodeling machine to the HIS3 promoter by Gcn4p. The remodeling machine involved would presumably be capable of mobilizing nucleosomes on DNA in vitro; candidates included the SWI/SNF, Isw1, Isw2, and RSC remodeling complexes. We tested the roles of the SWI/SNF and Isw1 remodeling complexes in nucleosome mobilization on HIS3 using mutants in their ATPase subunits.
The chromatin structures of TA-HIS3
purified from gcn4
, snf2
, and
isw1
cells grown under inducing conditions were
compared with that of induced wild-type chromatin by monomer extension
mapping (Fig.
3). The D nucleosome array was predominant in gcn4
and
snf2
chromatin but not in isw1
chromatin. The structures of gcn4
and
snf2
chromatin were almost identical (Fig.
3B), except that the A7
and A25 positions were more prominent in snf2
chromatin than in gcn4
chromatin. Nucleosomes D2, D3,
and D4, which occupy most of the HIS3 coding region, gave
consistently weaker signals relative to nucleosomes D1 and D5 (this
effect is dependent on the Isw2 remodeling complex [Y. Kim, unpublished
observations]). Thus, both Gcn4p and the Snf2p subunit of the SWI/SNF
complex were required for the mobilization of HIS3 nucleosomes
from the D to the A positions. In contrast, Isw1p was not required for
this mobilization.
The Isw1p remodeling complex was particularly
interesting because it has been shown to organize nucleosomes into
arrays with approximately 175-bp spacing in vitro
(40). However, the
nucleosomal spacing was unaffected in isw1
cells
(Fig. 2B), so it is
presumably not the only complex capable of making such arrays. Although
isw1
chromatin resembled wild-type chromatin, the two
were not identical (Fig.
3). Nucleosomes A25 and
A28 were prominent in isw1
chromatin, and there were
some more minor quantitative differences, such as increased occupancy
of the A15 and A19 positions, perhaps indicating that Isw1p promotes
the formation of some A arrays over others. A nucleosome-free gap
between the A25 and A28 nucleosomes was present in the map for
isw1
chromatin, corresponding to a major weakening of
the D5, A26, and A27 positions. This region corresponds to the
3' end of HIS3 where transcript termination probably
occurs; the gap of about 50 bp lies between nucleotides +713
and +764 (relative to the transcription start site at
+1 and the stop codon at +685) (Fig.
2A). Thus, Isw1 is
required for the movement of nucleosomes into positions A26, A27, and
D5 at the 3' end of HIS3, presumably at the expense of
A25 and A28. The biological significance of this change in chromatin
structure is unclear since the isw1
mutation did not
have a significant effect on HIS3 transcription (not shown).
However, it is clear that the SWI/SNF and Isw1 complexes tend to direct
nucleosomes to different destinations on
HIS3.
Chromatin structure of the chromosomal HIS3 locus. It was important to determine whether chromosomal HIS3 chromatin undergoes structural transitions similar to those of HIS3 plasmid chromatin. However, the monomer extension method cannot be applied to single-copy genes in the context of the entire genome because the huge excess of nucleosomes derived from the rest of the genome results in nonspecific annealing to template DNA, contributing too much background (41). Plasmid-borne HIS3 can be purified away from the rest of the genome, and the signal is improved by the high copy number of TA-HIS3. Therefore, we had to use the standard indirect end-labeling method to probe the chromatin structure of the chromosomal HIS3 gene. This method relies on a relatively mild digestion of chromatin in nuclei using MNase or DNase I, which cleaves the relatively accessible linker DNA between nucleosomes.
The 1,767-bp BamHI fragment encompassing the entire chromosomal HIS3 gene and parts of the upstream PET56 gene and the downstream DED1 gene was mapped (Fig. 4). The probe used abutted the BamHI site in the DED1 coding region. The indirect end-labeling pattern of protein-free genomic DNA was dominated by two MNase hypersensitive sites mapping to nucleotides 44 and +737. The coordinates are given with respect to the upstream transcription start site of HIS3, designated nucleotide +1 (33). The strong hypersensitive site at nucleotide +737 was located just downstream of the HIS3 stop codon (at nucleotide +683). MNase has a strong preference for cleaving DNA at CATA and CTA sequences (7). The hypersensitive site at nucleotide +737 coincided with a cluster of six CATA sequences located between nucleotides +682 and +780, which probably accounts for the observed hypersensitivity. In fact, many (but not all) of the bands observed in the protein-free DNA coincide with CATA sequences, partly accounting for the cleavage pattern (not shown).
|
, and
gcn4
cells were compared (Fig.
4). An examination of
HIS3 chromatin structure in uninduced wild-type cells revealed
many bands, particularly in the 5' half of HIS3. These
bands were mostly significantly less than 147 bp apart and were
therefore too close together to be attributed to uniquely positioned
nucleosomes. HIS3 chromatin in gcn4
cells
yielded almost the same set of bands as did wild-type chromatin, but
their relative intensities were different, with a subset of relatively
strong bands having the spacing expected of nucleosomes, suggesting the
presence of a predominant nucleosomal array. The weaker bands between
the stronger bands in the 5' half of HIS3 can be
accounted for by the presence of an alternative array(s). The more
complex structure of wild-type HIS3 chromatin is consistent
with the presence of more than one nucleosomal array.
The
predominant array in gcn4
cells coincided reasonably
well with the D array observed by monomer extension (Fig.
4), with the exception of
the D5 nucleosome, which overlapped the MNase hypersensitive site at
the 3' end of HIS3 (discussed below). The chromatin
structure of HIS3 in isw1
cells was very
similar to that of the wild type, except that the bands corresponding
to cut sites located within the D nucleosomes were somewhat more
prominent in isw1
chromatin and the 3'
HIS3 hypersensitive site was much more pronounced. The latter
could reflect the fact that the 3' hypersensitive site at
nucleotide +737 lies between nucleosomes A25 (nucleotides
+564 to +713) and A28 (nucleotides +764 to
+908) in the nucleosome-free gap observed in the monomer
extension map for isw1
chromatin. Induction had
little effect on the chromatin structure of HIS3 in wild-type,
isw1
, and gcn4
cells (the latter
was expected because HIS3 cannot be induced in the absence of
Gcn4p). In the HIS3 promoter, there was a MNase cut site at
nucleotide 146, but the distance between this site and the
5' hypersensitive site at nucleotide 44 is too small
to accommodate a nucleosome.
To compare the indirect end-labeling data with the monomer extension data, the differences between the methods must be discussed. Indirect end labeling requires a relatively low level of digestion by MNase, whereas monomer extension requires a limit digest to obtain nucleosome core particles. MNase has both endonuclease and exonuclease activities; initially, it cuts DNA rapidly at the preferred sequences CATA and CTA (7) and then it trims the DNA ends relatively slowly. Further digestion by MNase generates smaller nucleosomal oligomers; these are eventually reduced to mononucleosomes and trimmed to nucleosome core particles, which are stable to MNase for an extended period. Thus, the digestion conditions required for indirect end labeling correspond to initial cleavages at favored sites in the linkers with very little trimming, without which the borders and position of a nucleosome cannot be determined with accuracy. This problem probably accounts for the large variation in nucleosome sizes reported using this method.Indirect end labeling works best with strongly ordered nucleosomal arrays and cannot resolve complex chromatin structures (such as those detected using monomer extension), which would appear more like protein-free DNA.
In the indirect end label map of wild-type
HIS3 chromatin, some weak MNase cut sites were apparent near
the centers of the D1 and D2 nucleosomes (Fig.
4). These cut sites were
more prominent in isw1
chromatin (particularly in
induced isw1
chromatin). These bands are consistent
with the presence of the alternative overlapping arrays identified by
monomer extension. We argue that MNase cuts at its favored sites when
they are in the linker DNA, but not when they are in the nucleosome.
Thus, the degree of cleavage at each preferred site is an indicator of
the probability of that site being present in the linker; a particular
site could be in the linker in one array and be cut but be nucleosomal
in another array and be protected. A case in point is that of
nucleosome D5, which overlaps the strong 3' hypersensitive site
(see above); the fact that the D5 nucleosome was present in the
nucleosome population used for monomer extension proves that the
hypersensitive site is not cut when it is inside this nucleosome. Thus,
the band was strong primarily because it is a strongly favored cut site
in protein-free DNA; its presence in chromatin indicates that this site
is in the linker in a significant fraction of wild-type HIS3
chromatin. This site probably reflected cleavage at any of a cluster of
six CATA sequences spread over 100 bp; the probability of one or more
of these CATA sequences being in a linker would be high.
It is concluded that chromosomal HIS3 has a more ordered chromatin structure in the absence of Gcn4p, consistent with the formation of a predominant nucleosomal array. This predominant array is similar to that detected using monomer extension with HIS3 plasmid chromatin.
The SWI/SNF remodeling complex is constitutively present on the HIS3 gene. It seemed likely that the Gcn4p activator recruits the SWI/SNF complex to the HIS3 promoter (22, 36). Accordingly, the ChIP assay was employed to determine whether the SWI/SNF complex was present at the HIS3 promoter and whether its presence depended on the Gcn4p activator. Strains having a wild-type chromosomal HIS3 locus were used instead of the TA-HIS3 plasmid strains. This was to avoid complications in the ChIP analysis due to differential recovery and fragmentation of plasmid chromatin relative to chromosomal chromatin (which we had observed in preliminary experiments). Strains carrying SNF2 with three FLAG tags were grown to mid-log phase and cross-linked with formaldehyde under three different growth conditions: noninduced (with histidine), induced (no histidine), and highly induced (no histidine and treated with 10 mM 3-AT for 3 h). DNA purified from cross-linked chromatin immunoprecipitated with anti-FLAG antibody was analyzed by quantitative multiplex PCR, using part of the coding region of the POL1 gene as an internal control (Fig. 5). The POL1 gene is often used as a control because it is relatively long and so there should be no contributing signal from the POL1 promoter.
In cells carrying SNF2-FLAG, the IP signals observed for the HIS3 promoter were at least 10 times those obtained either in the absence of antibody (mock) or for a strain carrying untagged SNF2 (Fig. 5A). However, the signal at POL1 was also positive and the HIS3/POL1 ratio was not significantly different from that of input, indicating that SWI/SNF was just as likely to be in the middle of the POL1 gene as at the HIS3 promoter. In addition, there was no effect of induction on the presence of SWI/SNF at HIS3. Several other control regions were tested in addition to the POL1 coding region with identical results (not shown). The experiment was also repeated using both hemagglutinin-tagged and myc-tagged SNF2 strains, with the same result (not shown). Thus, the SWI/SNF complex was constitutively present at the HIS3 promoter.
In gcn4
cells carrying
SNF2-FLAG, there was an approximately twofold decrease in the
amount of Snf2-FLAG at the HIS3 promoter relative to wild-type
cells, but there was also a proportionate decrease at POL1.
This result suggested that there was a general reduction in the amounts
of chromatin-bound SWI/SNF complex in gcn4
cells,
probably the result of an indirect effect (see below). It should be
noted that gcn4
cells grew quite poorly relative to
the wild type and that they almost stopped growing in the presence of
3-AT. The absence of Isw1p had no effect on the ChIP signals for
Snf2-FLAG (Fig. 5A).
Essentially the same results were obtained for the SWI/SNF complex on
the HIS3 open reading frame (Fig.
5C). Thus, there was no
evidence here for the recruitment of SWI/SNF to the HIS3
promoter by Gcn4p. Instead, the SWI/SNF complex appeared to be present
constitutively at the HIS3 promoter and on the HIS3
gene.
As a positive test for the recruitment of the SWI/SNF
complex by Gcn4p, the ARG1 promoter was examined by using the
same IP samples. ARG1 is also induced by 3-AT via starvation
for histidine and consequent activation of GCN4 mRNA for
translation (5). There is
good evidence for Gcn4p-dependent recruitment of the SWI/SNF complex to
the ARG1 promoter
(43). This observation
was confirmed: induction with 3-AT resulted in a threefold increase in
Snf2-FLAG levels at the ARG1 promoter relative to
POL1 (Fig. 5D).
It was also clear that the SWI/SNF complex was present at the
ARG1 promoter in uninduced cells at levels similar to those
observed at the HIS3 promoter (Fig.
5A). The 3-AT-induced
increase in the binding of the SWI/SNF complex at the ARG1
promoter was abolished in the gcn4
mutant, showing
that it was dependent on Gcn4p. We conclude that Gcn4p recruited
additional SWI/SNF complex to the ARG1 promoter in
3-AT-treated cells but not to the HIS3 promoter.
ChIP
experiments were used to confirm that Gcn4p binds at the HIS3
promoter on induction. A gcn4
strain was transformed
with a centromeric plasmid carrying GCN4 tagged with 13 myc
epitopes at its C terminus or with empty vector as a control (Fig.
5E). These strains also
carried the SNF2-FLAG gene. In 3-AT-treated cells, there was a
3.5-fold increase in the binding of Gcn4-myc relative to Int-V as
internal control (the same result was obtained using POL1 as
internal control [data not shown]). In the uninduced and partially
induced conditions (i.e., no 3-AT), Gcn4p was detected at the
HIS3 promoter but at lower levels (twofold). The binding of
Snf2-FLAG at the HIS3 promoter was also constitutive in these
strains (not shown).
All Gcn4p-dependent genes are affected in a
gcn4
strain, resulting in pleiotropic effects. This
problem was circumvented by constructing a strain with a mutated Gcn4p
binding site and expressing both SNF2-FLAG and
GCN4-myc. The mutation was a single-base deletion (of the
first T in the TGACTC sequence recognized by
Gcn4p; the his3-142 mutation
[34]). In order to
introduce this mutation into the chromosomal HIS3 gene, it was
necessary to insert a selection marker (ADE2) into the
HIS3 ORF, rendering the strain unable to grow in the absence
of histidine. Consequently, the induction procedure was altered: cells
were grown in medium containing histidine, rapidly harvested,
resuspended for an hour in medium lacking histidine, and then induced
with 3-AT for 20 min prior to cross-linking. ChIP experiments were
performed to confirm the absence of Gcn4p at the mutated HIS3
promoter (Fig. 5F). Gcn4p
was not detected at the mutated HIS3 promoter in uninduced or
in 3-AT-induced cells. However, Gcn4p was observed at the wild-type
promoter after a 3-AT-induction of an otherwise identical strain
(4.5-fold over POL1), as expected. As a positive control, the
presence of Gcn4p at the ARG1 promoter was confirmed in both
strains: Gcn4p cross-linked very well in uninduced cells (15- to
25-fold) and extremely well in 3-AT-induced cells (60- to 80-fold). The
much higher degree of cross-linking of Gcn4p at the ARG1
promoter relative to the HIS3 promoter in wild-type cells
might reflect more efficient cross-linking, but such a large difference
might indicate that Gcn4p bound more tightly at ARG1 than at
HIS3. There was no significant difference in the amount of
SWI/SNF at the HIS3 promoter (or at POL1) in the
presence or absence of bound Gcn4p (Fig.
5F). This experiment
provides further evidence that Gcn4p does not recruit additional
SWI/SNF to the HIS3
promoter.
Isw1p is constitutively present on the HIS3 gene, but excluded from the HIS3 promoter.
We tested whether
Isw1p is present at HIS3 and whether its presence at
HIS3 is dependent on the Gcn4p activator or on the SWI/SNF
remodeling machine by using a strain with FLAG-tagged ISW1
(Fig.
6). In cells with FLAG-tagged Isw1p, the IP signals observed for the
POL1 control were at least 10 times those obtained either in
the absence of antibody (mock) or with a strain lacking the FLAG tag
(wild type), indicating that Isw1p was present in the middle of the
POL1 gene. In uninduced cells, Isw1p was modestly depleted at
the HIS3 promoter relative to POL1 (about twofold)
(Fig. 6A). Induction
resulted in further depletion of Isw1p from the HIS3 promoter
(about threefold relative to POL1). The induction-dependent
depletion of Isw1p was partly dependent on the SWI/SNF complex since it
was significantly weaker in the snf2
strain (Fig.
6A), suggesting that the
SWI/SNF complex might play a role in depleting the HIS3
promoter of Isw1p. In the absence of the Gcn4p activator, there was
also a depletion of Isw1p relative to POL1 (three- to
fivefold) independent of growth condition. This result suggested that
Gcn4p might recruit Isw1p to the HIS3 promoter. However, Isw1p
was detected at high levels on the HIS3 coding region,
independent of growth condition, Gcn4p, and the SWI/SNF complex (Fig.
6B). This observation
indicates that Isw1p is excluded from the promoter upon HIS3
induction rather than recruited to it.
|
) and highly induced (wild type
treated with 3-AT); under these conditions, different blocking
complexes might be present at the promoter. The SWI/SNF complex appears
to be a contributing factor, although it did not affect the presence of
Isw1p on the coding region even though both complexes were present
there. | DISCUSSION |
|---|
|
|
|---|
An important issue is whether the chromatin structure of HIS3 is typical of yeast genes. We have studied nucleosome positions on only one other gene, CUP1 (28-30), with similar results. However, since we were unable to identify the remodeling complexes acting at CUP1, we turned to HIS3 for further studies, because it was known to be affected by the SWI/SNF complex. Most of the work described here necessarily utilized plasmid rather than chromosomal chromatin, but our indirect end-labeling study strongly suggests that HIS3 plasmid chromatin is a good model for chromosomal HIS3 chromatin.
We conclude that there is good agreement on the nucleosome positions constituting the predominant array on HIS3, both in the plasmids and in the chromosome. However, we observed additional, alternative nucleosomal arrays using the monomer extension method. This reflects the fact that the indirect end-labeling method cannot detect more than one nucleosomal array because it depends on identifying nucleosomes by finding nucleosome-sized gaps in the MNase cleavage pattern. Indirect end-labeling experiments often provide data with series of major bands too close together to be assigned to positioned nucleosomes, and it is usually concluded that there are no positioned nucleosomes. We suggest that these patterns might actually reflect the presence of multiple alternative arrays of positioned nucleosomes with no predominant arrays.
The nucleosome density profile of HIS3.
Recently, both
nucleosome scanning and histone ChIP were used to measure the
nucleosome densities of HIS3 and other yeast genes
(26). The nucleosome
scanning method involves the preparation of mononucleosomal DNA for use
as template in a series of PCRs utilizing primer pairs spaced about 30
bp apart to measure the relative amount of DNA in nucleosomes along a
gene of interest. Another recent study
(44) used nucleosomal DNA
in a similar way to probe microarrays to measure nucleosome density on
a genomic scale. Both studies reported a sinusoidal nucleosome density
profile along part of the HIS3 gene, with peaks and troughs
that coincide quite well with the approximate nucleosome positions
derived by indirect end labeling. Although these reported positions
also agree quite well with our D array, our data indicate that the D
array is predominant in only gcn4
and
snf2
chromatin. In wild-type cells, our monomer
extension data revealed the presence of multiple overlapping arrays
(Fig. 2A). However, the
monomer extension method determines nucleosome positions, whereas
indirect end-labeling can reveal only a predominant array, and the ChIP
and nucleosome scanning methods report histone or nucleosome density,
which are not necessarily the same as nucleosome position.
To
compare our high-resolution positioning data with the published
nucleosome density data, we converted our data to a nucleosome density
function. This is possible because the relative amounts of each
nucleosome are given by the scan of a single monomer extension lane
(the data in Fig. 1 were
used). The HIS3 gene was divided into 5-bp intervals, and each
nucleosome was assumed to occupy 145 bp. Each nucleosome (i.e., D1 to
D5 and A4 to A25) was given a score equal to its phosphorimager signal
corrected for background; this score was placed in the 29 bins of 5 bp,
corresponding to the 145 bp it occupies on HIS3 (Fig.
7A). The scores for each nucleosome at each 5-bp interval
were summed across the HIS3 gene. The score was then plotted
as a percentage of the total nucleosomal signal against HIS3
coordinate. For illustrative purposes, the signals for only the D array
(in gcn4
chromatin) are shown in Fig.
7B. From this, it is
obvious that a square waveform is predicted for a single nucleosomal
array; the amplitude corresponding to each nucleosome should be the
same in the case of a unique array (i.e., if nucleosomes are in
identical positions on all copies of HIS3). Thus, the
sinusoidal waveforms observed by others
(26,
44) are not really
consistent with a unique array of nucleosomes, although it might be
argued that the square wave function is smoothed out at lower
resolution (but see below).
|
chromatin, there are five peaks, reflecting the
contribution of the predominant D array. In wild-type chromatin, there
are only four peaks, although the first peak has a shoulder, reflecting
the contribution of the D2 nucleosome. These patterns are very similar
to those observed by other researchers
(26), who mapped about
half of the HIS3 gene by nucleosome and H4 ChIP scanning; the
main difference is that the other researchers resolved D1 and D2
clearly, whereas we did not. Otherwise, the positions of the peaks and
troughs are the same (once the different HIS3 coordinates used
in reference 26 are taken
into account). In the microarray study
(44), only the first
nucleosome on HIS3 (equivalent to D1) is shown; its position
is in agreement with our data and those of others
(26). The patterns
reported for many other genes
(44) are strikingly
similar to the nucleosome density profiles we report here (Fig.
7). Thus, our monomer
extension data predict a nucleosome density pattern just like that
observed for HIS3 using the nucleosome/ChIP scanning assays,
even though multiple overlapping positions are present. Therefore, we
suggest that the yeast genome might not be composed mostly of uniquely
positioned nucleosomes as proposed
(44). Instead, the
microarray data could be interpreted to indicate that the genome is
organized into multiple alternative nucleosomal arrays, similar to
those we have observed on HIS3. In conclusion, there is an underlying long-range order in the overlapping arrays of nucleosomes on HIS3, with maxima and minima in nucleosome density. This results from the summation of the square wave functions for each overlapping nucleosome array (as in Fig. 7B), yielding a "constructive interference" pattern corresponding to the nucleosome density. In physical terms, the pattern indicates that the alternative positions occur in clusters, resulting in maxima and minima.
The Gcn4p activator and the SWI/SNF complex direct nucleosome mobilization over the entire HIS3 gene. Our observations suggest that, in wild-type cells, HIS3 chromatin is organized into one of several alternative nucleosomal arrays. In the absence of Gcn4p or the SWI/SNF complex, the D array is predominant, though it is not the only significant array. Thus, both Gcn4p and SWI/SNF are required for mobilizing nucleosomes from positions in the D array to positions in the alternative A arrays. It seems likely that the SWI/SNF complex is directly responsible for mobilizing the nucleosomes on the HIS3 gene since it is capable of mobilizing nucleosomes in vitro (24). Consistent with this model, our ChIP experiments indicate that the SWI/SNF complex is present at the HIS3 promoter and on the HIS3 gene. Our data indicate that the effects of the SWI/SNF complex are not limited to the chromatin structure of the promoter but include that of the entire HIS3 gene.
An alternative possibility might
be that the nucleosome mobilization observed is due to the passage of
RNA polymerase II rather than the direct consequence of SWI/SNF
activity. Although it is difficult to rule this model out entirely,
there is some evidence against it. Firstly, the D array is predominant
in HIS3 chromatin from gcn4
and
snf2
cells even though the levels of basal
transcription are quite high
(9). Secondly, the TATA
box mutations we have described previously
(9) do not affect
nucleosome positions; the monomer extension map resembles wild-type
chromatin, even though the levels of HIS3 transcription are
very low (not shown).
It was expected that the role of Gcn4p in mobilization is to recruit the SWI/SNF complex to the HIS3 promoter. However, we found that SWI/SNF is present at HIS3 independently of Gcn4p. The simplest explanation for our observations is that SWI/SNF is not recruited to HIS3; it is present constitutively. Alternatively, some additional SWI/SNF might indeed be recruited by Gcn4p but rapidly departs from the HIS3 promoter, moving down the gene. Another possibility is that a Gcn4p-independent mechanism is responsible for the recruitment of SWI/SNF to HIS3, perhaps involving the general transcription factors (27). The recruitment of additional SWI/SNF by Gcn4p at ARG1 might reflect the contribution of other transcription factors not present at HIS3, such as the ArgR complex, which associates with the ARG1 promoter in a Gcn4p-dependent manner (42). In any case, the presence of the SWI/SNF complex on the HIS3 coding region is consistent with a role in gene-wide nucleosome mobilization.
The role of the Isw1 complex in remodeling HIS3 chromatin appears to be more subtle than that of SWI/SNF; it is involved in minor but significant changes in HIS3 chromatin structure. In the absence of Isw1p, a nucleosome-free gap of about 50 bp appears at the 3' end of HIS3, where transcript termination probably occurs, suggesting that Isw1 favors the mobilization of nucleosomes to positions covering this gap. The observed accumulation of RNA polymerase II at the 3' ends of yeast genes in an isw1 mutant (21) might contribute to the formation of this nucleosome-free gap. It has been proposed that the Isw1 complex coordinates transcript elongation and termination (21). The Isw1 complex also appears to influence the relative amounts of the various A and D positions, perhaps favoring the formation of some arrays over others. The constitutive presence of Isw1p on the HIS3 gene is consistent with these structural data. The level of Isw1p at the HIS3 promoter is lower than that on the coding region and is affected by the SWI/SNF complex. However, the marginal effects of Isw1p on HIS3 transcription suggest that these changes in chromatin structure are not very important for HIS3 expression. Like the SWI/SNF complex, the Isw1 complex also influences which positions are occupied by nucleosomes on HIS3 but it favors different positions from the SWI/SNF complex.
A working model for the activation of HIS3 chromatin. We now have a very detailed picture of the activation of HIS3 chromatin. In the absence of Gcn4p or the SWI/SNF complex, the chromatin structure of HIS3 is relatively ordered, with the D array of nucleosomes predominant. In the presence of Gcn4p and the SWI/SNF complex, several overlapping arrays of nucleosomes are formed on the HIS3 gene, indicating that there is a net movement of nucleosomes from the D array to the alternative A arrays. Although this chromatin is more disordered than that formed in the absence of Gcn4p or the SWI/SNF complex, some long-range order persists, as indicated by the nucleosome density profiles, which suggest that the various arrays represent clusters of alternative nucleosome positions. Previously, we have presented evidence suggesting that nucleosomes on the HIS3 gene undergo major conformational changes that are dependent on Gcn4p and the SWI/SNF complex (9). These conformational changes do not substantially affect the protection of nucleosomal DNA from MNase because nucleosomal DNA was prepared in reasonable yield from induced chromatin for monomer extension studies. This is perhaps surprising given the accessibility to restriction enzymes; new experiments aimed at understanding the structural basis of the loss of supercoils from induced chromatin should cast light on this issue.
As a working model, we propose that the binding of Gcn4p at the promoter initiates the formation of a much more dynamic chromatin structure over the entire HIS3 gene, involving nucleosome movements and conformational changes (Fig. 8). In the presence of Gcn4p, increased activity of the SWI/SNF complex on HIS3 results in increased mobilization of nucleosomes from the D positions to the various A positions. The Isw1 complex contributes to this mobilization by mobilizing nucleosomes to different positions from those favored by SWI/SNF. We speculate that the increased dynamics of activated HIS3 chromatin structure might render the underlying DNA more transparent. The continuous movement of nucleosomes by the remodeling complexes envisaged in our model might create windows of opportunity for various factors to bind over the entire HIS3 gene, including the various elongation complexes, stimulating HIS3 transcription.
|