MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
MCB.01263-06v1
26/23/8722    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nouspikel, T. P.
Right arrow Articles by Hanawalt, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nouspikel, T. P.
Right arrow Articles by Hanawalt, P. C.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2006, p. 8722-8730, Vol. 26, No. 23
0270-7306/06/$08.00+0     doi:10.1128/MCB.01263-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Transcription Domain-Associated Repair in Human Cells{triangledown}

Thierry P. Nouspikel,1,2* Nevila Hyka-Nouspikel,1,2 and Philip C. Hanawalt2

Institute for Cancer Studies, University of Sheffield Medical School, Beech Hill Road, Sheffield S10 2RX, United Kingdom,1 Department of Biological Sciences, Stanford University, Stanford, California2

Received 12 July 2006/ Returned for modification 7 August 2006/ Accepted 18 September 2006


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nucleotide excision repair (NER), which is arguably the most versatile DNA repair system, is strongly attenuated in human cells of the monocytic lineage when they differentiate into macrophages. Within active genes, however, both DNA strands continue to be proficiently repaired. The proficient repair of the nontranscribed strand cannot be explained by the dedicated subpathway of transcription-coupled repair (TCR), which is targeted to the transcribed strand in expressed genes. We now report that the previously termed differentiation-associated repair (DAR) depends upon transcription, but not simply upon RNA polymerase II (RNAPII) encountering a lesion: proficient repair of both DNA strands can occur in a part of a gene that the polymerase never reaches, and even if the translocation of RNAPII is blocked with transcription inhibitors. This suggests that DAR may be a subset of global NER, restricted to the subnuclear compartments or chromatin domains within which transcription occurs. Downregulation of selected NER genes with small interfering RNA has confirmed that DAR relies upon the same genes as global genome repair, rather than upon TCR-specific genes. Our findings support the general view that the genomic domains within which transcription is active are more accessible than the bulk of the genome to the recognition and repair of lesions through the global pathway and that TCR is superimposed upon that pathway of NER.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA is constantly under attack from numerous damaging agents from the external environment and as a consequence of intracellular metabolism. The resulting damage, adding to that due to the spontaneous "decay" of DNA (18), would quickly cripple a genome comprising several billion base pairs were it not for continuous surveillance by multiple DNA repair systems. Among these systems, nucleotide excision repair (NER) is the most versatile: it can recognize and repair a wide variety of lesions, from UV-induced pyrimidine dimers to bulky chemicals or protein DNA adducts to intrastrand cross-links.

The mechanistic details of NER are well understood. Lesions are likely detected through the conformational change they introduce in the double-helical DNA structure by the heterotrimer XPC/HR23B/Centrin2 with, for some lesions, an initial contribution by the DDB heterodimer. Then other recognition enzymes, XPA and RPA, come into play, in part to verify the presence of a bona fide lesion and to identify the damaged strand. A denaturation bubble is opened around the lesion by the general transcription factor TFIIH, and the damaged strand is nicked by XPG on the 3' side of the lesion and by the heterodimer ERCC1/XPF on the 5' side. Finally, an oligonucleotide of roughly 30 nucleotides encompassing the lesion is displaced, and the resulting gap is filled using the intact strand as a template (19).

The importance of NER is dramatically illustrated by the genetic disease xeroderma pigmentosum (XP), in which one of the NER enzymes is absent or inactive. XP patients suffer from multiple cancers in sun-exposed areas of their bodies, as well as a modest increase in internal cancers (6).

A profound property of NER is that it can be coupled to transcription, usually resulting in the preferential repair of the transcribed strand (TS) over that of the nontranscribed strand (NTS) in active genes, a subpathway termed transcription-coupled repair (TCR). The mechanistic details of TCR are still unclear, although it is generally assumed that RNA polymerase II (RNAPII) serves as a damage sensor that signals the NER system when it encounters a blocking lesion in the TS (12). Thus, RNAPII can substitute for XPC (and DDB) in lesion detection, and XP group C (XP-C) patients, deficient in global genomic repair (GGR), still retain TCR. Deficiencies in the TCR pathway can result in several other genetic diseases, including Cockayne syndrome, in which the patients are not cancer prone but suffer from developmental defects and numerous neurological problems, generally fatal at an early age. Mutations in XPG, XPB, and XPD (the last two encoding subunits of TFIIH) and in two other genes, CSA and CSB, can result in Cockayne syndrome (17).

The strikingly different phenotypes of XP and Cockayne syndrome can be understood in terms of the two principal DNA transactions: replication and transcription. The presence of a lesion in a transcribed gene is likely to result in a nonfunctional protein or no protein at all. It may also block translocation of RNAPII and make it unavailable for the transcription of other genes. Evidence has even been presented that a stalled RNAPII can be ubiquitinated and targeted for degradation (7). In any case, the end result is cellular dysfunction and possibly cell death. By contrast, some DNA polymerases can bypass damage, in a process that often results in the introduction of an error into the newly synthesized strand opposite the lesion (29). Such an accumulation of mutations in proliferating cells is a predominant mechanism leading to cancer (39).

However, the latter should not be a problem in postmitotic cells, which no longer replicate their genomes. If they could maintain the integrity of their active genes, for instance via TCR, such cells could largely dispense with NER at the global genome level, provided that they do not alter their pattern of gene expression. Cells that neither divide nor change phenotype are known as terminally differentiated and are common in higher organisms. A classic example is neurons, and we have reported that NER is greatly diminished at the global genomic level in human hNT neurons when compared with their NT2 precursor cells (25). Similar results were observed in human fetal neurons kept in culture for several months (24). The repair of the principal UV-induced lesion, cyclobutane-pyrimidine dimers (CPDs), was virtually nil in either system, whereas the more distorting, but less frequent, (6-4) pyrimidine-pyrimidone photoproducts [(6-4)PPs] were repaired much less rapidly in hNT neurons than in their NT2 precursor cells. Similarly, the repair of benzo[a]pyrene diol-epoxide adducts was markedly reduced after differentiation (21). By contrast, TCR was still very efficient in removing CPDs from the TS of active genes. Surprisingly, the NTS was also proficiently repaired in these active genes, a phenomenon that we originally termed differentiation-associated repair (DAR) (25). We reasoned that DAR may be needed to maintain the integrity of the NTS, which must serve as a template for the patching step in TCR. Attenuating GGR might be a valid strategy in cells that are not expected to ever replicate their genomes, but it could be catastrophic if lesions were allowed to accumulate in the NTS of active genes over a lifetime. Sooner or later, the repair DNA polymerase would encounter a neglected lesion within the template for the 29-nucleotide single-strand DNA patch created by TCR, which would likely result in the introduction of a mutation in the gene being repaired (26). The present study was undertaken to further analyze the molecular mechanisms of DAR, as well as to determine the generality of the DNA repair phenotype that we have observed in neurons.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture. HL60 (16) and THP1 (ATCC) cells were grown in RPMI 1640 medium (Gibco) with 10% fetal calf serum. HL60 cells were differentiated with 32 nM TPA (12-O-tetradecanoylphorbol-13-acetate; Calbiochem) for 16 or 48 h, and nonadherent cells were washed away before harvest. THP1 cells were differentiated with 100 nM TPA for 48 h. Fresh monocytes were isolated as described previously (1) from buffy coats obtained from the Stanford Blood Center.

For experiments involving transcription inhibitors, cells were preincubated for 90 min with either 100 µM 5,6-dichlorobenzimidazole riboside (DRB; Calbiochem) or 10 µg/ml {alpha}-amanitin (Calbiochem). Cells were further incubated with transcription inhibitors after UV irradiation.

GGR assay. Cells were suspended or rinsed with phosphate-buffered saline (PBS) and irradiated with 254-nm UV light with a Westinghouse IL-782-30 15-W lamp, at a fluency of ~111 mW/m2, for a total dose of 10 J/m2. Cells were harvested by centrifugation or scraping, and DNA was prepared by phenol extraction as described previously (32). Purified DNA was boiled for 5 min and slot blotted in triplicate on nitrocellulose membranes (Bio-Rad): 1 µg per slot for (6-4)PPs and 80 ng per slot for CPDs. Membranes were baked for 30 min at 80°C and probed with monoclonal antibodies against CPDs and (6-4)PPs (20) as described previously (25).

TCR assay. The same DNA samples prepared for the GGR assay were also used to appraise strand-specific repair of CPDs, as described previously (32). Briefly, 50 µg DNA was digested with an appropriate restriction enzyme (KpnI for DHFR, XbaI for c-myc), ethanol precipitated, and dissolved in 10 mM Tris (pH 8.0)-1 mM EDTA (TE). Each sample was precisely divided in two and either digested with T4 endonuclease V or mock treated. DNA was resolved on an alkaline agarose gel, transferred to a nitrocellulose membrane, and probed with strand-specific RNA probes for DHFR intron IV (33) or for c-myc exon 3 (16). Results were quantified with a GS-363 PhosphorImager (Bio-Rad).

Chromatin immunoprecipitation-PCR assay. HL60 cells differentiated with TPA for 16 h were incubated with 1% formaldehyde in PBS for 20 min at room temperature to cross-link proteins to DNA. The reaction was quenched with 250 mM glycine (final), and the cells were washed with ice-cold PBS, resuspended in FA buffer (10 mM Tris, pH 7.5, 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulfate, 0.1% sodium deoxycholate, 1 mM phenylmethylsulfonyl fluoride), and lysed by repeated aspiration through a 25-gauge needle. The lysate was spun 30 min at 45,000 rpm, and the pellet was quickly rinsed with TE, triturated into a solution containing 10 mM Tris, pH 8.0, 1 mM EDTA, and 150 mM NaCl, and sonicated for 5 min at 10% duty cycle with a Branson Sonifier 200 at 30% power. The DNA was then either digested with the restriction enzyme AvaI for 4 h at 37°C or further sonicated for 50 min (both methods gave identical results). The lysate was incubated in FA buffer with agarose beads precoupled to an anti-RNA polymerase II antibody (H224; Santa Cruz Biotechnology) for 90 min at room temperature. The beads were washed extensively and treated with 0.8 mg/ml pronase in TE for 1 h at 42°C and 5 h at 65°C. DNA was phenol extracted and precipitated as described previously (32). PCR was performed as described previously (23) with primers specific for exon 1 (GTTTTCGGGGCTTTATCTAACTCG and CGCTGCTATGGGCAAAGTTTCGTG) or for exon 3 (GTCTCCACACATCAGCACAATAC and TTCCTTACTTTTCCTTACGCACAA) of the c-myc gene. Amplification products were analyzed by agarose gel electrophoresis and staining with ethidium bromide.

siRNA transfection. Proprietary transfection vectors were purchased from GenScript to generate small interfering RNA (siRNA) against XPG, XPC, or CSB, under the control of the U3 promoter. These vectors were stably transfected into THP1 cells, which were bulk selected with increasing doses of hygromycin (Gibco) up to 150 µg/ml for 5 weeks. The cultures were then serially diluted in 96-well plates and kept in culture for several weeks with lower doses of hygromycin (100 to 150 µg/ml). Sixteen clones corresponding to the most dilute conditions were selected. RNA was prepared, reverse-transcribed with an oligo(dT) primer, and amplified by PCR in the presence of [32P]dCTP with primers specific for the genes of interest and located upstream of the siRNA recognition site. Fragments of ß-actin or GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were coamplified in the same reaction for normalization purposes.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We made use of two human leukemia cell lines that can be differentiated into macrophages, another canonical example of terminally differentiated cells. HL60 is a promyelocytic leukemia cell line that can be differentiated into macrophage-like cells with TPA (30) or into granulocyte-like cells with various chemical agents (8). HL60 cells are unfortunately genetically unstable, and they evolve in culture as additional mutations and chromosomal abnormalities occur (10). The monocytic leukemia cell line THP1 is farther down the monocyte/macrophage differentiation pathway, roughly corresponding to primary monocytes, and more stable than HL60. It too can be differentiated into macrophage-like cells by addition of TPA to the culture medium (37). To verify that our observations were not due to aberrations specific to the leukemia cell lines, we also employed primary monocytes freshly isolated from human blood. These cells can also be induced to differentiate into macrophages by treatment with TPA.

We assessed the NER system in these three cell types, whether naive or differentiated, by measuring the repair of two principal UV-induced lesions, CPDs and (6-4)PPs. Both involve noncanonical covalent bonds between two adjacent pyrimidines on the same DNA strand. CPDs constitute a strong block for RNAPII and are therefore readily repaired by TCR but are a weak substrate for GGR, and their detection requires an additional component, DDB, at the global genome level. By contrast, (6-4)PPs are among the most readily recognized and rapidly repaired substrates for NER.

Global genome repair of UV-induced lesions. Freshly isolated human monocytes, HL60 cells, or THP1 cells were differentiated with TPA (or not) for 48 h and, in the case of HL60 cells, also for 16 h. To measure removal of UV-induced lesions at the global genome level, cells were irradiated with 10 J/m2 of 254-nm UV light and harvested after various periods of incubation at 37°C. DNA was purified and blotted on a nitrocellulose membrane, and the amounts of CPDs and (6-4)PPs were measured with specific monoclonal antibodies (Fig. 1).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. Global genome repair of UV-induced lesions. HL60 cells, naive (dotted lines) or differentiated with TPA for 16 h (dashed lines) or 48 h (solid lines), THP1 cells, and fresh blood monocytes, naive or differentiated with TPA for 48 h, were irradiated with 10 J/m2 of 254-nm UV light. DNA was isolated at various times after irradiation, blotted on a nitrocellulose membrane, and probed with monoclonal antibodies against CPDs (top row) or (6-4)PPs (bottom row). Data are averages of two to four experiments, each performed in triplicate. Error bars are standard errors of the means. Asterisks denote significant differences from naive cells: *, P < 0.1; **, P < 0.05; ***, P < 0.025; ****, P < 0.01.

 
Naive HL60 cells repaired CPDs relatively efficiently, whereas in cells differentiated with TPA for 16 h very little repair of CPDs occurred within the first 8 h after irradiation. Significant repair was apparent 24 h after irradiation, but much less than that in naive cells. CPD repair was completely abolished when HL60 cells were differentiated for 48 h with TPA. This effect of differentiation was less clear with THP1 cells and primary monocytes, mainly because these cells displayed little repair of CPDs even in their naive state. Nevertheless, it is obvious from Fig. 1 that neither macrophage-like cells differentiated from THP1 cells nor macrophages differentiated from primary monocytes significantly repaired CPDs.

As is generally the case, (6-4)PPs were repaired much more efficiently than CPDs in all three cell types, although, interestingly, repair was somewhat slower in primary monocytes. Repair of (6-4)PPs was decreased upon differentiation but not completely abolished. Rather, the kinetics of repair were significantly slower in all three cell types after differentiation by TPA for 48 h. This effect was not apparent in HL60 cells after only 16 h of differentiation with TPA.

Strand-specific repair in the DHFR gene. To measure repair of CPDs in a transcribed gene, we performed strand-specific Southern blot analyses on the same DNA samples used for GGR appraisal, after digestion with T4 endonuclease V. This enzyme generates a single-strand break at the site of a CPD, which results in the disappearance of the restriction fragment of interest from the Southern blot, allowing us to appraise the number of lesions in a given gene. By using denaturing gels and strand-specific RNA probes, this method can also reveal any difference in repair rates from one strand to the other (32).

Figure 2 demonstrates that CPDs were efficiently removed from both strands of the constitutively active DHFR gene in naive cells (dotted lines), although significantly faster from the transcribed strand than from the nontranscribed strand (filled symbols versus open symbols). This strand bias is the hallmark of TCR and probably reflects the fact that RNAPII constitutes an efficient, processive detection system for lesions that arrest transcription.


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. Strand-specific repair of CPDs in the DHFR gene. (A) DNA prepared as for Fig. 1 was digested with KpnI and then with T4 endonuclease V and subjected to Southern analysis with RNA probes specific for the transcribed (filled symbols) or nontranscribed (open symbols) strand of the constitutively expressed DHFR gene. Dotted lines, naive cells; solid lines, cells differentiated with TPA for 48 h. Data are averages of two experiments, and error bars are standard errors of the means. (B) Same data as those for panel A combined with those in Fig. 1. Repair of the nontranscribed strand in differentiated cells was replotted after subtraction of the amount of GGR observed in Fig. 1. Upward triangles, monocytes; downward triangles, THP1; leftward triangles, HL60. Error bars were omitted for clarity.

 
In primary macrophages or macrophage-like cells (solid lines) differentiated from either HL60 or THP1 cells, the TS of the DHFR gene was proficiently repaired, as expected for an actively transcribed gene. Interestingly, the NTS was also proficiently repaired, in spite of the lack of GGR for CPDs in differentiated cells (Fig. 1). Figure 2B combines data from Fig. 1 and 2A and shows repair of the NTS in differentiated cells after subtraction of the amount of global repair observed in these cells. In other words, it displays a supplementary repair component, approximately equal to 25%, which cannot be accounted for by GGR. Since RNAPII does not detect CPDs in the NTS (9), this additional repair also cannot be attributed to TCR. We thus concluded that the NTS had to be repaired by DAR, confirming the phenotype that we have observed in neurons (25).

Strand-specific repair in the c-myc gene. In HL60 cells, the c-myc gene is subject to a very peculiar regulation (Fig. 3A): it is active in naive cells and inactive in differentiated cells 48 h after treatment with TPA. However, 16 h after treatment with TPA, the gene is still partially transcribed but RNAPII never proceeds beyond the first exon (3). We verified this fact in our laboratory, both with "run-on" experiments (16) and with a technique involving chromatin immunoprecipitation and PCR (Fig. 3C). Both approaches confirmed that the distal part of the c-myc gene was not transcribed in HL60 cells differentiated for 16 h.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
FIG. 3. Strand-specific repair in the c-myc gene in HL60 cells. (A) The c-myc gene is expressed in naive HL60 cells, inactive in HL60 cells differentiated for 48 h, and transcribed only to the end of the first exon in HL60 cells differentiated for 16 h. X, XbaI restriction site; brackets, location of the RNA probes. (B) Experiments similar to those in Fig. 2 but in which DNA was digested with XbaI and probed for a restriction fragment located at the end of the c-myc gene. Filled squares, probe specific for the TS; open squares, probe specific for the NTS. Data are averages of two experiments, and error bars are standard errors of the means. (C) PCR amplification of the first or third exon of c-myc, using as template either total DNA or DNA that was immunoprecipitated (IP) with antibodies against RNA polymerase II, after formaldehyde cross-linking and DNA shearing by ultrasounds and restriction digestion. A successful amplification indicates that RNA polymerase II was present in this portion of the gene at the time of cross-linking.

 
We then performed strand-specific Southern blotting on the c-myc gene, selecting a restriction site and a probe located in the distal part of the gene, thereby to measure repair of CPDs in the region that translocating RNAPII does not reach in TPA-treated cells. Figure 3B illustrates the results of these experiments. As expected, in naive cells (top panel) both strands of the c-myc gene are proficiently repaired, with a noticeable bias in favor of the TS, indicating that both GGR and TCR are proficient. After 48 h of treatment with TPA (bottom panel), very little repair is observed in either strand of the now-silent c-myc gene. This was expected as GGR is down-regulated (Fig. 1), and TCR occurs only in active genes. The surprising results were those obtained with HL60 cells differentiated with TPA for only 16 h (middle panel): both strands were equally well repaired, in spite of the fact that GGR of CPDs is essentially inactive in these cells (Fig. 1). Because RNAPII never reaches the part of the gene that we were assaying, TCR cannot account for repair in that domain, as demonstrated by the absence of strand bias. We thus concluded that both strands were repaired by DAR.

Effect of transcription inhibitors. The above experiment could not be performed in THP1 cells, because the c-myc gene is inactive in this cell line, even prior to differentiation. We therefore decided to use two transcription inhibitors, DRB and {alpha}-amanitin. DRB inhibits the phosphorylation of the C terminus of the large subunit of RNAPII, thereby preventing it from entering the elongation mode and leaving the promoter. By contrast, {alpha}-amanitin interacts with an elongating RNAPII and prevents incorporation of ribonucleotides into the nascent RNA chain, thereby stalling the polymerase. Thus, using these inhibitors we could theoretically distinguish between two situations: a polymerase bound to the promoter that never initiates transcription and a polymerase stalled within the gene during RNA synthesis.

As shown in Fig. 4, both treatments resulted in the same phenotype, similar to that observed for the c-myc gene in HL60 cells differentiated for 16 h. There was no strand bias in favor of the TS, as expected, since transcription had been shut off. However, even though these cells displayed almost no repair of CPDs at the global genome level (data not shown; similar to Fig. 1), both strands of the DHFR gene were repaired by DAR.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Strand-specific repair in THP1 cells treated with transcription inhibitors. (A) Experiment similar to that in Fig. 2, except that THP1 cells were treated with transcription inhibitors DRB or {alpha}-amanitin. Only the results in differentiated cells are presented. (B) Quantification of the results from panel A. Filled triangles, probes specific for the TS; open triangles, probe specific for the NTS.

 
Depleting NER enzymes with siRNA. The above results are compatible with a model in which DAR is a subset of GGR, which operates only in transcriptionally active domains of the genome. If this hypothesis is correct, DAR should require the same NER enzymes as those needed for GGR. In particular, it should rely on XPC, which is required for GGR but not for TCR. Conversely, if DAR were a variant of TCR, it should require CSA and CSB, both specific for TCR.

We transfected THP1 cells with stable siRNA constructs designed to destroy mRNA for XPC, CSB, or XPG (as a control). Clones that achieved at least 70% decrease in the respective mRNA levels were selected (data not shown). As a control for the efficiency of the siRNA approach, we also measured the effect of siRNA transfection on GGR. Given that CPDs are poorly repaired in THP1 cells, only the repair of (6-4)PPs in differentiated cells is shown in Fig. 5A. It can be seen that transfection of an anti-XPC siRNA construct resulted in a very significant decrease in the removal of (6-4)PPs. By contrast, transfection of an anti-XPG siRNA construct had a much less marked effect. This was not completely unexpected, as it has been shown that even small amounts of XPG mRNA are enough to greatly alleviate the phenotype of XP-G patients (36). It has even been observed that healthy individuals display an abnormal splicing event in XPG, sometimes resulting in a 90% decrease in mRNA levels, with no obvious phenotypic consequences (22), although the possibility that the amount of abnormally spliced mRNA varies in a tissue-specific manner and was higher in the samples provided by the donors than in more-vital organs cannot be excluded. Nevertheless, we were not surprised that a 70% decrease in XPG mRNA did not have a marked effect on GGR. As for CSB, since this enzyme only affects TCR, it would not be expected to have an effect greater than a few percent at the global genome level.


Figure 5
View larger version (19K):
[in this window]
[in a new window]
 
FIG. 5. Effect of siRNA directed against CSB, XPC, or XPG. (A) Global genomic repair in siRNA-transfected cells, measured as for Fig. 1. Only (6-4)PPs are shown. (B) Strand-specific repair in the DHFR gene, measured as for Fig. 2. Only differentiated cells are shown. Filled symbols, probe specific for the TS; open symbols, probe specific for the NTS. Error bars are standard errors of the means of two experiments.

 
We then measured strand-specific repair of CPDs in the various transfectants before (not shown) and after differentiation. Figure 5B demonstrates a strict dependence on XPG for DAR; neither strand is repaired in cells transfected with anti-XPG siRNA. This is the result we were expecting since XPG is absolutely required for NER, both at the global genome level and when coupled to transcription. It is interesting that, in spite of the relatively proficient repair of (6-4)PPs at the global genome level, TCR of CPDs is almost completely abolished in the transfected cells after differentiation. We do not have a definitive explanation for this difference in behavior between the two lesions. It may be that, when XPG becomes limiting, the vast majority of (6-4)PPs (generally repaired by GGR more rapidly than CPDs are repaired by TCR) result in titrating of XPG away from the few molecules of RNAPII stalled by a CPD in a transcribed gene. Another possible explanation is that a 70% decrease in XPG may have indirect effects on NER, for instance, through the transcription machinery or chromatin structure. In this respect, it is worth noting that an analysis of XPG mutations suggested that XPG must have an additional function besides the incision role it plays in NER (27).

Cells transfected with anti-XPC siRNA displayed the typical phenotype of XP-C cells: proficient repair of the TS (by TCR only, hence lower than in naive cells in which it benefits from GGR and TCR) and complete lack of repair of the NTS. Thus, XPC is required for proficient DAR. By contrast, cells transfected with anti-CSB siRNA proficiently repaired CPDs in both strands of the active DHFR gene. There was no strand bias in favor of the TS, confirming that the absence of CSB inhibited TCR but that DAR was still observed on both strands.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have examined modulations of NER in human cells of the myelomonocytic lineage when they are induced to differentiate into macrophages. We observed a general drop in efficiency of NER at the global genome level upon differentiation, whereas the repair of both strands of transcribed genes remained proficient. Proficient repair of the TS can be attributed to TCR, whereas repair of the NTS in GGR-deficient cells constitutes what we have previously named DAR. This phenotype is similar to what we have previously observed in human neurons, either primary (24) or differentiated from a precursor neuroteratoma cell line (25). It is thus possible that all differentiated cells may experience an attenuation of global genome repair, possibly an energy-saving strategy, while maintaining proficient repair of active genes via TCR and DAR.

We did not observe any marked changes in the expression of the various NER enzymes upon macrophage differentiation, with the exception of a twofold reduction in the level of the p48/DDB2 subunit of DDB (14). However, this reduction was not observed in neurons (25) or in macrophages originating from a third acute myeloid leukemia cell line, KG-1, which displayed a GGR phenotype similar to that of HL60 and THP1 (14). This makes it unlikely that the decrease in p48/DDB2 could be the cause of the GGR defect we observed.

In addition, it is worth noting that GGR of CPDs was already relatively slow in naive cells from the monocytic lineage, when compared to that generally observed in actively dividing cells (25). In the case of THP1, this could be attributed to the deficient p53 status of this cell line (28); it has been shown that p53 regulates basal levels of the p48/DDB2 regulatory subunit of the DDB enzyme (15), as well as regulating its induction after DNA damage (11). Since DDB greatly enhances GGR of CPDs (35), a p53-deficient cell line is not likely to repair CPDs efficiently at the global genome level. The situation is less clear for HL60 cells, due to the unstable nature of this cell line. There have been reports of p53-proficient as well as of p53-null HL60 sublines, and even sublines in which p53 is present but inactive (10). We have tested two different sublines of HL60 (14, 16), and only one of these was reasonably proficient in the repair of CPDs. That was, of course, the one used in the present study.

TCR of CPDs does not require DDB, presumably because these lesions constitute a strong block for RNAPII, which then serves as a sensor (in place of DDB and XPC) and leads to proficient repair of CPDs in the TSs of active genes. Of course, while repairing the TS, TCR must use the NTS as a template to fill the ~30-nucleotide gap left by the excision of an oligonucleotide containing the lesion. A teleological explanation for DAR is that it serves to maintain the integrity of the NTS of active genes, so as to preserve a flawless template for TCR (25). In this respect, it is interesting that DAR is present in white blood cells, which have a limited life span. The probability is fairly low of a lesion occurring in the TS close enough (i.e., within 30 nucleotides at most) to a lesion in the NTS that a mutation would result upon TCR. It would probably take years before the NTS is crippled to such an extent that it eventually compromises TCR in any given gene. Clearly, this might be a problem for neurons, which are supposed to last for a lifetime, but not for short-lived white blood cells. Thus, we would not have been surprised if DAR had not been present in macrophages. Yet we did observe it, suggesting that DAR may be a more common mode of repair than we originally thought.

A convenient target gene to study the mechanism of DAR is the c-myc gene in HL60 cells. This gene is active in naive HL60 cells and eventually becomes silent once the cells have been differentiated for 48 h. After only 16 h of differentiation, however, the gene still appears to be transcribed, but only to the end of the first exon. There are two schools of thought about this phenomenon: some believe that the polymerase actually travels to the end of the first exon and is arrested there (3), and other groups believe that the RNAPII never actually leaves the promoter in undisturbed cells and that the observed stretch of transcription occurs upon preparation of nuclei (34). We attempted to mimic either situation in the DHFR gene in THP1 cells by using different transcription inhibitors: DRB to prevent RNAPII from leaving the promoter, or {alpha}-amanitin to stall it while actively engaged in transcription. The same NER phenotype resulted from both inhibitors: despite the lack in global genome repair, the DHFR gene was still repaired on both strands, without any bias in favor of the TS. This was also observed in the c-myc gene in HL60 cells differentiated for 16 h. These experiments lead to important conclusions about the mechanism of DAR. They demonstrate, first, that DAR is active on both DNA strands and, second and most importantly, that DAR depends upon active transcription but does not rely upon translocating RNAPII to actually detect lesions. The simplest model to account for these observations is that DAR is merely a subset of GGR, restricted to the nuclear subcompartments within which transcription occurs. Bringing a gene into such "transcription factories" would facilitate proficient repair on both strands, regardless of whether the gene is transcribed or not.

This is reminiscent of previous observations in the laboratory of George Kantor, in which large DNA domains (over 50 kb) were shown to be preferentially repaired in domains containing active transcription units. However, this "proximity effect" was apparent only on the TS and occurred in XP-C cells (2) but not in Cockayne syndrome group B cells (31), implying that it was somehow an extension of TCR.

By contrast, we observed DAR on both strands, and our model predicts that DAR should rely upon the same NER enzymes as GGR. In particular, it should require the early detection enzyme XPC. XP-C cells lack GGR but have proficient TCR (13), a phenotype very similar to what we observed in differentiated cells, except that the NTS of active genes is not repaired in XP-C cells. This may be because XPC is required for DAR, but it could also be due to the fact that the only cells available from XP-C patients are actively growing fibroblasts and lymphoblasts. Conceivably, if we had access to differentiated cells from XP-C patients, we might observe DAR. Since such cells are not available, we resorted to stably transfecting THP1 cells with siRNA designed to inhibit production of XPC and subsequently differentiating transfected cells into macrophages. These XPC-deficient macrophages displayed the same phenotype as XP-C fibroblasts or XP-C lymphoblasts, with little or no repair of the NTS, thereby confirming that DAR does require XPC. Conversely, when we used siRNA to knock down the mRNA level of CSB, an enzyme required for TCR but dispensable for GGR, we did not observe any effect on DAR but did observe the expected disappearance of the TCR-related strand bias. Therefore, DAR cannot be considered a subset of TCR, but rather it is a subset of GGR.

We have recently demonstrated that the GGR deficiency in THP1 cells can be complemented by the ubiquitin-activating enzyme E1 (27a). This suggested to us that an NER enzyme might be activated by ubiquitination, and we have evidence that it is the TFIIH complex. In particular, purified rat TFIIH was able to complement extracts from differentiated THP1 cells in an in vitro NER assay. Our current model is that ubiquitination of TFIIH is required for GGR but dispensable for TCR and for transcription. Such a differential regulation would not be surprising, as there are mutations in the XPB or XPD subunits of TFIIH known to affect only TCR, with no effect on GGR or transcription (4). Clearly, the various functions of TFIIH can be regulated independently from each other.

Since TFIIH is a general transcription factor, required for RNAPII to enter the elongation mode, it would not be surprising if it were concentrated inside "transcription factories" within the nucleus. Thus, if even a small fraction of TFIIH remained ubiquitinated in terminally differentiated cells, which we did observe (data not shown), it would be available preferentially to genes entering transcription factories, thereby resulting in the preferential repair of both strands in active genes, which we have called DAR.

Whether this phenomenon occurs in all differentiated cells, and only in differentiated cells, is still an open question. Although DAR was not observed in terminally differentiated cardiac myocytes from rats (38), it is quite possible that DAR is present in many cell types but can be visualized only in cells that have little or no GGR. Indeed, we (14) and others (5) have reported evidence for DAR in cells that were not terminally differentiated but in which global repair of CPDs was low enough that DAR became obvious in active genes. It has been proposed that DAR should thus be renamed "nontranscribed strand repair," given that it is not unique to differentiated cells (5). But this alternative nomenclature would not be appropriate, since we demonstrate here that DAR operates on both strands. We suggest instead that it be called "domain-associated repair," which has the advantage of maintaining the same acronym, while also more appropriately reflecting the mechanistic details of DAR: preferential repair within transcribed DNA domains that have privileged access to NER enzymes within transcription factories.


    ACKNOWLEDGMENTS
 
We thank Toshio Mori for the gift of anti-CPD and anti-(6-4)PP antibodies, Stephen Lloyd for the gift of T4 endonuclease V, David Mellert for assistance with RT-PCR, and Ann Ganesan for critical reading of the manuscript and helpful suggestions.

This work was supported by a Senior Scholar Award from the Ellison Medical Foundation and grant CA77712 from the National Cancer Institute, U.S. Department of Health and Human Services.


    FOOTNOTES
 
* Corresponding author. Mailing address: Institute for Cancer Studies, University of Sheffield Medical School, Beech Hill Road, Sheffield S10 2RX, United Kingdom. Phone: 44 114 271 2966. Fax: 44 114 271 3892. E-mail: t.nouspikel{at}sheffield.ac.uk. Back

{triangledown} Published ahead of print on 2 October 2006. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Armant, M., M. Rubio, G. Delespesse, and M. Sarfati. 1995. Soluble CD23 directly activates monocytes to contribute to the antigen-independent stimulation of resting T cells. J. Immunol. 155:4868-4875.[Abstract]

2. Barsalou, L. S., G. J. Kantor, D. M. Deiss, and C. E. Hall. 1994. DNA repair in the genomic region containing the beta-actin gene in xeroderma pigmentosum complementation group C and normal human cells. Mutat. Res. 315:43-54.[CrossRef][Medline]

3. Bentley, D. L., and M. Groudine. 1986. A block to elongation is largely responsible for decreased transcription of c-myc in differentiated HL60 cells. Nature 321:702-706.[CrossRef][Medline]

4. Berneburg, M., and A. R. Lehmann. 2001. Xeroderma pigmentosum and related disorders: defects in DNA repair and transcription. Adv. Genet. 43:71-102.[Medline]

5. Bielas, J. H. 2006. Non-transcribed strand repair revealed in quiescent cells. Mutagenesis 21:49-53.[Abstract/Free Full Text]

6. Bootsma, D., and J. H. Hoeijmakers. 1991. The genetic basis of xeroderma pigmentosum. Ann. Genet. 34:143-150.[Medline]

7. Bregman, D. B., R. Halaban, A. J. van Gool, K. A. Henning, E. C. Friedberg, and S. L. Warren. 1996. UV-induced ubiquitination of RNA polymerase II: a novel modification deficient in Cockayne syndrome cells. Proc. Natl. Acad. Sci. USA 93:11586-11590.[Abstract/Free Full Text]

8. Collins, S. J., F. W. Ruscetti, R. E. Gallagher, and R. C. Gallo. 1978. Terminal differentiation of human promyelocytic leukemia cells induced by dimethyl sulfoxide and other polar compounds. Proc. Natl. Acad. Sci. USA 75:2458-2462.[Abstract/Free Full Text]

9. Donahue, B. A., S. Yin, J. S. Taylor, D. Reines, and P. C. Hanawalt. 1994. Transcript cleavage by RNA polymerase II arrested by a cyclobutane pyrimidine dimer in the DNA template. Proc. Natl. Acad. Sci. USA 91:8502-8506.[Abstract/Free Full Text]

10. Fisher, A. M., K. Danenberg, D. Banerjee, J. R. Bertino, P. Danenberg, and C. J. Gomer. 1997. Increased photosensitivity in HL60 cells expressing wild-type p53. Photochem. Photobiol. 66:265-270.[Medline]

11. Ford, J., and P. C. Hanawalt. 1997. Expression of wild-type p53 is required for efficient global genomic nucleotide excision repair in UV-irradiated human fibroblasts. J. Biol. Chem. 272:28073-28080.[Abstract/Free Full Text]

12. Hanawalt, P. C. 2002. Subpathways of nucleotide excision repair and their regulation. Oncogene 21:8949-8956.[CrossRef][Medline]

13. Hanawalt, P. C., J. M. Ford, and D. R. Lloyd. 2003. Functional characterization of global genomic DNA repair and its implications for cancer. Mutat. Res. 544:107-114.[CrossRef][Medline]

14. Hsu, P. S., P. C. Hanawalt, and T. Nouspikel. 4 August 2006, posting date. Nucleotide excision repair phenotype of human acute myeloid leukemia cell lines at various stages of differentiation. Mutat. Res. [Online.] doi: 10.1016/j.mrfmmm.2006.06.008.

15. Hwang, B. J., J. M. Ford, P. C. Hanawalt, and G. Chu. 1999. Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in global genomic repair. Proc. Natl. Acad. Sci. USA 96:424-428.[Abstract/Free Full Text]

16. Islas, A., and P. C. Hanawalt. 1995. DNA repair in the MYC and FMS proto-oncogenes in ultraviolet light-irradiated human HL60 promyelocytic cells during differentiation. Cancer Res. 55:336-341.[Abstract/Free Full Text]

17. Lehmann, A. R. 2003. DNA repair-deficient diseases, xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Biochimie 85:1101-1111.[Medline]

18. Lindahl, T. 1993. Instability and decay of the primary structure of DNA. Nature 362:709-715.[CrossRef][Medline]

19. Lindahl, T., and R. D. Wood. 1999. Quality control by DNA repair. Science 286:1897-1905.[Abstract/Free Full Text]

20. Mori, T., M. Nakane, T. Hattori, T. Matsunaga, M. Ihara, and O. Nikaido. 1991. Simultaneous establishment of monoclonal antibodies specific for either cyclobutane pyrimidine dimer or (6-4) photoproduct from the same mouse immunized with ultraviolet-irradiated DNA. Photochem. Photobiol. 54:225-232.[Medline]

21. Nouspikel, T. 22 August 2006, posting date. DNA repair in differentiated cells: some new answers to old questions. Neuroscience [Online.] doi: 10.1016/j.neuroscience.2006.07.006.

22. Nouspikel, T. 1996. Study of the role of XPG in xeroderma pigmentosum and Cockayne's syndrome. Ph.D. dissertation. University of Geneva, Geneva, Switzerland.

23. Nouspikel, T., and S. G. Clarkson. 1994. Mutations that disable the DNA repair gene XPG in a xeroderma pigmentosum group G patient. Hum. Mol. Genet. 3:963-967.[Abstract/Free Full Text]

24. Nouspikel, T., and P. C. Hanawalt. 2001. DNA repair in terminally differentiated cells. DNA Repair 1:59-75.

25. Nouspikel, T., and P. C. Hanawalt. 2000. Terminally differentiated human neurons repair transcribed genes but display attenuated global DNA repair and modulation of repair gene expression. Mol. Cell. Biol. 20:1562-1570.[Abstract/Free Full Text]

26. Nouspikel, T., and P. C. Hanawalt. 2003. When parsimony backfires: neglecting DNA repair may doom neurons in Alzheimer's disease. Bioessays 25:168-173.[CrossRef][Medline]

27. Nouspikel, T., P. Lalle, S. A. Leadon, P. K. Cooper, and S. G. Clarkson. 1997. A common mutational pattern in Cockayne syndrome patients from xeroderma pigmentosum group G: implications for a second XPG function. Proc. Natl. Acad. Sci. USA 94:3116-3121.[Abstract/Free Full Text]

27. Nouspikel, T., and P. C. Hanawalt.Impaired nucleotide excision repair upon macrophage differentiation is corrected by E1 ubiquitin-activating enzyme. Proc. Natl. Acad. Sci. USA, in press.

28. Olivier, M., R. Eeles, M. Hollstein, M. A. Khan, C. C. Harris, and P. Hainaut. 2002. The IARC TP53 database: new online mutation analysis and recommendations to users. Hum. Mutat. 19:607-614.[CrossRef][Medline]

29. Prakash, S., R. E. Johnson, and L. Prakash. 2005. Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function. Annu. Rev. Biochem. 74:317-353.[CrossRef][Medline]

30. Rovera, G., D. Santoli, and C. Damsky. 1979. Human promyelocytic leukemia cells in culture differentiate into macrophage-like cells when treated with a phorbol diester. Proc. Natl. Acad. Sci. USA 76:2779-2783.[Abstract/Free Full Text]

31. Shanower, G. A., and G. J. Kantor. 1997. A difference in the pattern of repair in a large genomic region in UV-irradiated normal human and Cockayne syndrome cells. Mutat. Res. 385:127-137.[Medline]

32. Spivak, G., and P. Hanawalt. 1995. Determination of damage and repair in specific DNA sequences. Methods Companion Methods Enzymol. 7:147-161.

33. Spivak, G., T. Itoh, T. Matsunaga, O. Nikaido, P. Hanawalt, and M. Yamaizumi. 2002. Ultraviolet-sensitive syndrome cells are defective in transcription-coupled repair of cyclobutane pyrimidine dimers. DNA Repair 1:629-643.[Medline]

34. Strobl, L. J., and D. Eick. 1992. Hold back of RNA polymerase II at the transcription start site mediates down-regulation of c-myc in vivo. EMBO J. 11:3307-3314.[Medline]

35. Tang, J. Y., B. J. Hwang, J. M. Ford, P. C. Hanawalt, and G. Chu. 2000. Xeroderma pigmentosum p48 gene enhances global genomic repair and suppresses UV-induced mutagenesis. Mol. Cell 5:737-744.[CrossRef][Medline]

36. Thorel, F., A. Constantinou, I. Dunand-Sauthier, T. Nouspikel, P. Lalle, A. Raams, N. G. Jaspers, W. Vermeulen, M. K. Shivji, R. D. Wood, and S. G. Clarkson. 2004. Definition of a short region of XPG necessary for TFIIH interaction and stable recruitment to sites of UV damage. Mol. Cell. Biol. 24:10670-10680.[Abstract/Free Full Text]

37. Tsuchiya, S., Y. Kobayashi, Y. Goto, H. Okumura, S. Nakae, T. Konno, and K. Tada. 1982. Induction of maturation in cultured human monocytic leukemia cells by a phorbol diester. Cancer Res. 42:1530-1536.[Abstract/Free Full Text]

38. van der Wees, C. G., M. P. Vreeswijk, M. Persoon, A. van der Laarse, A. A. van Zeeland, and L. H. Mullenders. 2003. Deficient global genome repair of UV-induced cyclobutane pyrimidine dimers in terminally differentiated myocytes and proliferating fibroblasts from the rat heart. DNA Repair 2:1297-1308.[CrossRef][Medline]

39. Venitt, S. 1996. Mechanisms of spontaneous human cancers. Environ. Health Perspect. 104(Suppl. 3):633-637.[Medline]


Molecular and Cellular Biology, December 2006, p. 8722-8730, Vol. 26, No. 23
0270-7306/06/$08.00+0     doi:10.1128/MCB.01263-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Other Versions of this Article:
MCB.01263-06v1
26/23/8722    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nouspikel, T. P.
Right arrow Articles by Hanawalt, P. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nouspikel, T. P.
Right arrow Articles by Hanawalt, P. C.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals