| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
Department of Surgery, University of Virginia School of Medicine, Charlottesville, Virginia
Received 26 May 2006/ Returned for modification 1 August 2006/ Accepted 11 September 2006
| ABSTRACT |
|---|
|
|
|---|
B is constitutively activated in many cancers and is important for cytokine-mediated progression and metastatic movement of tumors. Breast cancer metastasis suppressor 1 (BRMS1) is a metastasis suppressor gene whose mechanisms of action are poorly understood. In this report, we demonstrate that BRMS1 decreases the transactivation potential of RelA/p65 and ameliorates the expression of NF-
B-regulated antiapoptotic gene products. BRMS1 immunoprecipitates with the RelA/p65 subunit of NF-
B with protein-protein interactions occurring at the C terminus region of the rel homology domain but not at its known transactivation domains. Moreover, BRMS1 functions as a corepressor by promoting binding of HDAC1 to RelA/p65, where it deacetylates lysine K310 on RelA/p65, which suppresses RelA/p65 transcriptional activity. Selective small interfering RNA knockdown of BRMS1 confirms that chromatin-bound BRMS1 is required for deacetylation of RelA/p65, while enhancing chromatin occupancy of HDAC1 onto the NF-
B-regulated promoters cIAP2 and Bfl-1/A1. We observed in cells lacking BRMS1 a dramatic increase in cell viability after the loss of attachment from the extracellular matrix. Collectively, these results suggest that BRMS1 suppresses metastasis through its ability to function as a transcriptional corepressor of antiapoptotic genes regulated by NF-
B. | INTRODUCTION |
|---|
|
|
|---|
B has been detected in many human malignant tumors (7, 14, 16, 46, 58, 61). We have previously shown that NF-
B plays an important role in the resistance of non-small-cell lung cancer (NSCLC) to chemotherapy and histone deacetylase (HDAC) inhibition (30, 31, 41). Recently, the importance of cytokine-mediated activation of IKKß and subsequently NF-
B in the promotion and progression of inflammatory-associated epithelial cancers has been identified (23, 32, 48). Furthermore, low levels of the cytokine tumor necrosis factor (TNF) produced by tumor-associated macrophages have been suggested to actually increase tumor growth and metastatic progression through NF-
B-dependent signaling cascades (5, 32). Purported mechanisms through which NF-
B promotes tumor progression and metastatic movement include the upregulation of antiapoptotic gene products, as well as proangiogenic factors (1). Thus, there is increasing evidence that upregulation of cell survival signals via NF-
B is one of the initial critical events that must occur during the metastatic process.
Transcriptionally active NF-
B is typically composed of a heterodimeric protein complex, of which the best studied and most common form is the RelA/p65/p50 heterodimer, where RelA/p65 contains the transactivation domains. Classic activation of NF-
B occurs after IKK isoform phosphorylation of cytosolic I
B, which results in its proteasomal degradation and subsequent liberation of NF-
B which, in turn, translocates into the nucleus, where it enhances transcription (4, 21). Intranuclear NF-
B activity is regulated by transcriptional coregulators that function by connecting sequence-specific activators to the basal transcriptional machinery, in addition to modifying chromatin through their intrinsic histone acetyltransferase (HAT) or HDAC activity (50). RelA/p65 binds to the CBP/p300 transcriptional coactivator, as well as p/CAF, and overexpression of these coactivators enhances the transactivation potential of NF-
B (47, 56). The transcriptional activity of RelA/p65 is also modulated by several HDACs, including HDAC-1, -2, and -3, and SIRT1 (2, 10, 64). Posttranslational modifications are pivotal for chromatin-associated activities of RelA/p65 in that acetylation of RelA/p65 is important for its transcriptional activity and DNA binding, as well as impairing its assembly with I
B
and nuclear exportation (11, 33).
In contrast to the prometastatic role of NF-
B, breast cancer metastasis suppressor 1 (BRMS1) is a gene that was mapped to chromosome 11q13 and was originally identified as a metastasis suppressor gene (55). The BRMS1 protein product is localized predominantly in the nucleus and contains an imperfect leucine zipper motif and various coiled-coil domains (43, 55). BRMS1 mRNA expression has been shown to be markedly reduced in melanoma and breast cancer cell lines, and stable overexpression of BRMS1 in these cell lines significantly inhibited their metastatic potential (13, 54). Interestingly, there is no evidence to date that BRMS1 regulates metastatic movement through alterations in matrix metalloproteinase levels, cellular adhesion profiles, or alterations in tumor cell invasion (52). Recent studies indicate that BRMS1 is a selective component of the mSin3a/HDAC corepressor complex resulting in basal transcription repression as measured by a GAL4 luciferase reporter of the myelomonocytic growth factor minimal promoter (42). BRMS1 has also been shown to negatively regulate the nuclear translocation of NF-
B and urokinase-type plasminogen activator transcripts through processes involving inhibition of I
B
phosphorylation (13).
Given that BRMS1 functions as a metastasis suppressor and has been associated with a known corepressor complex and that NF-
B activation is associated with the development of metastases, we sought to determine whether BRMS1 may be regulating NF-
B transcriptional activity through effects on RelA/p65 acetylation. Using an NSCLC model system, we demonstrate that BRMS1 represses both the basal and inducible transactivation potential of RelA/p65 by functioning as a corepressor for HDAC1 in addition to decreasing HDAC1 binding to RelA/p65. Using site-directed mutagenesis and selective small interfering RNA (siRNA) knockdown of specific HDACs, we have identified that the BRMS1/HDAC1 corepressor complex reduces NF-
B-dependent transcription through deacetylation of RelA/p65 on lysine K310. Futhermore, siRNA knockdown of BRMS1 recruits endogenous acetyl-K310-RelA/p65 to the chromatin of NF-
B-dependent antiapoptotic genes cIAP2 and Bfl-1/A1 promoters while simultaneously inhibiting endogenous HDAC-1 chromatin occupancy. Finally, using an anoikis cell model of metastasis, we demonstrate that BRMS1 significantly increases apoptosis in suspended NSCLC cells after cytokine stimulation.
Collectively, these results indicate that BRMS1 functions as a corepressor that modulates NF-
B-dependent antiapoptotic transcription at the chromatin level. These observations suggest that BRMS1 expression may prevent metastases by the ability of this corepressor to regulate NF-
B transcription and cell survival after the loss of cellular adhesion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
B luciferase reporter (3x-
B-Luc), Gal-4 luciferase construct (Gal4-Luc), expression vectors encoding Gal4-p65 fusion protein (1-286, 286-520, 286-551, 520-551, 1-551, and 286-551/K310R), expression vectors (pGEX) encoding GST-p65 fusion proteins (1-305, 245-455, and 354-551), and plasmids (pCMV) encoding Flag-tagged p65 were previously described (41, 51, 64). Human BRMS1 cDNA was cloned by PCR (the primers were 5'-GTATGAATTCGACCTGTCCAGCCTCCAAGC-3' [forward] and 5'-GTATCTCGAGTCAAGGTCCATCCGATTTTC-3' [reverse]; the restriction sites are underlined) and inserted into hemagglutinin (HA)-tagged pCMV vector (Clontech, Palo Alto, CA) and pcDNA3.1(+) vectors (Invitrogen, Carlsbad, CA) using the restriction enzymes EcoRI and XhoI (New England Biolabs, Beverly, MA). Human HDAC1 was cloned by PCR (the HDAC1 primers were 5'-CGGAATTCACGATGGCGCAGACGCAGGGCAC-3' [forward] and 5'-CGGAATTCGGCCAACTTGACCTCCTCCTTG-3' [reverse]) and inserted into pcDNA3.1(+) vectors using EcoRI sites. siRNA SMART pool human BRMS1, HDAC1, HDAC3, and siCONTROL nontargeting siRNA were purchased from Dharmacon (Chicago, IL). The antibodies used in the present study were as follows: BRMS1 (Abnova Corp., Taiwan); RelA/p65, mSin3A, p300, myc, and normal rabbit immunoglobulin G (IgG; Santa Cruz Biotechnology, Santa Cruz, CA);
-acetyl-lysine, HDAC1, HDAC3, Ac-H3(Lys9/Lys14), and Ac-H4 (Lys8) (Cell Signaling Technology, Beverly, MA); M2 Flag-epitope tag, ß-tubulin, and
-tubulin (Sigma Aldrich, St. Louis, MO); and HA-epitope tag (BD Biosciences, Palo Alto, CA). Acetyl-p65 (K310) antibody was kindly provided by Marty W. Mayo (Charlottesville, VA). Recombinant TNF was purchased from Sigma (St. Louis, MO). The TNT T7 Quick-Coupled transcription/translation system was obtained from Promega Biosciences (San Luis Obispo, CA).
Total RNA isolation, quantitative reverse transcriptase PCR (RT-PCR), and NF-
B-regulated gene expression assays.
Total RNA was extracted by using TRIzol (Invitrogen) according to the manufacturer's protocol. In brief, 106 cells or 100 mg of tissue was lysed with 1 ml of TRIzol, and the proteins were separated by chloroform. RNAs were precipitated with isopropanol, and cDNAs were synthesized by using an Advantage RT for PCR enzyme kit (Clontech, Palo Alto, CA). BRMS1 expression was determined by real-time PCR with an iCycler IQ (Bio-Rad, Hercules, CA). The human BRMS1 primers were TGCAGCGGAGCCTCAAG (forward) and TCACATCCAGACAGAAGCCCT (reverse). Human HPRT gene was amplified as a reference gene (38). Real-time PCR quantification was processed. The expression of BRMS1 (
TC) was normalized by an endogenous reference gene (HPRT) (TCR). The
TC value was calculated by subtracting the TC value of the reference (TCR) from the TC value of the sample (TCS):
TC = TCS TCR. The relative expression (2
TC) to a calibrator (placenta RNA; Clontech, Palo Alto, CA) was determined by subtracting the
TCC (calibrator,
TCC = TCCS TCCR) from the
TC value (
TC =
TCC (calibrator)
TC).
For NF-
B-regulated gene expression assays, HEK 293T cells or H1299 cells were plated 24 h before transfection. For BRMS1 overexpression assays, BRMS1 expression vector or empty vector as a control was transiently transfected by using Polyfect reagent (QIAGEN, Valencia, CA) according to the manufacturer's instructions. For BRMS1 knockdown assay, siRNA BRMS1 or siRNA control (100 nM) was transfected by using Oligofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The day after transfection, an additional 100 nM siRNA was transfected into H1299 cells as described above. At 36 h after the first transfection, TNF (10 ng/ml) was added to the cells for an additional 12 h. Total RNA was extracted by using TRIzol, followed by real-time RT-PCR as described above. The PCR primers used were as follows: cIAP-2, the 5'-GCTGTGATGGTGGACTCAGG-3' (forward) and 5'-TGGCTTGAACTTGACGGATG-3' (reverse); Bfl-1/A1, 5'-TCATATTTTGTTGCGGAGTTCA-3' (forward) and 5'-TCCAGCCAGATTTAGGTTCAAA-3' (reverse); Bcl-xL, 5'-GCATTGTGGCCTTTTTCTCC-3' (forward) and 5'-GCTGCTGCATTGTTCCCATA-3' (reverse); VCAM-1, 5'-GCTGCTCAGATTGGAGACTCA-3' (forward) and 5'-CGCTCAGAGGGCTGTCTATC-3' (reverse); ICAM-1, 5'-CTGTGTCCCCCTCAAAAGTC-3' (forward) and 5'-GGGGTCTCTATGCCCAACAA-3' (reverse); E-Selectin, 5'-TGAAGCTCCCACTGAGTCCAA-3' (forward) and 5'-GGTGCTAATGTCAGGAGGGAGA-3' (reverse); and GAPDH, 5'-CTACACCTTGCCTGTGAGCA-3' (forward) and 5'-GACACGTGTGGCCATTGTAG-3' (reverse).
Transfection and luciferase reporter assays. Plasmids and reporters were transiently cotransfected to cells at 40 to 60% confluence by using Polyfect reagent as described above. Luciferase reporter activity assays were performed as previously described (41). ß-Galactosidase activities were analyzed as control for the efficiency of transfection. Luminescence was normalized to protein concentrations, and all transfection data are means ± the standard deviations (SD) of three independent experiments performed in triplicate analyses.
Immunoprecipitation and Western blot. HEK 293T cells were transfected with expression vectors encoding Flag-tagged p65, HA-tagged BRMS1, or both. Cells were harvested 48 h after transfection. In select experiments, HEK 293T cells were transfected with siRNA BRMS1 or control. For immunoprecipitation assays, primary antibody (2 µg of anti-HA-epitope tag, 3.4 µg of anti-Flag-epitope tag, 3.1 µg of anti-ß-tubulin, 4 µg of anti-myc, 4 µg of anti-p65, 4 µg of anti-BRMS1, 4 µg of anti-HDAC1, or 4 µg of anti-HDAC3) was mixed with precleared cell lysates for an hour at 4°C before the addition of 30 µl of protein agarose A/G (Santa Cruz, Santa Cruz, CA), and reactions were tumbled overnight at 4°C. The agarose beads were extensively washed, and the eluted protein was resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by immunoblot analysis. All Western blots were performed according to standard procedures. Proteins were separated by SDS-12% PAGE. After transfer, nitrocellulose membranes (Bio-Rad, Hercules, CA) were probed with primary antibodies at a 1:1,000 dilution and secondary antibodies (Promega, Madison, WI) at a 1:5,000 dilution in blocking solution. Proteins were visualized with enhanced chemiluminescent substrate (Pierce Biotechnology, Rockford, IL).
GST binding assays. Glutathione S-transferase (GST)-p65 fusion proteins were expressed in Escherichia coli BL21 (Amersham, Piscataway, NJ) and purified as described previously (18). The relative abundance of the fusion protein to GST was evaluated by using an SDS-10% PAGE gel stained with Coomassie blue. pcDNA3.1(+)-BRMS1 expression vector was translated with the TNT reticulocyte system binding with 35S-labeled methionine (Amersham, Piscataway, NJ) according to the manufacturer's protocol. Labeled BRMS1 was rocked for 2 h at room temperature with GST-p65 fusion proteins in a total volume of 500 µl of NETN buffer (20 mM Tris-HCl [pH 7.5], 100 mM KCl, 0.7 mM EDTA, 0.05% Nonidet P-40, and 1 mM phenylmethylsulfonyl fluoride). The reactions were extensively washed in NETN buffer, and the bound proteins were resolved on 15% denaturing SDS-PAGE gels for analysis by autoradiography.
RelA/p65 deacetylation assays. RelA/p65 deacetylation assays were performed as previously described (11). HEK 293T cells were transfected with expression vector encoding HA-tagged BRMS1 or empty vector. In select experiments, cells were cotransfected with siRNA HDAC1, HDAC3, or siRNA control as described above. After treatment with TNF (0, 20, or 40 ng/ml) for 1 h, cell lysates were resolved on SDS-PAGE gels and immunoblotted with a specific acetyl-p65(K310) antibody. For in vitro deacetylation assays, HEK 293T cells were cotransfected with expression vectors encoding Flag-tagged p65 with or without p300. Cell lysates were immunoprecipitated with 4 µg of Flag antibody. RelA/p65 deacetylation assays were performed by incubating 20 µl of immunoprecipitated Flag-RelA/p65 protein with 10 µl of in vitro-translated BRMS1 protein and/or increasing amounts of HDAC1 protein by using the TNT reticulocyte system in HDAC buffer (10 mM Tris-HCl [pH 8.0], 10 mM NaCl, 10% glycerol) for 2 h at room temperature. The reactions were washed three times in HDAC buffer and then analyzed by immunoblotting with a pan-acetyl-lysine antibody.
Caspase-3, DNA fragmentation, and cell death assays. HEK 293T cells or H1299 cells were transiently transfected with pCMV-BRMS1 expression vector or empty vector as control. Cells were left untreated or treated with TNF (50 ng/ml) 24 h after transfection. At 48 h posttransfection, apoptosis was quantified by quantitation of nucleosomes released into the cytoplasm using a cell death detection ELISA Plus kit (Roche Applied Science) according to the manufacturer's directions. Caspase-3 activity was determined by the addition of an APC-DEVD protein conjugate (Calbiochem, San Diego, CA) to cellular extracts containing 30 µg of protein. The fluorescence of caspase-3-cleaved protein conjugates was measured. For cell death assays, BRMS1 was overexpressed by transfecting pCMV-BRMS1 expression vector or empty vector as a control or suppressed by transfecting siRNA BRMS1 or siRNA control into HEK 293T and H1299 cells as described above. At 48 h after transfection, cells were suspended, respectively, for 0, 0.5, 1, 2, or 3 h. Cells were then replated, and the percentage of cell death was obtained by enumerating the trypan blue-positive cells versus the total number of cells after an additional 24 h of incubation.
ChIP.
For overexpression experiments, HEK 293T cells were transfected with pCMV-BRMS1 or empty vector. For RNA interference experiments, HEK 293T cells were transfected with siRNA BRMS1 or siRNA control as described above. After 36 h, the cells were left untreated or were treated with TNF (10 ng/ml) for an additional 12 h. Chromatin immunoprecipitation (ChIP) assays were performed as described previously (34). DNA was immunoprecipitated with 4 µl of antibody (anti-BRMS1, anti-p65, anti-p50, anti-mSin3A, anti-acetyl-p65 K310, anti-HDAC1, anti-HDAC3, Ac-H3, Ac-H4, or normal rabbit IgG) and purified. The regions of the human cIAP-2 and Bfl-1/A1 promoters containing
B binding sites were targeted for amplification as described previously (38). PCR data were analyzed as previously described (8).
Statistical analysis. The results of all experiments represent the means ± the SD of three separate experiments performed in triplicate unless otherwise noted. Statistical differences between control and BRMS1 groups were determined by a two-tailed, unpaired Student t test when appropriate. P values of <0.05 were considered significant.
| RESULTS |
|---|
|
|
|---|
|
BRMS1 represses the transactivation potential of RelA/p65.
Previous studies have indicated that the nuclear translocation and DNA-binding activity of NF-
B is suppressed in breast cancer MDA-MB-231 and melanoma C8161.9 cell lines that stably overexpress BRMS1 (13). To determine whether BRMS1 could abolish NF-
B transcriptional activity in our system, transient-transfection 3x-
B luciferase assays were performed after treatment with TNF. We chose TNF as a stimulus based its ability to enhance the metastatic progression of epithelial cancers in an NF-
B-dependent manner (32). As shown in Fig. 2A, BRMS1 dramatically diminished basal and TNF-induced NF-
B transcriptional activity in both cell lines. Failure of BRMS1 to affect transcription in cells expressing a mutant 3x-
B-Luc reporter gene confirms NF-
B specificity. Given that BRMS1 has been shown to affect NF-
B through decreased cytosolic I
B processing (13), we sought to specifically examine the ability of BRMS1 to regulate the transactivation potential of RelA/p65 only. To accomplish this, Gal4/p65-Luc reporter gene assays were performed (Fig. 2B). These demonstrated that BRMS1 significantly represses the transactivation potential of RelA/p65 after TNF stimulation.
|
B-dependent antiapoptotic genes (cIAP-2, Bfl-1/A1, and BclxL) (9, 60, 67), 293T cells were transfected with expression vector encoding BRMS1 and quantitative RT-PCR was performed (Fig. 2C). BRMS1 significantly decreased TNF-induced cIAP-2, Bfl-1/A1, and Bcl-xL transcripts. To determine whether BRMS1 also decreased other NF-
B-regulated genes known to be involved in metastasis, RT-PCR experiments were repeated for the intracellular adhesion proteins ICAM, VCAM, and E-selectin (36, 37, 59). As shown in Fig. 2D, there was no significant effect of BRMS1 overexpression on these transcripts, as well as no effect on the non-NF-
B regulated gene GAPDH. To confirm that regulation of NF-
B-regulated antiapoptotic genes is specific to BRMS1, selective silencing of BRMS1 expression using siRNA resulted in a robust rescue of all of these antiapoptotic genes (Fig. 2E). These results indicate that BRMS1 inhibits the transactivation potential of RelA/p65 and establishes the first evidence that BRMS1 may modulate cancer cell survival through transcriptional repression of NF-
B-regulated antiapoptotic genes.
BRMS1 coimmunoprecipitates with the RelA/p65 and p50 subunits of NF-
B.
We next determined whether BRMS1 could coimmunoprecipitate with components of NF-
B that are known to have antiapoptotic function, RelA/p65 and p50. Exogenous RelA/p65 or BRMS1 were reciprocally immunoprecipitated after the overexpression of HA-tagged BRMS1 and Flag-tagged RelA/p65 (Fig. 3A). The negative control, ß-tubulin monoclonal antibody, or myc polyclonal antibody failed to detect the immunoprecipitation protein complexes, confirming the specificity for the anti-Flag and anti-HA antibodies, respectively. Although coimmunoprecipitation of BRMS1 and RelA/p65 occurred in these overexpression assays, we wanted to determine whether these two proteins would interact in a similar fashion endogenously. As shown in the reciprocal coimmunoprecipitation assays in Fig. 3B, endogenous BRMS1 in nuclear extracts does coimmunoprecipitate with both endogenous RelA/p65 and p50. This association between BRMS1 and the nuclear RelA/p65 and p50 subunits of NF-
B implies that BRMS1 may affect NF-
B transcription by directly interacting with the RelA/p65-p50 heterodimer.
|
B.
RelA/p65 contains an N-terminal Rel homology domain (RHD) consisting of approximately 286 amino acids which mediates DNA binding and dimerization (22). Three transactivation domains are present in the C terminus region of RelA/p65, which regulate the interaction of NF-
B with various basal transcriptional components and also associates with p300/CBP transcriptional coactivators (3, 20, 22, 47, 56). To further characterize the protein binding domains between BRMS1 and RelA/p65, we performed GST pull-down assays. GST and truncated GST-RelA/p65 fusion proteins (Fig. 3C) were used to examine their interaction with BRMS1 in an in vitro rabbit reticulocyte transcription/translation system. As shown in Fig. 3D, BRMS1 was found to strongly bind to GST-RelA/p65(245-455) fusion protein and to modestly interact with GST-RelA/p65(1-305) fusion protein but not to GST alone and the GST-RelA/p65(354-551) construct. This suggests that the region of RelA/p65 which directly interacts with BRMS1 is primarily located between amino acids 245 and 354 of RelA/p65. This region corresponds to the C-terminal end of the RHD but does not include the transactivation domains of RelA/p65. To determine whether there was a correlation between the BRMS1-binding regions within the RelA/p65 protein and the transactivation potential of RelA/p65, Gal4/p65 constructs were ectopically expressed in the 293T system, and the Gal4/p65 luciferase activity was determined in the presence or absence of BRMS1. Maximal BRMS1-mediated repression of RelA/p65 transactivation occurred in cells overexpressing the Gal4-RelA/p65(286-551) and Gal4-RelA/p65(286-520) proteins (Fig. 3E). BRMS1 had little to no ability to repress RelA/p65 transactivation at the N-terminus and C-terminus regions of the protein. Collectively, these data suggest that BRMS1-mediated repression of the transactivation potential of RelA/p65 could be the result of direct binding between the two proteins within the region located between amino acids 245 and 354 of RelA/p65.
BRMS1 deacetylates RelA/p65 on lysine residue 310. The transactivation potential of RelA/p65 is regulated in part through its reversible acetylation (11, 64). The RelA/p65 protein is known to be acetylated at five lysine (K) residues, 122, 123, 218, 221, and 310. K310 is known to be the most important for the full transactivation function of RelA/p65 (33, 64). Based on our data to this point, we next hypothesized that BRMS1 may repress the transactivation potential of RelA/p65 by modulation of its acetylation state. Using our anti-acetyl RelA/p65 K310 antibody, deacetylation assays were performed which show that endogenous RelA/p65 is acetylated on K310 in dose-dependent manner after stimulation with TNF. Importantly, the addition of BRMS1 effectively deacetylated RelA/p65 on K310 despite escalating doses of TNF (Fig. 4A).
|
BRMS1 functions as a corepressor for RelA/p65 deacetylation.
To determine which class of HDACs is primarily responsible for BRMS1-mediated deacetylation of RelA/p65, 3x-
B luciferase assays were repeated in the presence of HDAC inhibitors. Trichostatin A (TSA) is a typical inhibitor for class I and II HDACs but not for class III (40). Nicotinamide (NAM) is a specific negative regulator of class III HDACs (6). TSA significantly rescued the BRMS1 repression of basal and TNF-induced NF-
B-dependent transcription, but NAM did not (Fig. 5A). Thus, inhibition of class I/II HDACs, but not class III, is involved in BRMS1-mediated deacetylation of RelA/p65.
|
Although we have demonstrated that BRMS1 abolishes acetylation of RelA/p65 on K310, it is unclear whether this deacetylation is due to histone deacetylases known to associate with BRMS1 or, alternatively, whether BRMS1 itself has intrinsic deacetylase activity. To experimentally address this question, RelA/p65 was first acetylated using p300 in vivo and then incubated in vitro with translated BRMS1, increasing doses of HDAC1, or both. The addition of BRMS1 protein alone was unable to deacetylate RelA/p65. HDAC1 alone produced a modest deacetylation of RelA/p65, but when both recombinant proteins were added, significant deacetylation of RelA/p65 was observed (Fig. 5D). To confirm the requirement for BRMS1 in deacetylating RelA/p65, these in vitro deacetylation assays were repeated with increasing doses of HDAC1 alone and no BRMS1, and only modest deacetylation was observed (Fig. 5D). These results indicate that BRMS1 alone does not possess intrinsic HDAC activity; however, when expressed with HDAC1, together they effectively deacetylate RelA/p65.
In order to confirm that the ability of BRMS1 to deacetylate RelA/p65 was due to binding with HDAC1, we used RNA interference to separately knockdown HDAC1 or HDAC3 expression in the presence of BRMS1. As shown in Fig. 5E, selective HDAC1 knockdown in the presence of BRMS1 resulted in a partial rescue of endogenous RelA/p65 acetylation (compare lanes 10 and 11), but HDAC3 knockdown did not (compare lanes 10 and 12). In a similar experimental design, the transcriptional activity of NF-
B was partially rescued after the loss of HDAC1 even in the presence of BRMS1 overexpression with no demonstrable rescue following HDAC3 knockdown (Fig. 5F). Interestingly, in both deacetylation (Fig. 5E) and NF-
B transcriptional activity assays (Fig. 5F), knockdown of HDAC1 was unable to completely abolish BRMS1-mediated RelA/p65 deacetylation or repression of NF-
B transcriptional activity, suggesting that there are other HDACs that tether BRMS1. Despite these results, the data presented indicate that the BRMS1/HDAC1 complex functions to regulate the deacetylation of RelA/p65.
Silencing of chromatin-bound BRMS1 promotes acetylation of RelA/p65 and decreases HDAC1 loading to NF-
B-dependent promoters.
To elucidate whether there was a direct correlation between BRMS1 deacetylation of RelA/p65 and repression of NF-
B mediated transcription, ChIP assays were performed across the promoter of two NF-
B-regulated antiapoptotic cIAP-2 and Bfl-1/A1 genes in the 293T and H1299 NSCLC cells. The H1299 cells were chosen because they have a reduced BRMS1 expression relative to the 293T cells. There are three putative NF-
B binding sites identified in cIAP-2 promoter at positions 147, 197, and 210 and one putative NF-
B binding element in Bfl-1/A1 promoter at position 823 (15, 27). As noted previously, unrelated downstream sequences in both of genes were also amplified as a control (see Fig. S1 in the supplemental material).
As shown in Fig. 6A and B, RNA interference inhibition of BRMS1 dramatically increases TNF-mediated endogenous acetylation of RelA/p65 (K310) on chromatin as demonstrated using our specific anti-K310 antibody. In addition, selective silencing of BRMS1 concomitantly decreases chromatin occupancy of HDAC1 without affecting HDAC3 loading. This occurs on both the cIAP2 and the Bfl-1/A1 promoters. In contrast, ectopic expression of BRMS1 resulted in enhanced recruitment of HDAC1 to the promoters and a significant reduction in acetylated RelA/p65 (Fig. 6C). Interestingly, RelA/p65 chromatin loading increased with either ectopic expression or silencing of BRMS1, suggesting that BRMS1 does not govern basal or inducible loading of RelA/p65 on chromatin. We also found that as a corepressor, BRMS1 can function as a more global regulator of chromatin structure, as evidenced by its ability to decrease promoter occupancy of Ac-H3 and Ac-H4 on both the cIAP2 and the Bfl-1/A1 promoters. These ChIP findings were not cell type specific since similar results were observed in the H1299 NSCLC cells (see Fig. S2 in the supplemental material).
|
B transcription by modulating the acetylation status of RelA/p65 in an HDAC1-dependent manner.
Modulation of BRMS1 expression sensitizes cells to TNF-induced apoptosis.
Understanding the importance of TNF-mediated tumor growth (32, 48) and our observation that ectopic expression of BRMS1 inhibits NF-
B-dependent antiapoptotic gene expression, we hypothesized that BRMS1 would sensitize cancer cells to apoptotic cell death. To experimentally address this hypothesis, apoptosis assays were performed on 293T cells and H1299 NSCLC cells that transiently overexpressed BRMS1. As shown in Fig. 7A and B, BRMS1 overexpression sensitized cells to TNF-induced apoptosis, as indicated by enhanced DNA fragmentation and caspase-3 activity, respectively.
|
| DISCUSSION |
|---|
|
|
|---|
B, we chose to examine a lung cancer cell model system since lung cancer is a highly metastatic disease (28). One explanation for this is that during tumorigenesis there is a loss of metastasis suppressor function, thus priming the tumor to develop distant metastases. Evidence for this is shown in Fig. 1, where both BRMS1 mRNA and protein are decreased in NSCLC cell lines and human lung cancer tissues compared to normal epithelial lung cell line and adjacent noncancerous lung tissues.
The three separate steps required for a cancer to successfully metastasize are migration, invasion, and avoidance of cell death or apoptosis (17). Prior studies examining putative mechanisms of BRMS1-mediated suppression of metastasis have demonstrated no effect on cancer cell invasion properties, although breast cancer and melanoma cells overexpressing BRMS1 do show a modest decrease in motility compared to parental cells (52, 57). Other studies have also shown in breast cancer cells that BRMS1 restores gap junctional intercellular communication and increases mRNA expression of phosphorylated connexin 43, which is responsible for closing the gap junction communication (39, 53, 62). We have demonstrated here that an additional mechanism through which BRMS1 functions involves the ability of this corepressor to modulate NF-
B-dependent transcription of genes known to regulate cell survival. Casey and coworkers first reported that BRMS1 could modulate NF-
B nuclear translocation through an IKKß-independent inhibition of phosphorylation of I
B, the cytosolic protein that sequesters NF-
B, thus preventing its nuclear translocation (13). We hypothesized that BRMS1, a predominantly nuclear and chromatin-associated protein, could also be regulating NF-
B transcriptional activity.
The present study demonstrates that BRMS1 significantly inhibits NF-
B-dependent transcription, specifically the transactivation potential of RelA/p65. Moreover, we show that selective silencing of BRMS1 restores expression of the NF-
B-dependent antiapoptotic genes cIAP-2, Bfl-1/A1, and BclxL in HEK 293T and NSCLC cells and sensitizes both cell lines to TNF-induced apoptosis (Fig. 2 and 7). Previous studies have shown that antiapoptotic proteins protect cancer cells from anoikis and prolong their survival, thus increasing the likelihood that they will survive following invasion through, and detachment from, the extracellular matrix (49, 66). The regulation of tumor cell viability as cancer cells migrate, invade, and then detach and enter the bloodstream is a key event in tumor metastatic progression. Thus, as demonstrated in the present study, BRMS1-mediated suppression of NF-
B-dependent antiapoptotic gene expression results in a proapoptotic state, priming the tumor for TNF-mediated cell death.
We show that BRMS1 coimmunoprecipitates endogenous RelA/p65 and p50 (Fig. 3). Moreover, BRMS1 directly interacts with the C-terminal region of the RHD of RelA/p65 (amino acids 254 to 354). The functional significance of BRMS1 binding to this region of RelA/p65 is shown in Fig. 3E, where maximal repression of the RelA/p65 transactivation potential occurs in constructs overexpressing this binding domain. Interestingly, HDAC1 has also been described to bind to this region of RelA/p65 as well (65).
While NF-
B transcription is regulated through interactions with its inhibitor I
B, more recent studies have identified the importance of acetylation in regulating its activity (10, 11, 64). The RelA/p65 subunit of NF-
B is acetylated by the coactivators p300, CBP, and p/CAF at five known lysine residues, with acetylation of K310 playing the prominent role in regulation of the full transcriptional activity of RelA/p65 (11, 33). In addition, TNF can also promote acetylation of K310 as demonstrated by us and others (12). Realizing that the binding domain of BRMS1 on RelA/p65 included K310, we wanted to determine whether BRMS1 was repressing RelA/p65 transcriptional activity by promoting deacetylation of this lysine residue. Our findings indicate that BRMS1 completely abolishes TNF stimulated acetylation of RelA/p65 on K310 and that this deacetylation results in a dramatic decrease in the transactivation potential of RelA/p65 after TNF treatment (Fig. 4). This observation is interesting given that TNF, along with interleukin-6 and other cytokines, released from tumor-associated macrophages has been shown to stimulate tumor progression through NF-
B-dependent pathways (32). Our data using siRNA knockdown of BRMS1 support the premise that in cancers lacking BRMS1 there is likely be a more robust response to TNF and other cytokine-mediated transcriptional activation of NF-
B-dependent antiapoptotic gene products, which are known to promote tumor cell survival.
While BRMS1 has been shown to associate with the mSin3a/HDAC complex (42), we demonstrate that BRMS1 itself functions as a corepressor by regulating binding of HDAC1 to RelA/p65 and promoting HDAC1-mediated deacetylation of RelA/p65. In contrast to NCoR and SMRT nuclear corepressors, there is no conserved nuclear receptor interaction motif in BRMS1. In addition, there are no classic hydrophobic regions on BRMS1 that have been associated with some corepressors (29). This observation, and the fact that BRMS1 tethers HDAC1 instead of HDAC3, provides a sharp contrast to other well described corepressors, such as NCoR and SMRT.
Our data demonstrate that chromatin-associated BRMS1 regulates the acetyl-K310 RelA/p65 status on the NF-
B-dependent cIAP-2 and Bfl-1/A1 promoters (Fig. 6). We cannot dismiss the role of mSin3a and its potential contribution to the inhibition of RelA/p65-dependent transcription since there is a concomitant decrease in mSin3a on chromatin after the loss of BRMS1. In addition, given the corepressor function of BRMS1, it is not surprising to see that it can also modify chromatin structure through enhanced deacetylation of histone tails H3 and H4. However, as noted in Fig. 5, in vitro coexpression of both BRMS1 and HDAC1 is sufficient to efficiently deacetylate RelA/65. Thus, BRMS1 enhances the repression of endogenous NF-
B-dependent antiapoptotic genes by promoting HDAC-1-mediated deacetylation of RelA/p65 directly on chromatin.
In summary, we demonstrate that the metastasis suppressor BRMS1 directly interacts with RelA/p65 and inhibits its transactivation potential, in part, by functioning as a corepressor for HDAC1-mediated deacetylation of RelA/p65. The loss of BRMS1 is likely to affect other transcription factors (i.e., AP1, STAT, etc.) that are regulated by HDAC1 and are involved in cancer cell survival signal transduction pathways. Future studies will focus on upstream events through which BRMS1 is regulated, particularly as they relate to the ability of BRMS1 to decrease tumor cell survival.
| ACKNOWLEDGMENTS |
|---|
This study was supported in part by a grant from the Commonwealth Foundation for Cancer Research (D.R.J.) and by NIH Surgery Research Training grant T32 HL007849 (P.W.S.).
| FOOTNOTES |
|---|
Published ahead of print on 25 September 2006. ![]()
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
B: the enemy within. Cancer Cell 6:203-208.[CrossRef][Medline]2. Ashburner, B. P., S. D. Westerheide, and A. S. Baldwin, Jr. 2001. The p65 (RelA) subunit of NF-
B interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol. Cell. Biol. 21:7065-7077.
3. Baeuerle, P. A. 1998. I
B-NF-
B structures: at the interface of inflammation control. Cell 95:729-731.[CrossRef][Medline]
4. Baldwin, A. S., Jr. 1996. The NF-
B and I
B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649-683.[CrossRef][Medline]
5. Balkwill, F. 2002. Tumor necrosis factor or tumor promoting factor? Cytokine Growth Factor Rev. 13:135-141.[CrossRef][Medline]
6. Bitterman, K. J., R. M. Anderson, H. Y. Cohen, M. Latorre-Esteves, and D. A. Sinclair. 2002. Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir2 and human SIRT1. J. Biol. Chem. 277:45099-45107.
7. Bours, V., E. Dejardin, F. Goujon-Letawe, M. P. Merville, and V. Castronovo. 1994. The NF-
B transcription factor and cancer: high expression of NF-
B- and I
B-related proteins in tumor cell lines. Biochem. Pharmacol. 47:145-149.[CrossRef][Medline]
8. Chakrabarti, S. K., J. C. James, and R. G. Mirmira. 2002. Quantitative assessment of gene targeting in vitro and in vivo by the pancreatic transcription factor, Pdx1. Importance of chromatin structure in directing promoter binding. J. Biol. Chem. 277:13286-13293.
9. Chen, C., L. C. Edelstein, and C. Gelinas. 2000. The Rel/NF-
B family directly activates expression of the apoptosis inhibitor Bcl-xL. Mol. Cell. Biol. 20:2687-2695.
10. Chen, L., W. Fischle, E. Verdin, and W. C. Greene. 2001. Duration of nuclear NF-
B action regulated by reversible acetylation. Science 293:1653-1657.
11. Chen, L. F., Y. Mu, and W. C. Greene. 2002. Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-
B. EMBO J. 21:6539-6548.[CrossRef][Medline]
12. Chen, L. F., S. A. Williams, Y. Mu, H. Nakano, J. M. Duerr, L. Buckbinder, and W. C. Greene. 2005. NF-
B RelA phosphorylation regulates RelA acetylation. Mol. Cell. Biol. 25:7966-7975.
13. Cicek, M., R. Fukuyama, D. R. Welch, N. Sizemore, and G. Casey. 2005. Breast cancer metastasis suppressor 1 inhibits gene expression by targeting nuclear factor-
B activity. Cancer Res. 65:3586-3595.
14. Dejardin, E., G. Bonizzi, A. Bellahcene, V. Castronovo, M. P. Merville, and V. Bours. 1995. Highly-expressed p100/p52 (NFKB2) sequesters other NF-
B-related proteins in the cytoplasm of human breast cancer cells. Oncogene 11:1835-1841.[Medline]
15. D'Souza, B. N., L. C. Edelstein, P. M. Pegman, S. M. Smith, S. T. Loughran, A. Clarke, A. Mehl, M. Rowe, C. Gelinas, and D. Walls. 2004. Nuclear factor
B-dependent activation of the antiapoptotic bfl-1 gene by the Epstein-Barr virus latent membrane protein 1 and activated CD40 receptor. J. Virol. 78:1800-1816.
16. Duffey, D. C., Z. Chen, G. Dong, F. G. Ondrey, J. S. Wolf, K. Brown, U. Siebenlist, and C. Van Waes. 1999. Expression of a dominant-negative mutant inhibitor-
Balpha of nuclear factor-
B in human head and neck squamous cell carcinoma inhibits survival, proinflammatory cytokine expression, and tumor growth in vivo. Cancer Res. 59:3468-3474.
17. Fidler, I. J. 1995. Critical factors in the biology of human cancer metastasis. Am. Surgeon 61:1065-1066.[Medline]
18. Fischle, W., S. Emiliani, M. J. Hendzel, T. Nagase, N. Nomura, W. Voelter, and E. Verdin. 1999. A new family of human histone deacetylases related to Saccharomyces cerevisiae HDA1p. J. Biol. Chem. 274:11713-11720.
19. Frisch, S. M., and H. Francis. 1994. Disruption of epithelial cell-matrix interactions induces apoptosis. J. Cell Biol. 124:619-626.
20. Gerritsen, M. E., A. J. Williams, A. S. Neish, S. Moore, Y. Shi, and T. Collins. 1997. CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94:2927-2932.
21. Ghosh, S., and M. Karin. 2002. Missing pieces in the NF-
B puzzle. Cell 109(Suppl.):S81-S96.[CrossRef][Medline]
22. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-
B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225-260.[CrossRef][Medline]
23. Greten, F. R., L. Eckmann, T. F. Greten, J. M. Park, Z. W. Li, L. J. Egan, M. F. Kagnoff, and M. Karin. 2004. IKKß links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell 118:285-296.[CrossRef][Medline]
24. Hassig, C. A., T. C. Fleischer, A. N. Billin, S. L. Schreiber, and D. E. Ayer. 1997. Histone deacetylase activity is required for full transcriptional repression by mSin3A. Cell 89:341-347.[CrossRef][Medline]
25. Hoberg, J. E., A. E. Popko, C. S. Ramsey, and M. W. Mayo. 2006. I
B kinase alpha-mediated derepression of SMRT potentiates acetylation of RelA/p65 by p300. Mol. Cell. Biol. 26:457-471.
26. Hoberg, J. E., F. Yeung, and M. W. Mayo. 2004. SMRT derepression by the I
B kinase alpha: a prerequisite to NF-
B transcription and survival. Mol. Cell 16:245-255.[CrossRef][Medline]
27. Hong, S. Y., W. H. Yoon, J. H. Park, S. G. Kang, J. H. Ahn, and T. H. Lee. 2000. Involvement of two NF-
B binding elements in tumor necrosis factor alpha-, CD40-, and Epstein-Barr virus latent membrane protein 1-mediated induction of the cellular inhibitor of apoptosis protein 2 gene. J. Biol. Chem. 275:18022-18028.
28. Jemal, A., R. Siegel, E. Ward, T. Murray, J. Xu, C. Smigal, and M. J. Thun. 2006. Cancerstatistics, 2006. CA Cancer J. Clinicians 56:106-130.
29. Jepsen, K., and M. G. Rosenfeld. 2002. Biological roles and mechanistic actions of co-repressor complexes. J. Cell Sci. 115:689-698.
30. Jones, D. R., R. M. Broad, L. D. Comeau, S. J. Parsons, and M. W. Mayo. 2002. Inhibition of nuclear factor
B chemosensitizes non-small cell lung cancer through cytochrome c release and caspase activation. J. Thorac. Cardiovasc. Surg. 123:310-317.
31. Jones, D. R., R. M. Broad, L. V. Madrid, A. S. Baldwin, Jr., and M. W. Mayo. 2000. Inhibition of NF-
B sensitizes non-small cell lung cancer cells to chemotherapy-induced apoptosis. Ann. Thorac. Surg. 70:930-937.
32. Karin, M., and F. R. Greten. 2005. NF-
B: linking inflammation and immunity to cancer development and progression. Nat. Rev. Immunol. 5:749-759.[CrossRef][Medline]
33. Kiernan, R., V. Bres, R. W. Ng, M. P. Coudart, S. El Messaoudi, C. Sardet, D. Y. Jin, S. Emiliani, and M. Benkirane. 2003. Post-activation turn-off of NF-
B-dependent transcription is regulated by acetylation of p65. J. Biol. Chem. 278:2758-2766.
34. Kuo, M. H., and C. D. Allis. 1999. In vivo cross-linking and immunoprecipitation for studying dynamic protein-DNA associations in a chromatin environment. Methods 19:425-433.[CrossRef][Medline]
35. Laherty, C. D., W. M. Yang, J. M. Sun, J. R. Davie, E. Seto, and R. N. Eisenman. 1997. Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression. Cell 89:349-356.[CrossRef][Medline]
36. Lee, C. W., W. N. Lin, C. C. Lin, S. F. Luo, J. S. Wang, J. Pouyssegur, and C. M. Yang. 2006. Transcriptional regulation of VCAM-1 expression by tumor necrosis factor-alpha in human tracheal smooth muscle cells: involvement of MAPKs, NF-
B, p300, and histone acetylation. J. Cell Physiol. 207:174-186.[CrossRef][Medline]
37. Lee, D. K., J. E. Kang, H. J. Park, M. H. Kim, T. H. Yim, J. M. Kim, M. K. Heo, K. Y. Kim, H. J. Kwon, and M. W. Hur. 2005. FBI-1 enhances transcription of the nuclear factor-
B (NF-
B)-responsive E-selectin gene by nuclear localization of the p65 subunit of NF-
B. J. Biol. Chem. 280:27783-27791.
38. Liu, Y., C. E. Denlinger, B. K. Rundall, P. W. Smith, and D. R. Jones. 21 August 2006, posting date. SAHA induces Akt-mediated phosphorylation of p300 which promotes acetylation and transcriptional activation of RelA/p65. J. Biol. Chem. [Online.] doi: 10.1074/jbc.M604478200.
39. Locke, D. 1998. Gap junctions in normal and neoplastic mammary gland. J. Pathol. 186:343-349.[CrossRef][Medline]
40. Marks, P., R. A. Rifkind, V. M. Richon, R. Breslow, T. Miller, and W. K. Kelly. 2001. Histone deacetylases and cancer: causes and therapies. Nat. Rev. Cancer 1:194-202.[CrossRef][Medline]
41. Mayo, M. W., C. E. Denlinger, R. M. Broad, F. Yeung, E. T. Reilly, Y. Shi, and D. R. Jones. 2003. Ineffectiveness of histone deacetylase inhibitors to induce apoptosis involves the transcriptional activation of NF-
B through the Akt pathway. J. Biol. Chem. 278:18980-18989.
42. Meehan, W. J., R. S. Samant, J. E. Hopper, M. J. Carrozza, L. A. Shevde, J. L. Workman, K. A. Eckert, M. F. Verderame, and D. R. Welch. 2004. Breast cancer metastasis suppressor 1 (BRMS1) forms complexes with retinoblastoma-binding protein 1 (RBP1) and the mSin3 histone deacetylase complex and represses transcription. J. Biol. Chem. 279:1562-1569.
43. Meehan, W. J., and D. R. Welch. 2003. Breast cancer metastasis suppressor 1: update. Clin. Exp. Metastasis 20:45-50.[CrossRef][Medline]
44. Mountain, C. F. 1997. Revisions in the international system for staging lung cancer. Chest 111:1710-1717.[CrossRef][Medline]
45. Nagy, L., H. Y. Kao, D. Chakravarti, R. J. Lin, C. A. Hassig, D. E. Ayer, S. L. Schreiber, and R. M. Evans. 1997. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase. Cell 89:373-380.[CrossRef][Medline]
46. Nakshatri, H., P. Bhat-Nakshatri, D. A. Martin, R. J. Goulet, Jr., and G. W. Sledge, Jr. 1997. Constitutive activation of NF-
B during progression of breast cancer to hormone-independent growth. Mol. Cell. Biol. 17:3629-3639.[Abstract]
47. Perkins, N. D., L. K. Felzien, J. C. Betts, K. Leung, D. H. Beach, and G. J. Nabel. 1997. Regulation of NF-
B by cyclin-dependent kinases associated with the p300 coactivator. Science 275:523-527.
48. Pikarsky, E., R. M. Porat, I. Stein, R. Abramovitch, S. Amit, S. Kasem, E. Gutkovich-Pyest, S. Urieli-Shoval, E. Galun, and Y. Ben-Neriah. 2004. NF-
B functions as a tumour promoter in inflammation-associated cancer. Nature 431:461-466.[CrossRef][Medline]
49. Rodeck, U., M. Jost, J. DuHadaway, C. Kari, P. J. Jensen, B. Risse, and D. L. Ewert. 1997. Regulation of Bcl-xL expression in human keratinocytes by cell-substratum adhesion and the epidermal growth factor receptor. Proc. Natl. Acad. Sci. USA 94