| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2006, p. 9268-9278, Vol. 26, No. 24
0270-7306/06/$08.00+0 doi:10.1128/MCB.01168-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
*
Gidi Shani,
Kevin Aung,
Jonathan Kelber, and
Wylie Vale
Clayton Foundation Laboratories for Peptide Biology, The Salk Institute for Biological Studies, La Jolla, California 92037
Received 28 June 2006/ Returned for modification 21 July 2006/ Accepted 22 September 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
TGF-ß ligands exert their biological effects by binding and assembling cell surface type I and type II transmembrane serine/threonine kinase receptors. Receptor assembly allows the constitutively active type II receptor kinase to phosphorylate the type I receptor, thereby activating the type I receptor kinase (42). This receptor activation mechanism was initially established for TGF-ß, which first binds its type II receptor, TßRII, to allow subsequent recruitment and phosphorylation of its type I receptor, TßRI (55, 56). Intracellular signals emanating from active TGF-ß receptor complexes include those mediated by the cytoplasmic receptor-activated Smad proteins Smad2 and Smad3, which are target substrates for the TßRI kinase (42). Following phosphorylation by TßRI, Smad2 and Smad3 bind the common mediator Smad, Smad4, and the resulting hetero-oligomeric Smad complexes migrate into the nucleus to regulate transcription of target genes (42).
The ability of TGF-ß superfamily members to bind and assemble their signaling receptors is regulated in a complex manner by membrane-bound coreceptors and accessory proteins (23). One example is betaglycan (TßRIII), a multifunctional transmembrane proteoglycan that binds TGF-ß isoforms and enhances their ability to bind and assemble signaling receptors (27, 28, 50). Betaglycan also binds inhibins (25) and facilitates the ability of these inhibitory TGF-ß ligands to bind activin type II receptors and block signaling by activins (25) and BMPs (54). As another example, endoglin also binds multiple TGF-ß ligands and, interestingly, determines whether TGF-ß signals via TßRI as opposed to the functionally distinct type I receptor ALK1 (24, 35). Finally, the accessory protein BMP and activin receptor membrane-bound inhibitor (BAMBI) resembles a type I receptor but lacks a cytoplasmic kinase domain and inhibits BMP, activin, and TGF-ß signaling by forming inactive complexes with these ligands and their respective signaling receptors (34). As illustrated by these three cell surface proteins, accessory receptors control the ability of TGF-ß ligands to access signaling receptors and generate cellular responses.
Cripto (Cripto-1, TDGF1) is a multifunctional signaling protein and an accessory receptor based on its ability to bind TGF-ß ligands and modulate their signaling properties (19, 40, 46). Under normal physiological conditions, Cripto is selectively expressed during developmental processes and it has been shown to have activity both as a soluble factor and as a glycosylphosphatidylinositol (GPI)-anchored cell surface protein (46). In the developing embryo, Cripto and other epidermal growth factor-Cripto, FRL-1, Cryptic (EGF-CFC) proteins have essential roles as necessary coreceptors for TGF-ß ligands, including nodals (38, 41), growth and differentiation factor 1 (GDF1) (8), and GDF3 (7). In this capacity, EGF-CFC proteins are required for processes such as mesendoderm induction (38), correct positioning of the body axes (4, 12, 38), and cardiac development (58). Cripto has also been identified as a marker for embryonic stem cells (5), suggesting it facilitates maintenance of the stem cell phenotype (46). Although generally absent from adult tissues, Cripto is expressed at high levels in human tumors and several molecular mechanisms that may contribute to its ability to promote tumorigenesis have been proposed previously (46). For example, Cripto can activate ras/mitogen-activated protein kinase (22) and phosphatidylinositol 3-kinase (13) pathways associated with mitogenesis and cell survival and it also inhibits signaling by activins (1, 15). Determining the extent to which these and other oncogenic Cripto actions contribute to the tumor phenotype remains an important area of investigation.
Here, we identify a new molecular mechanism in which Cripto inhibits TGF-ß signaling. Our results show that Cripto binds TGF-ß and reduces TGF-ß binding to TßRI, suggesting that it interferes with receptor assembly. Consistent with this interpretation, we demonstrate that Cripto attenuates TGF-ß signaling in multiple cell types and signaling assays. Importantly, Cripto substantially diminished the cytostatic effects of TGF-ß on mammary epithelial cells grown under either anchorage-dependent or anchorage-independent conditions. We have also measured the activity of Cripto deletion mutants lacking either the EGF-like domain or the CFC domain, and our results suggest that the EGF-like domain is both necessary and sufficient for TGF-ß binding and inhibition of TGF-ß signaling. Finally, we have shown that knockdown of endogenous Cripto expression by use of small interfering RNA (siRNA) enhances TGF-ß responsiveness. Since Cripto is highly expressed in tumors (46) and since loss of the antiproliferative effects of TGF-ß is frequently associated with tumorigenesis (43), we propose that Cripto antagonism of TGF-ß signaling may contribute to tumor initiation and progression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Expression constructs. We used overlapping PCR (14) to generate constructs in which a single FLAG epitope tag sequence (DYKDDDDK) was inserted upstream of the EGF-like domain between glycine 55 and isoleucine 56 of mouse Cripto. The Cripto deletion mutants were generated using a previously described PCR strategy (17) in which either the EGF-like domain or the CFC domain was replaced with an in-frame BamHI site (GGATCC) encoding the amino acids Gly-Ser. For transient transfection into HepG2 and 293T cells, Cripto constructs were subcloned into pcDNA3 (Invitrogen, Carlsbad, CA). Cripto constructs were also subcloned into the lentiviral vector pCSC (31) for production of lentivirus. Lentiviral vectors used in this study were a gift from Inder Verma (Salk Institute). The TßRI-HA and TßRII-His expression constructs have been described previously (56) and were a gift from Joan Massagué (Memorial Sloan-Kettering Cancer Center, New York).
Transfection and infection of cell lines. 293T cells and HeLa cells were grown in Dulbecco's modified Eagle's medium, and HepG2 cells were grown in alpha minimal essential medium. Both media were supplemented with 10% fetal calf serum, penicillin, streptomycin, and L-glutamine. MCF10A cells were grown in Dulbecco's modified Eagle's medium-F-12 supplemented with 5% donor horse serum, 20 ng/ml EGF, 10 µg/ml insulin, 0.5 µg/ml hydrocortisone, and 100 ng/ml cholera toxin.
For transient transfection, cells were plated at densities between 40 and 60% confluence and GenePorter 2 (Gene Therapy Systems) was used for HepG2 cells and Perfectin (Gene Therapy Systems) was used for 293T cells according to the manufacturer's instructions. For viral transduction, lentivirus was produced essentially as previously described (31). An appropriate dilution of virus-containing media to obtain a multiplicity of infection of 3 to 5 was used to generate pools of cells containing the vector, and the efficiency of viral infection was determined by monitoring green fluorescent protein expression in infected cells by use of fluorescence microscopy.
Measurement of cell surface expression of Cripto constructs in 293T cells. Detection of Cripto expressed at the surface of intact cells via cell surface enzyme-linked immunosorbent assay (ELISA) was performed essentially as previously described (18). 293T cells were plated on 24-well polylysine-coated plates at a density of 100,000 cells per well, transfected 24 h later with 0.5 µg vector or Cripto DNA per well, and then assayed for cell surface expression 48 h after transfection. Cells were rinsed in HEPES dissociation buffer (HDB) (12.5 mM HEPES [pH 7.4], 140 mM NaCl, and 5 mM KCl) and then incubated in 3% bovine serum albumin (BSA) in HDB for 30 min at room temperature (RT). Cells were then incubated for 2 h with 2 µg/ml anti-FLAG (M2) antibody in 3% BSA in HDB, rinsed with HDB, and incubated with peroxidase-conjugated anti-mouse immunoglobulin G in 3% BSA in HDB for 1 h at room temperature. Wells were rinsed with HDB, and then 100 µl of tetramethylbenzidine peroxidase substrate was added to each well. Plates were incubated at RT until the solutions turned visibly blue. Peroxidase activity was stopped by adding 100 µl of 0.18 M H2SO4 to each well, and peroxidase activity was quantified by measuring the absorbance of the resulting yellow solutions at 450 nm.
Covalent cross-linking. 293T cells were plated on six-well plates coated with polylysine at a density of 400,000 cells per well and then transfected approximately 24 h later. Cells were transfected with 4 µg DNA per well with a ratio of 0.5 µg TßRII/0.5 µg TßRI/3 µg Cripto unless otherwise indicated. As necessary, empty vector was used to keep the amount of DNA transfected constant at 4 µg. Covalent cross-linking was performed approximately 48 h after transfection by first rinsing cells in HDB and then incubating them with 125I-TGF-ß1 in binding buffer (HDB containing 0.1% BSA, 5 mM MgSO4, and 1.5 mM CaCl2) at RT for approximately 4 h. Cells were rinsed in HDB, incubated in HDB containing 0.5 mM disuccinylsuberate for 30 min on ice, rinsed in HDB, and then solubilized in lysis buffer (Tris-buffered saline containing 1% NP-40, 0.5% deoxycholate, and 2 mM EDTA) supplemented with standard protease inhibitors for 1 h on ice. Solubilized, cross-linked complexes were incubated for approximately 24 h at 4°C with anti-His, anti-Flag, or anti-HA antibody, and then immune complexes were precipitated using protein G-agarose and analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography as previously described (14).
Luciferase assays. Luciferase assays were carried out using TGF-ß-responsive 3TP-lux and A3-luciferase reporters essentially as previously described (15). The 3TP-lux luciferase reporter contains three consecutive tetradecanoylphorbol acetate response elements and a portion of the plasminogen activator inhibitor 1 (PAI-1) promoter region, while the A3-luciferase construct contains three copies of the ARE (activin response element) from the Xenopus laevis Mix.2 promoter linked to a basic TATA box and a luciferase reporter gene. HepG2 cells were plated at 150,000 cells per well in 24-well plates and transfected in triplicate approximately 24 h later with 1 µg DNA per well, with a ratio of 800 ng Cripto/100 ng 3TP-lux/100 ng cytomegalovirus-ß-galactosidase (CMV-ß-Gal). Cells were treated with TGF-ß1 approximately 30 h after the transfection and harvested 16 h following treatment. Cells were incubated in solubilization buffer (1% Triton X-100, 25 mM glycylglycine [pH 7.8], 15 mM MgSO4, 4 mM EGTA, and 1 mM dithiothreitol) for 30 min on ice, and luciferase reporter activity was measured and normalized relative to CMV-ß-Gal activities. 293T cells were plated on 24-well plates treated with polylysine at 100,000 cells per well and transfected in triplicate approximately 24 h later with 0.5 µg DNA per well by use of 400 ng Cripto/50 ng FAST2 (FoxH1)/25 ng A3-luciferase/25 ng CMV-ß-galactosidase per well. Cells were treated approximately 24 h following transfection and then harvested approximately 16 h following treatment. Luciferase assays were performed as described above for HepG2 cells.
Smad2 phosphorylation. Cells were stably infected with lentivirus and then plated on six-well plates at a density of 100,000 cells per well. Forty-eight hours after plating, cells were washed once with HDB, starved for 1.5 to 8 h in additive-free medium, and then left untreated or treated with TGF-ß1 for 30 min. Cells were rinsed in ice-cold HDB and then harvested by adding 150 µl ice-cold solubilization buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate) supplemented with 50 mM beta-glycerol phosphate, 20 mM NaF, and standard protease inhibitors. Fifty microliters of 4x sample buffer was than added to each sample, and the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted to nitrocellulose. Blots were treated with anti-phospho-Smad2 or anti-Smad2 antibody followed by anti-rabbit antibody conjugated to horseradish peroxidase, and bands were detected using enhanced chemiluminescence.
Cell proliferation assays and colony formation in soft agar. MCF10A cells were stably infected with pCSC lentivirus constructs as described above. Cells were plated on 96-well plates at a density of 500 cells/well, and 48 h later cells were either treated with 100 pM TGF-ß1 or left untreated. Six days after treatment, cell number was determined by using a Cyquant cell proliferation kit according to the manufacturer's instructions. To measure colony formation in soft agar, 12-well plates were prepared with 1.5-ml/well surface layers consisting of 0.6% agar resuspended in MCF10A growth medium. An additional 0.75 ml of 0.33% agar-MCF10A growth medium containing 1,000 stably infected MCF10A cells was then added to each well, and TGF-ß1 (100 pM final concentration) was added before the agar hardened. Wells were refed with 20 µl of MCF10A growth medium with or without TGF-ß1 (final concentration, 100 pM) twice a week for 15 days, and then colonies were visualized microscopically and counted.
RNA extraction and qPCR. Total RNA was extracted from HeLa cells by using an RNeasy mini kit (QIAGEN, Inc., Valencia, CA) according to the manufacturer's instructions. DNase treatment was performed on-column using an RNase-free DNase kit (QIAGEN). SYBR green real-time reverse transcription-PCRs were performed by the microarray/quantitative PCR (qPCR) scientific core facility at the Salk Institute (http://cores.salk.edu/microarray). Sequences of primer pairs specific for human Cripto and GAPDH (glyceraldehyde-3-phosphate dehydrogenase) were as follows: ATGGCCATTTCTAAAGTCTTTGAACT (Cripto-forward), GATGGACGAGCAAATTCCTGAT (Cripto-reverse), TGGAAGGACTCATGACCACAG (GAPDH-forward), and CAGTCTTCTGGGTGGCAGTGA (GAPDH-reverse).
Design of Cripto lentiviral shRNA vectors. Target sequences within the human Cripto gene were identified and selected using the Sfold program (http://sfold.wadsworth.org/sirna.pl). The design of short hairpin RNA (shRNA) and production of lentiviral shRNA vectors were carried out essentially as previously described (44). Briefly, an 83-mer oligonucleotide containing the human Cripto shRNA sequence and a T3 oligonucleotide (5'-CTCGAAATTAACCCTCACTAAAGGG-3') were used to PCR amplify a fragment which was then subcloned into the lentiviral vector in which shRNA expression is driven by an H1 promoter (44). The 83-mers used to generate the Cripto 1 (C1) and Cripto 2 (C2) shRNA vectors were as follows: for C1, 5'-CTGTCTAGACAAAAAGCAAGCTGACCCTGAAGTTCTCTCTTGAA GAACTTCAGGGTCAGCTTGCGGGGATCTGTGGTCTCATACA-3', and for C2, 5'-CTGTCTAGACAAAAAGCAAGCTGACCCTGAAGTTCTCTCTTGAAGAACTTCAGGGTCAGCTTGCGGGGATCTGTGGTCTCATACA-3'.
| RESULTS |
|---|
|
|
|---|
32 kDa appeared and increased in intensity as the amount of Cripto DNA was increased (Fig. 1A, lanes 2 to 7). The fact that 125I-TGF-ß1-Cripto cross-linked complexes were coimmunoprecipitated with an antibody directed against TßRII indicates that TßRII, TGF-ß1, and Cripto form a stable ternary complex.
|
Cripto blocks TGF-ß signaling in 293T cells and HepG2 cells. To determine whether Cripto affects TGF-ß signaling, we first tested its ability to modulate TGF-ß-dependent Smad2 phosphorylation. 293T cells were stably infected with lentivirus containing either Cripto or empty vector and then treated with a range of TGF-ß1 doses. In control cells, phospho-Smad2 was clearly visible following treatment with 10 pM TGF-ß1 and reached near-maximal levels following treatment with 30 pM TGF-ß1 (Fig. 2A). By contrast, phospho-Smad2 was not detected in Cripto-infected cells treated with 10 pM TGF-ß1 and phospho-Smad2 levels were clearly reduced following treatment with 30 pM and 100 pM TGF-ß1 relative to corresponding phospho-Smad2 levels observed in vector-infected cells (Fig. 2A). Therefore, Cripto can mitigate TGF-ß signaling as measured by phosphorylation of Smad2. Since phospho-Smad2 levels directly reflect the TßRI kinase activity resulting from TßRI recruitment into TGF-ß-TßRII complexes, these results further support a role for Cripto as an inhibitor of TGF-ß receptor assembly.
|
4-fold relative to cells transfected with empty vector (Fig. 2B and C). Together with the cross-linking data and phospho-Smad2 data presented above, these results provide additional evidence for a model in which Cripto interferes with receptor assembly to cause a decrease in TGF-ß signaling. Roles of the EGF-like and CFC domains of Cripto in TGF-ß binding. Cripto and other EGF-CFC family members share two conserved cysteine-rich domains, an N-terminal EGF-like domain and a C-terminal CFC domain (41). Each of these modular domains can have activity in the absence of the other, and both have been implicated in specific protein-protein interactions and signaling functions (4, 40, 46). The domain structure of mouse Cripto is illustrated in Fig. 3A. This diagram indicates the locations of the signal peptide, the introduced FLAG epitope, the EGF-like domain, the CFC domain, and the C-terminal hydrophobic region required for GPI anchor attachment.
|
EGF, in which the EGF-like domain has been deleted; and
CFC, in which the CFC domain has been deleted. During posttranslational processing, N-terminal and C-terminal sequences are removed, resulting in a mature Cripto protein consisting almost entirely of the EGF-like and CFC domains (30) (Fig. 3A). Therefore, the
EGF mutant consists essentially of the CFC domain and vice versa. In order to confirm expression of these FLAG-tagged proteins at the cell surface, we transfected constructs into 293T cells and detected Cripto proteins with anti-FLAG antibody by using an intact cell ELISA-based assay (18). As shown in Fig. 3B, each of these Cripto constructs was expressed at the cell surface at similar levels.
We next compared the abilities of wild-type Cripto and the Cripto deletion mutants to bind and cross-link to TGF-ß1 in the presence or absence of TGF-ß signaling receptors. 293T cells were transfected with the indicated constructs (Fig. 3C), labeled with 125I-TGF-ß1, and then subjected to covalent cross-linking followed by immunoprecipitation with an antibody directed against TßRII (anti-His). 125I-TGF-ß1 cross-linked bands corresponding to TßRII as well as wild-type and mutant Cripto forms are indicated (Fig. 3C). As shown in Fig. 1, 125I-TGF-ß1 formed a cross-linked complex with both TßRII and wild-type Cripto (Fig. 3C, lane 3). In addition, 125I-TGF-ß1 clearly formed a cross-linked complex with the
CFC mutant but not the
EGF mutant when these constructs were coexpressed with TßRII (Fig. 3C, lanes 2, 4, and 5). This result demonstrates that the CFC domain is not required for TGF-ß1 binding to Cripto and indicates, rather, that the EGF-like domain binds TGF-ß.
Next, we tested whether TßRII is required for binding of TGF-ß1 to wild-type and mutant forms of Cripto. 293T cells were again transfected with Cripto constructs in the absence or presence of TßRII, labeled with 125I-TGF-ß1, and then subjected to covalent cross-linking followed by immunoprecipitation with an antibody directed against Cripto (anti-FLAG). As shown in Fig. 3D, cross-linking of 125I-TGF-ß1 to Cripto or the Cripto mutants was not observed in the absence of cotransfected TßRII (Fig. 3D, lanes 1 to 3). However, labeled bands containing Cripto and its mutant forms were evident following cotransfection of TßRII (Fig. 3D, lanes 4 to 6). Therefore, TßRII appears to be required for TGF-ß binding to Cripto and, similarly to TßRI, Cripto apparently lacks affinity for TGF-ß unless TGF-ß is first bound to TßRII. Consistent with the data from Fig. 3C, both wild-type Cripto and the
CFC mutant formed cross-linked complexes with 125I-TGF-ß1 when they were coexpressed with TßRII (Fig. 3D, lanes 4 and 6). A faint band was also observed following cross-linking of 125I-TGF-ß1 to the
EGF mutant, indicating this mutant weakly binds TGF-ß (Fig. 3D, lane 5). However, the relative intensities of the bands corresponding to the
EGF-125I-TGF-ß1 and
CFC-125I-TGF-ß1 complexes (Fig. 3D, lanes 5 and 6) indicate that the EGF-like domain plays a predominant role in TGF-ß binding.
In parallel experiments, we measured the effects of the Cripto deletion mutants on cross-linking of 125I-TGF-ß1 to TßRI. As predicted, and as demonstrated in Fig. 1, 125I-TGF-ß1 formed a cross-linked complex with both TßRII and TßRI when these receptor proteins were coexpressed (Fig. 3E, lane 3). Consistent with data presented in Fig. 1B, the intensity of the band corresponding to the TßRI-125I-TGF-ß1 complex was reduced following cotransfection of wild-type Cripto (Fig. 3E, compare lanes 3 and 4). The relative intensity of the labeled TßRI band was similarly reduced when the
CFC mutant was cotransfected but was affected only minimally by cotransfection of the
EGF mutant (Fig. 3E, lanes 3 to 6). The intensities of the bands from Fig. 3E corresponding to TßRI-TGF-ß complexes were quantitated using densitometry and are presented in Fig. 3F. In summary, these cross-linking data indicate that the EGF-like domain of Cripto binds TGF-ß and enables Cripto to block cross-linking of TGF-ß to TßRI. In addition, these results suggest that the CFC domain plays little if any role in these actions.
The EGF-like domain mediates inhibition of TGF-ß signaling.
Next, we tested the effects of wild-type and mutant forms of Cripto on TGF-ß signaling by transfecting Cripto constructs into 293T cells and measuring their effects on induction of a TGF-ß-responsive luciferase reporter gene. Figure 4A shows that following transfection of empty vector into 293T cells, TGF-ß1 treatment caused an
15-fold induction of luciferase relative to untreated cells. Luciferase induction in response to TGF-ß1 was reduced
3-fold following transfection of either wild-type Cripto or the
CFC mutant but was not inhibited following transfection of the
EGF mutant (Fig. 4A). This result indicates once again that the EGF-like domain of Cripto is required for antagonism of TGF-ß1 signaling and that the minimal ability of the CFC domain (
EGF mutant) to bind TGF-ß1 is apparently insufficient to mediate TGF-ß1 antagonism under these assay conditions. Together, these data indicate that the EGF-like domain of Cripto is both necessary and sufficient for the inhibition of TGF-ß signaling in 293T cells.
|
CFC construct also yielded phospho-Smad2 levels that were lower than levels for empty vector-infected cells (Fig. 4C). However, treatment of cells expressing
EGF resulted in phospho-Smad levels similar to those observed for cells infected with empty vector. The results from Fig. 4C were quantitated by measuring the intensities of the phospho-Smad2 bands and then normalizing them relative to the intensities of the corresponding Smad2 bands (Fig. 4D). These data corroborate the luciferase data shown in Fig. 4A and further indicate that the EGF-like domain of Cripto is both necessary and sufficient for Cripto antagonism of TGF-ß signaling.
Cripto blocks antiproliferative effects of TGF-ß in MCF10A cells.
TGF-ß has previously been shown to inhibit anchorage-dependent proliferation of human MCF10A cells (21), and we tested whether Cripto could block this effect. Figure 5A shows that following infection of MCF10A cells with lentivirus containing empty vector, TGF-ß1 treatment reduced cellular proliferation by
62% relative to untreated cells. By contrast, TGF-ß1 treatment of MCF10A cells expressing wild-type Cripto caused a decrease of proliferation of only
37% compared to untreated cells. We further tested the effects of the
EGF and
CFC mutants and found that TGF-ß1 treatment caused decreases in cellular proliferation of
53% and
36%, respectively, relative to corresponding untreated cells (Fig. 5A). Therefore, as previously shown in other assays, both wild-type Cripto and the
CFC mutant had similar abilities to block the cytostatic effect of TGF-ß on MCF10A cells. By contrast, the
EGF mutant had a much smaller effect on TGF-ß-induced growth inhibition. Together, these data demonstrate that Cripto can attenuate the antiproliferative effects of TGF-ß on MCF10A cells and provide further evidence indicating a predominant role for the EGF-like domain of Cripto in mediating TGF-ß antagonism.
|
67% relative to untreated cells. By contrast, TGF-ß1 reduced colony formation in cells infected with Cripto virus by only
36% relative to untreated cells (Fig. 5B), indicating that Cripto inhibits the TGF-ß-dependent antiproliferative response. This Cripto effect required the EGF-like domain since the
EGF mutant had essentially the same effect on TGF-ß1 inhibition of colony formation as empty vector. Finally, the CFC domain was not required for this effect since the
CFC mutant blocked the TGF-ß1 effect on colony formation to the same extent as wild-type Cripto (Fig. 5B). In summary, Cripto reduced TGF-ß1-dependent growth inhibition under anchorage-dependent and anchorage-independent conditions and the EGF-like domain appeared to be both necessary and sufficient for these effects. Reduction of endogenous Cripto expression increases TGF-ß signaling. Finally, we tested whether blocking expression of endogenous Cripto could cause an enhancement of TGF-ß signaling. Cripto is highly expressed in multiple cancer types, including cervical cancer (3), and here we have targeted Cripto expression in HeLa cells, a cervical carcinoma cell line. We generated lentiviral vectors designed to express shRNAs (44) and then infected HeLa cells with virus containing empty vector or one of two shRNA vectors, designated C1 and C2, each designed to target and reduce expression of human Cripto. Following infection, resulting RNA levels were measured and normalized relative to GAPDH by use of real-time qPCR. Figure 6A shows that both of the Cripto shRNA vectors caused reduction of Cripto mRNA levels relative to empty vector. However, the C1 shRNA had a much more pronounced effect than the C2 construct, reducing Cripto mRNA levels nearly fivefold relative to empty vector (Fig. 6A).
|
Model of Cripto antagonism of TGF-ß signaling. Figure 7 illustrates the mechanism we propose for Cripto antagonism of TGF-ß signaling. First, TGF-ß binds its type II receptor with high affinity, resulting in a TGF-ß-TßRII complex. Subsequent cellular responses, such as Smad phosphorylation and growth inhibition, depend on the ability of the TGF-ß-TßRII complex to recruit and activate TßRI (Fig. 7, right). The data presented here suggest a model in which Cripto binds the TGF-ß-TßRII complex (Fig. 7, left) in a manner that blocks the recruitment of TßRI, thereby inhibiting TGF-ß signaling.
|
| DISCUSSION |
|---|
|
|
|---|
Several molecular actions that may contribute to these changes in cell behavior have been attributed to Cripto (46). The results presented here demonstrate the ability of Cripto to cause the second essential alteration listed above by reducing the sensitivity of cells to the cytostatic effects of TGF-ß. We have shown that Cripto attenuates multiple TGF-ß responses, including reporter induction, Smad phosphorylation, and inhibition of cellular proliferation, under both anchorage-dependent and anchorage-independent conditions. We have further demonstrated that targeted knockdown of Cripto expression results in increased TGF-ß signaling. Therefore, endogenous Cripto can mitigate TGF-ß signaling, supporting a model in which the high levels of Cripto observed in human cancers promote tumorigenesis by counteracting the growth-inhibitory effects of TGF-ß.
Cripto inhibits TGF-ß signaling by disrupting receptor assembly. Cripto binds several members of the TGF-ß superfamily and modulates their signaling in at least three distinct ways. First, it acts as an obligate coreceptor for nodals (38), GDF1 (8), and GDF3 (7). Second, it binds Lefty proteins and this interaction blocks Cripto coreceptor function (4). Finally, Cripto binds activins, and in contrast to its coreceptor function, this binding inhibits activin signaling (1, 15).
Here we have attempted to elucidate the molecular mechanism of Cripto antagonism of TGF-ß signaling. Our results show that Cripto binds directly to TGF-ß and forms complexes containing Cripto, TGF-ß, and TßRII. We further demonstrate that Cripto interferes with TGF-ß cross-linking to TßRI, suggesting it disrupts receptor assembly by competing with TßRI for binding to TGF-ß-TßRII complexes. This is similar to our previous finding that Cripto prevents cross-linking of activin-A to ALK4 by forming inhibitory complexes containing Cripto, activin-A, and activin type II receptors (15). A key difference between these two cases, however, is that ALK4 independently binds the CFC domain of Cripto whereas TßRI does not (59, 60). In this regard, ALK4 is associated with complexes containing Cripto, activin-A, and activin type II receptors through its ability to bind directly to Cripto (15). Conversely, TßRI lacks such an ability to associate with analogous complexes containing Cripto, TGF-ß, and TßRII. Indeed, and in contrast to corresponding cross-linking experiments conducted with activin-A (15), no labeled Cripto was detected in this study following anti-TßRI immunoprecipitation. Therefore, although Cripto inhibits cross-linking of activin-A and TGF-ß to their respective type I receptors, it appears to form distinct inhibitory complexes that either contain ALK4 or exclude TßRI. Future studies will focus on determining the functional significance of this difference.
The EGF-like domain of Cripto binds TGF-ß and inhibits TGF-ß signaling. Cripto has diverse signaling functions that have been attributed to its EGF-like and CFC domains. The EGF-like domain, for example, can act as a soluble growth factor and is sufficient to activate mitogenic signaling pathways (26). In addition, this domain independently binds TGF-ß superfamily members, including nodals (30, 59, 60), GDF1 (8), and GDF3 (7), as well as Lefty proteins, which are structurally divergent TGF-ß ligands that antagonize nodal/GDF1/GDF3 signaling through competition for binding to EGF-CFC proteins (4). Finally, the EGF-like domain binds activin-A and is necessary and sufficient for Cripto antagonism of activin-A signaling (15).
By contrast, fewer binding partners and functions have been attributed directly to the CFC domain. The most widely documented role of the CFC domain is its ability to bind directly to the extracellular domain of ALK4, and loss of this binding abolishes EGF-CFC coreceptor function (30, 59, 60). The importance of this interaction is supported by the fact that the nodal antagonist tomoregulin inhibits Cripto coreceptor function by binding the CFC domain and preventing it from binding ALK4 (17). The CFC domain has also been reported to bind directly to activin-B, but not activin-A, to cause antagonism of activin-B signaling (1). This finding suggests that Cripto antagonizes activin-A and activin-B via distinct mechanisms (40) and is noteworthy since it may allow Cripto to discriminate between these two ligands and modulate their activities to differing degrees. In this regard, a greater inhibitory effect of Cripto on activin-B signaling than on activin-A signaling could explain the finding that activin-B cannot fully substitute for activin-A during embryonic development (6). In addition, the binding of activin-B to the CFC domain of Cripto appears to be unique among TGF-ß ligands since, as mentioned above, nodals (30, 59, 60), GDF1 (8), GDF3 (7), Leftys (4), and activin-A (15) are each thought to bind to the EGF-like domain.
As is clear from the discussion above, Cripto binds several TGF-ß ligands and can play distinct and sometimes opposing roles in modulating their function. Also, both the EGF-like domain and the CFC domain have been implicated in distinct functions that are ligand specific. Therefore, the roles of these domains in modulating the function of TGF-ß ligands cannot be predicted a priori. With this in mind, we have tested the roles of the EGF-like and CFC domains in TGF-ß binding and effects on TGF-ß signaling. We found that a Cripto mutant consisting of the EGF-like domain but not the CFC domain efficiently bound TGF-ß, as visualized in cross-linking assays, and that it also inhibited TGF-ß cross-linking to TßRI (Fig. 3). By contrast, the CFC domain alone bound TGF-ß poorly and had little or no effect on TGF-ß cross-linking to TßRI. This led us to predict that the EGF-like domain would also be sufficient to reduce TGF-ß signaling. Indeed, we found that wild-type Cripto and the
CFC mutant inhibited TGF-ß to similar extents in each of the functional assays we employed, confirming that the CFC domain was dispensable for these effects. Likewise, and consistent with our cross-linking data, the CFC domain (
EGF mutant) was unable or poorly able to block TGF-ß signaling in the same assays, illustrating the importance of the EGF-like domain in this context. In light of these data, we propose a model in which the EGF-like domain of Cripto competes with TßRI for binding to the TGF-ß-TßRII complex, resulting in reduced TGF-ß signaling.
Antagonism of TGF-ß signaling provides a novel mechanism of Cripto-induced tumorigenesis. Several reports have supported a role for Cripto in promoting tumor growth. For example, overexpression of Cripto causes anchorage-independent growth and partial transformation of NOG-8 (9) and CID-9 (32) mammary epithelial cells. It has also been shown previously that targeted disruption of Cripto expression abrogates the transformed phenotype in colon carcinoma cells (10). Cripto can further promote epithelial-to-mesenchymal transition and cellular migration, suggesting it may play a role in promoting tumor metastasis (33, 51). Moreover, and in addition to these in vitro data, it has been shown that monoclonal antibodies targeting either the CFC domain (1) or the EGF-like domain (57) of Cripto can inhibit tumor growth in vivo. Finally, a role for Cripto in promoting tumor growth is supported by the fact that transgenic mice in which Cripto expression was driven by the murine mammary tumor virus promoter displayed ductal hyperplasia and mammary tumor formation (52).
TGF-ß is also well established as a regulator of tumor progression and controls tissue homeostasis by inhibiting proliferation of multiple cell types, including most epithelial cells. The importance of this action is underscored by the fact that disruptions/alterations in the TGF-ß signaling pathway have been observed frequently in numerous human cancers (43). However, under these circumstances complete loss of key signaling components, such as receptors and Smad proteins, is rarely observed. Rather, tumor cells are thought to escape from the cytostatic effects of TGF-ß under conditions in which Smad2/3 signaling is reduced but not absent (2, 11, 37, 49). Here, we have provided evidence that Cripto can create such conditions by acting as an inhibitor of TGF-ß signaling. Therefore, in conclusion, we propose that the high levels of Cripto present in human cancers may contribute to tumorigenesis by restraining the growth-inhibitory effects of TGF-ß.
| ACKNOWLEDGMENTS |
|---|
This work was supported by the Foundation for Medical Research, Inc., the Robert J., Jr., and Helen C. Kleberg Foundation, NIH grant CA107420-01, and the International Human Frontier Science Program Organization.
W. Vale is a senior investigator of the Foundation for Medical Research, Inc.
| FOOTNOTES |
|---|
Published ahead of print on 9 October 2006. ![]()
P.C.G. and G.S. contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Akhurst, R. J., and R. Derynck. 2001. TGF-beta signaling in cancera double-edged sword. Trends Cell Biol. 11:S44-S51.[Medline]
3. Bianco, C., L. Strizzi, N. Normanno, N. Khan, and D. S. Salomon. 2005. Cripto-1: an oncofetal gene with many faces. Curr. Top. Dev. Biol. 67:85-133.[Medline]
4. Branford, W. W., and H. J. Yost. 2004. Nodal signaling: CrypticLefty mechanism of antagonism decoded. Curr. Biol. 14:R341-R343.[CrossRef][Medline]
5. Brivanlou, A. H., F. H. Gage, R. Jaenisch, T. Jessell, D. Melton, and J. Rossant. 2003. Stem cells. Setting standards for human embryonic stem cells. Science 300:913-916.
6. Brown, C. W., D. E. Houston-Hawkins, T. K. Woodruff, and M. M. Matzuk. 2000. Insertion of Inhbb into the Inhba locus rescues the Inhba-null phenotype and reveals new activin functions. Nat. Genet. 25:453-457.[CrossRef][Medline]
7. Chen, C., S. M. Ware, A. Sato, D. E. Houston-Hawkins, R. Habas, M. M. Matzuk, M. M. Shen, and C. W. Brown. 2006. The Vg1-related protein Gdf3 acts in a Nodal signaling pathway in the pre-gastrulation mouse embryo. Development 133:319-329.
8. Cheng, S. K., F. Olale, J. T. Bennett, A. H. Brivanlou, and A. F. Schier. 2003. EGF-CFC proteins are essential coreceptors for the TGF-beta signals Vg1 and GDF1. Genes Dev. 17:31-36.
9. Ciardiello, F., R. Dono, N. Kim, M. G. Persico, and D. S. Salomon. 1991. Expression of cripto, a novel gene of the epidermal growth factor gene family, leads to in vitro transformation of a normal mouse mammary epithelial cell line. Cancer Res. 51:1051-1054.
10. Ciardiello, F., G. Tortora, C. Bianco, M. P. Selvam, F. Basolo, G. Fontanini, F. Pacifico, N. Normanno, R. Brandt, M. G. Persico, et al. 1994. Inhibition of CRIPTO expression and tumorigenicity in human colon cancer cells by antisense RNA and oligodeoxynucleotides. Oncogene 9:291-298.[Medline]
11. Derynck, R., R. J. Akhurst, and A. Balmain. 2001. TGF-beta signaling in tumor suppression and cancer progression. Nat. Genet. 29:117-129.[CrossRef][Medline]
12. Ding, J., L. Yang, Y. T. Yan, A. Chen, N. Desai, A. Wynshaw-Boris, and M. M. Shen. 1998. Cripto is required for correct orientation of the anterior-posterior axis in the mouse embryo. Nature 395:702-707.[CrossRef][Medline]
13. Ebert, A. D., C. Wechselberger, S. Frank, B. Wallace-Jones, M. Seno, I. Martinez-Lacaci, C. Bianco, M. De Santis, H. K. Weitzel, and D. S. Salomon. 1999. Cripto-1 induces phosphatidylinositol 3'-kinase-dependent phosphorylation of AKT and glycogen synthase kinase 3beta in human cervical carcinoma cells. Cancer Res. 59:4502-4505.
14. Gray, P. C., J. Greenwald, A. L. Blount, K. S. Kunitake, C. J. Donaldson, S. Choe, and W. Vale. 2000. Identification of a binding site on the type II activin receptor for activin and inhibin. J. Biol. Chem. 275:3206-3212.
15. Gray, P. C., C. A. Harrison, and W. Vale. 2003. Cripto forms a complex with activin and type II activin receptors and can block activin signaling. Proc. Natl. Acad. Sci. USA 100:5193-5198.
16. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57-70.[CrossRef][Medline]
17. Harms, P. W., and C. Chang. 2003. Tomoregulin-1 (TMEFF1) inhibits nodal signaling through direct binding to the nodal coreceptor Cripto. Genes Dev. 17:2624-2629.
18. Harrison, C. A., P. C. Gray, S. C. Koerber, W. Fischer, and W. Vale. 2003. Identification of a functional binding site for activin on the type I receptor ALK4. J. Biol. Chem. 278:21129-21135.
19. Harrison, C. A., P. C. Gray, W. W. Vale, and D. M. Robertson. 2005. Antagonists of activin signaling: mechanisms and potential biological applications. Trends Endocrinol. Metab. 16:73-78.[CrossRef][Medline]
20. Hogan, B. L. 1996. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev. 10:1580-1594.
21. Iavarone, A., and J. Massague. 1997. Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-beta in cells lacking the CDK inhibitor p15. Nature 387:417-422.[CrossRef][Medline]
22. Kannan, S., M. De Santis, M. Lohmeyer, D. J. Riese II, G. H. Smith, N. Hynes, M. Seno, R. Brandt, C. Bianco, G. Persico, N. Kenney, N. Normanno, I. Martinez-Lacaci, F. Ciardiello, D. F. Stern, W. J. Gullick, and D. S. Salomon. 1997. Cripto enhances the tyrosine phosphorylation of Shc and activates mitogen-activated protein kinase (MAPK) in mammary epithelial cells. J. Biol. Chem. 272:3330-3335.
23. Kirkbride, K. C., B. N. Ray, and G. C. Blobe. 2005. Cell-surface co-receptors: emerging roles in signaling and human disease. Trends Biochem. Sci. 30:611-621.[CrossRef][Medline]
24. Lebrin, F., M. J. Goumans, L. Jonker, R. L. Carvalho, G. Valdimarsdottir, M. Thorikay, C. Mummery, H. M. Arthur, and P. ten Dijke. 2004. Endoglin promotes endothelial cell proliferation and TGF-beta/ALK1 signal transduction. EMBO J. 23:4018-4028.[CrossRef][Medline]
25. Lewis, K. A., P. C. Gray, A. L. Blount, L. A. MacConell, E. Wiater, L. M. Bilezikjian, and W. Vale. 2000. Betaglycan binds inhibin and can mediate functional antagonism of activin signalling. Nature 404:411-414.[CrossRef][Medline]
26. Lohmeyer, M., P. M. Harrison, S. Kannan, M. DeSantis, N. J. O'Reilly, M. J. Sternberg, D. S. Salomon, and W. J. Gullick. 1997. Chemical synthesis, structural modeling, and biological activity of the epidermal growth factor-like domain of human cripto. Biochemistry 36:3837-3845.[CrossRef][Medline]
27. López-Casillas, F., S. Cheifetz, J. Doody, J. L. Andres, W. S. Lane, and J. Massagué. 1991. Structure and expression of the membrane proteoglycan betaglycan, a component of the TGF-ß receptor system. Cell 67:785-795.[CrossRef][Medline]
28. López-Casillas, F., J. L. Wrana, and J. Massague. 1993. Betaglycan presents ligand to the TGF beta signaling receptor. Cell 73:1435-1444.[CrossRef][Medline]
29. Massague, J. 1998. TGF-beta signal transduction. Annu. Rev. Biochem. 67:753-791.[CrossRef][Medline]
30. Minchiotti, G., G. Manco, S. Parisi, C. T. Lago, F. Rosa, and M. G. Persico. 2001. Structure-function analysis of the EGF-CFC family member Cripto identifies residues essential for nodal signalling. Development 128:4501-4510.[Medline]
31. Miyoshi, H., U. Blomer, M. Takahashi, F. H. Gage, and I. M. Verma. 1998. Development of a self-inactivating lentivirus vector. J. Virol. 72:8150-8157.
32. Niemeyer, C. C., M. G. Persico, and E. D. Adamson. 1998. Cripto: roles in mammary cell growth, survival, differentiation and transformation. Cell Death Differ. 5:440-449.[CrossRef][Medline]
33. Normanno, N., A. De Luca, C. Bianco, M. R. Maiello, M. V. Carriero, A. Rehman, C. Wechselberger, C. Arra, L. Strizzi, M. Sanicola, and D. S. Salomon. 2004. Cripto-1 overexpression leads to enhanced invasiveness and resistance to anoikis in human MCF-7 breast cancer cells. J. Cell. Physiol. 198:31-39.[CrossRef][Medline]
34. Onichtchouk, D., Y. G. Chen, R. Dosch, V. Gawantka, H. Delius, J. Massague, and C. Niehrs. 1999. Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature 401:480-485.[CrossRef][Medline]
35. Pece-Barbara, N., S. Vera, K. Kathirkamathamby, S. Liebner, G. M. Di Guglielmo, E. Dejana, J. L. Wrana, and M. Letarte. 2005. Endoglin null endothelial cells proliferate faster and are more responsive to transforming growth factor beta 1 with higher affinity receptors and an activated Alk1 pathway. J. Biol. Chem. 280:27800-27808.
36. Rasmussen, S. B., E. Kordon, R. Callahan, and G. H. Smith. 2001. Evidence for the transforming activity of a truncated Int6 gene, in vitro. Oncogene 20:5291-5301.[CrossRef][Medline]
37. Roberts, A. B., and L. M. Wakefield. 2003. The two faces of transforming growth factor beta in carcinogenesis. Proc. Natl. Acad. Sci. USA 100:8621-8623.
38. Schier, A. F. 2003. Nodal signaling in vertebrate development. Annu. Rev. Cell Dev. Biol. 19:589-621.[CrossRef][Medline]
39. Seton-Rogers, S. E., and J. S. Brugge. 2004. ErbB2 and TGF-beta: a cooperative role in mammary tumor progression? Cell Cycle 3:597-600.[Medline]
40. Shen, M. M. 2003. Decrypting the role of Cripto in tumorigenesis. J. Clin. Investig. 112:500-502.[CrossRef][Medline]
41. Shen, M. M., and A. F. Schier. 2000. The EGF-CFC gene family in vertebrate development. Trends Genet. 16:303-309.[CrossRef][Medline]
42. Shi, Y., and J. Massague. 2003. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113:685-700.[CrossRef][Medline]
43. Siegel, P. M., and J. Massague. 2003. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer 3:807-821.[CrossRef][Medline]
44. Singer, O., R. A. Marr, E. Rockenstein, L. Crews, N. G. Coufal, F. H. Gage, I. M. Verma, and E. Masliah. 2005. Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology in a transgenic model. Nat. Neurosci. 8:1343-1349.[CrossRef][Medline]
45. Soule, H. D., T. M. Maloney, S. R. Wolman, W. D. Peterson, Jr., R. Brenz, C. M. McGrath, J. Russo, R. J. Pauley, R. F. Jones, and S. C. Brooks. 1990. Isolation and characterization of a spontaneously immortalized human breast epithelial cell line, MCF-10. Cancer Res. 50:6075-6086.
46. Strizzi, L., C. Bianco, N. Normanno, and D. Salomon. 2005. Cripto-1: a multifunctional modulator during embryogenesis and oncogenesis. Oncogene 24:5731-5741.[CrossRef][Medline]
47. Tian, F., S. D. Byfield, W. T. Parks, C. H. Stuelten, D. Nemani, Y. E. Zhang, and A. B. Roberts. 2004. Smad-binding defective mutant of transforming growth factor beta type I receptor enhances tumorigenesis but suppresses metastasis of breast cancer cell lines. Cancer Res. 64:4523-4530.
48. Tian, F., S. DaCosta Byfield, W. T. Parks, S. Yoo, A. Felici, B. Tang, E. Piek, L. M. Wakefield, and A. B. Roberts. 2003. Reduction in Smad2/3 signaling enhances tumorigenesis but suppresses metastasis of breast cancer cell lines. Cancer Res. 63:8284-8292.
49. Wakefield, L. M., and A. B. Roberts. 2002. TGF-beta signaling: positive and negative effects on tumorigenesis. Curr. Opin. Genet. Dev. 12:22-29.[CrossRef][Medline]
50. Wang, X. F., H. Y. Lin, E. E. Ng, J. Downward, H. F. Lodish, and R. A. Weinberg. 1991. Expression cloning and characterization of the TGF-beta type III receptor. Cell 67:797-805.[CrossRef][Medline]
51. Wechselberger, C., A. D. Ebert, C. Bianco, N. I. Khan, Y. Sun, B. Wallace-Jones, R. Montesano, and D. S. Salomon. 2001. Cripto-1 enhances migration and branching morphogenesis of mouse mammary epithelial cells. Exp. Cell Res. 266:95-105.[CrossRef][Medline]
52. Wechselberger, C., L. Strizzi, N. Kenney, M. Hirota, Y. Sun, A. Ebert, O. Orozco, C. Bianco, N. I. Khan, B. Wallace-Jones, N. Normanno, H. Adkins, M. Sanicola, and D. S. Salomon. 2005. Human Cripto-1 overexpression in the mouse mammary gland results in the development of hyperplasia and adenocarcinoma. Oncogene 24:4094-4105.[Medline]
53. Welt, C., Y. Sidis, H. Keutmann, and A. Schneyer. 2002. Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp. Biol. Med. (Maywood) 227:724-752.
54. Wiater, E., and W. Vale. 2003. Inhibin is an antagonist of bone morphogenetic protein signaling. J. Biol. Chem. 278:7934-7941.
55. Wrana, J. L., L. Attisano, J. Carcamo, A. Zentella, J. Doody, M. Laiho, X. F. Wang, and J. Massague. 1992. TGF beta signals through a heteromeric protein kinase receptor complex. Cell 71:1003-1014.[CrossRef][Medline]
56. Wrana, J. L., L. Attisano, R. Wieser, F. Ventura, and J. Massague. 1994. Mechanism of activation of the TGF-beta receptor. Nature 370:341-347.[CrossRef][Medline]
57. Xing, P. X., X. F. Hu, G. A. Pietersz, H. L. Hosick, and I. F. McKenzie. 2004. Cripto: a novel target for antibody-based cancer immunotherapy. Cancer Res. 64:4018-4023.
58. Xu, C., G. Liguori, M. G. Persico, and E. D. Adamson. 1999. Abrogation of the Cripto gene in mouse leads to failure of postgastrulation morphogenesis and lack of differentiation of cardiomyocytes. Development 126:483-494.[Abstract]
59. Yan, Y.-T., J.-J. Liu, Y. Luo, E. Chaosu, R. S. Haltiwanger, C. Abate-Shen, and M. M. Shen. 2002. Dual roles of Cripto as a ligand and coreceptor in the nodal signaling pathway. Mol. Cell. Biol. 22:4439-4449.
60. Yeo, C., and M. Whitman. 2001. Nodal signals to Smads through Cripto-dependent and Cripto-independent mechanisms. Mol. Cell 7:949-957.[CrossRef][Medline]
This artic