This Article Abstract Full Text (PDF) Other Versions of this Article: MCB.00839-06v1 26/24/9364    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wen, R. Articles by Wang, D. Search for Related Content PubMed PubMed Citation Articles by Wen, R. Articles by Wang, D.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2006, p. 9364-9376, Vol. 26, No. 24
0270-7306/06/$08.00+0     doi:10.1128/MCB.00839-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Essential Role of Phospholipase C2 in Early B-Cell Development and Myc-Mediated Lymphomagenesis

Renren Wen,^1,* Yuhong Chen,^1, Li Bai,^1,2 Guoping Fu,¹ James Schuman,¹ Xuezhi Dai,^1,3 Hu Zeng,^1,3 Chunying Yang,⁴ Robert P. Stephan,⁵ John L. Cleveland,⁴ and Demin Wang^1,6*

Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226,¹ Dali University, Dali, Yunnan, People's Republic of China,² State Key Laboratory of Pharmaceutical Biotechnology, Model Animal Research Center, Nanjing University, Nanjing 210093, People's Republic of China,³ Department of Biochemistry, St. Jude Children's Research Hospital, 332 North Lauderdale Street, Memphis, Tennessee 38105,⁴ Division of Developmental and Clinical Immunology, University of Alabama, Birmingham, Alabama 35294,⁵ Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin 53226⁶

Received 11 May 2006/ Returned for modification 7 June 2006/ Accepted 21 September 2006

	ABSTRACT

Top Abstract Introduction Materials and Methods Results Discussion References

 
Phospholipase C2 (PLC2) is a critical signaling effector of the B-cell receptor (BCR). Here we show that PLC2 deficiency impedes early B-cell development, resulting in an increase of B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B cells. PLC2 deficiency impairs pre-BCR-mediated functions, leading to enhanced interleukin-7 (IL-7) signaling and elevated levels of RAGs in the selected large pre-B cells. Consequently, PLC2 deficiency renders large pre-B cells susceptible to transformation, resulting in dramatic acceleration of Myc-induced lymphomagenesis. PLC2^–/– Eµ-Myc transgenic mice mainly develop lymphomas of B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B-cell origin, which are uncommon in wild-type Eµ-Myc transgenics. Furthermore, lymphomas from PLC2^–/– Eµ-Myc transgenic mice exhibited a loss of p27^Kip1 and often displayed alterations in Arf or p53. Thus, PLC2 plays an important role in pre-BCR-mediated early B-cell development, and its deficiency leads to markedly increased pools of the most at-risk large pre-B cells, which display hyperresponsiveness to IL-7 and express high levels of RAGs, making them prone to secondary mutations and Myc-induced malignancy.

	INTRODUCTION

Top Abstract Introduction Materials and Methods Results Discussion References

 
B-cell development is orchestrated by complex signaling networks, including those emanating from the pre-B-cell receptor (pre-BCR) and the BCR (10, 15). B-cell development follows an ordered series of events that relies on the sequential and proper rearrangements of the immunoglobulin heavy (IgH) and light (IgL) chain genes and upon the controlled expression of cell surface markers and transcription factors (10, 15). IgH chain gene rearrangement initiates in pro-B cells, and its successful rearrangement leads to the formation of the pre-BCR, which consists of the newly generated H chain in complex with the VpreB/5 surrogate light chain (10, 15). Signals emanating from the pre-BCR then provoke the expansion of pre-B cells and direct IgL chain gene rearrangements. Finally, the successfully rearranged L chain complexes with the H chain to generate a surface IgM form of the BCR, a hallmark of immature B cells (10, 15), and signaling from the BCR then orchestrates further B-cell maturation and directs B-cell function (33, 35).

The pre-BCR and BCR complexes have common signal transduction pathway components, including the Ig() and Ig(ß) transmembrane subunits (18, 24, 62). Their signaling relies on the sequential activation of three cytoplasmic tyrosine kinases, Lyn, Syk, and Btk, and upon the recruitment, tyrosine phosphorylation, and activation of the adapter protein SLP-65/BLNK and of the lipid kinase phosphatidylinositol 3-kinase (28, 40, 46). In turn, these events activate phospholipase C2 (PLC2), which hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate, which are required second messengers for diverse cellular responses (47, 48). Underscoring its essential role as a signaling effector, PLC2-deficient mice have profound defects in the transition from immature to mature B cells, and PLC2-deficient B cells fail to respond to mitogens and lack characteristic Ca²⁺ fluxes that follow engagement of the BCR (13, 64).

Due to the requirements for somatic antibody diversity and proper rearrangements of Ig genes, the B cell is an inherently hypermutable environment. Thus, chromosomal lesions can often occur that disrupt B-cell proliferation, apoptosis, and/or differentiation, and these changes ultimately result in B-cell leukemia or lymphoma (55). The t(8;14) chromosomal translocation, which involves the c-Myc oncogene and the regulatory regions of the Ig loci, is the underlying genetic event that gives rise to human Burkitt lymphoma (4, 61). The role of Myc in this disease was established by the creation of the Eµ-Myc transgenic mouse, where c-Myc is overexpressed in the B-cell compartment by virtue of the IgH chain enhancer (Eµ) (1). B cells from these mice display high proliferative rates that are initially offset by Myc's ability to trigger the apoptotic program (42, 52). Ultimately, however, secondary changes occur that bypass Myc's apoptotic program, and these mice generally succumb to lethal lymphoma by approximately 4 months of age (1, 5, 12, 20, 21, 29, 36, 54).

Genetic studies have established that Myc's ability to accelerate cell growth and trigger apoptosis are both rate limiting for lymphoma development in Eµ-Myc transgenics. For example, Myc triggers apoptosis through the agency of the Arf-p53 tumor suppressor pathway, and mutations in Arf and p53 are a hallmark of lymphomas in Eµ-Myc transgenic mice (5, 56) and Burkitt lymphomas (51). Furthermore, Myc's ability to accelerate cell proliferation is linked to its capacity to downregulate the expression of the cyclin-dependent kinase (Cdk) inhibitor p27^Kip1, and loss of p27^Kip1 accelerates Myc-induced lymphomagenesis (2, 36, 39, 41, 45, 63). The Btk and SLP-65 BCR signaling effectors have been suggested to function as tumor suppressors in B-cell transformation (6, 25). Here we report that the PLC2 deficiency impairs pre-BCR signaling and results in an increase of large pre-B cells, their elevated expression of RAGs and interleukin-7 (IL-7) receptor, and their susceptibilities to Myc-induced transformation.

	MATERIALS AND METHODS

Top Abstract Introduction Materials and Methods Results Discussion References

 
Interbreeding of mice and tumor surveillance. PLC2^+/– mice (C57Bl/6 x 129/svj, backcrossed to C57BL/6) were interbred with Eµ-Myc transgenic mice (congenic C57Bl/6) (1, 58). The F₁ offspring were crossed to PLC2^+/– mice to generate PLC2^+/+, PLC2^+/–, and PLC2^–/– Eµ-Myc transgenic littermates. These mice were monitored daily for signs of morbidity and tumor development. A log-rank test was performed to determine the statistical significance of the survival between the different genotypes of Eµ-Myc transgenic mice. Tumors that arose were harvested immediately after sacrifice of animals. Single-cell suspensions were obtained from parts of the tumors and were subjected to fluorescent-activated cell sorter (FACS) analysis. The remainder of the tumor samples was snap frozen in liquid nitrogen for DNA, RNA, and protein analyses.

Flow cytometry. Single-cell suspensions of spleen, bone marrow (BM), lymph node, or tumor tissue were treated with Gey's solution to remove red blood cells and resuspended in phosphate-buffered saline (PBS) with 2% bovine serum albumin (BSA). The cells were then stained with a combination of fluorescence-conjugated antibodies. Cy-Chrome-conjugated anti-B220 (15-0452), allophycocyanin (APC)-conjugated anti-B220 (17-0452), phycoerythrin (PE)-conjugated c-Kit (12-1171), and fluorescein isothiocyanate (FITC)-conjugated anti-Thy1.2 (11-0902) were purchased from eBioscience. Both FITC (1140-02)- and PE-conjugated (1140-09) anti-µ were purchased from Southern Biotechnology. PE-conjugated anti-B220 (553090), PE-conjugated anti-CD43 (553271), biotin-conjugated anti-pre-BCR (clone SL156,551863), biotin-conjugated anti-CD179ß (5) (clone LM34,551865), APC-conjugated anti-CD19 (550992), biotin-conjugated anti-CD24 (555296), biotin-conjugated IL-7R (555288), FITC-conjugated anti-BP-1 (01284D), PE-conjugated CD25 (09985B), FITC-conjugated anti-mouse Ig light chain (550003), FITC-conjugated anti-mouse Ig light chain (553434), PE-conjugated CD25 (09985B), PE-conjugated streptavidin (554061), Cy-Chrome-conjugated streptavidin (554062), and biotin-conjugated Rat IgG2a isotype control (553997) were purchased from BD Biosciences Pharmingen. Anti-mouse CD179 (VpreB) (59) was conjugated with biotin following the manufacturer's recommendations (Pierce). All antibodies were monoclonal antibodies. Samples were applied to FACS analysis.

Thymidine and bromodeoxyuridine (BrdU) incorporation assays. Freshly isolated bone marrow B cells, bone marrow-derived B cells, or FACS-sorted bone marrow B cells were cultured at 2 x 10⁴/well in round-bottom 96-well plates in RPMI-1640 medium with 0.1 mM nonessential amino acids, 1 mM sodium pyruvate, 5 x 10^–5 M 2-mercaptoethanol, 100 U/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine (all from Invitrogen Life Technologies), 10% heat-inactivated fetal bovine serum (HyClone), and the indicated concentrations of IL-7 (0, 0.02, 0.2, 2 ng/ml) for 2 days (IL-7 culture-derived BM B cells) or 4 days (freshly isolated BM B cells). For thymidine incorporation assays, the culture was then pulsed with 1 µCi/well of tritiated deoxythymidine (³H-dT; DuPont) for 18 h and harvested. Incorporated ³H-dT was determined by a Betaplate Liquid Scintillation Counter. For BrdU incorporation assays, FACS-sorted BM B cells were cultured with IL-7 (2 ng/ml) in 48-well plates for 3 days. Subsequently, the cells were incubated with BrdU (10 µM) for 1 h followed by staining with FITC-conjugated anti-BrdU antibodies (347583; BD Bioscience Pharmingen). After staining, the cells were resuspended in 300 µl PBS containing 2% BSA and 1 µg/ml 7-amino-actinomycin D and were immediately analyzed by FACS.

Semiquantitative and real-time RT-PCR. Total RNA were prepared from IL-7 BM culture-derived cells by RNA STAT-60 (Tel-Test, Inc.), and first-strand cDNA was synthesized from total RNA with Omniscript (QIAGEN) according to the manufacturer's instructions. For semiquantitative reverse transcription-PCR (RT-PCR), the specific primers are as follows: RAG1, TGCAGACATTCTAGCACTCTGG (5' primer) and ACATCTGCCTTCACGTCGAT(3' primer); RAG2, GCTATGTCAGAAGCATTCTATTTC (5' primer) and CTTGGCAGGAGTCAAGACTTTCCC (3' primer); ß-actin, ACTCCTATGTGGGTGACGAG and CAGGTCCAGACGCAGGATGGC (3' primer). RAG1 was amplified by 34 cycles of 94°C for 45 s, 55°C for 30 s, and 72°C for 1 min. RAG2 was amplified by 45 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 1 min. The ß-actin gene was used as an internal RNA level control. Real-time RT-PCR was performed as previously described (19). Briefly, the specific primers are as follows: RAG1, CATTCTAGCACTCTGGCCGG (5' primer) and TCATCGGGTGCAGAACTGAA (3' primer); RAG2, TTAATTCCTGGCTTGGCCG and TTCCTGCTTGTGGATGTGAAAT (3' primer); CD19, AATCCACGCATTCAAGTCCAG (5' primer) and GAGCCCTCCTCGCTGTCTG (3' primer). The real-time PCR was performed with an iCycler iQ (Bio-Rad) and was carried out in duplicate or triplicate at 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min in 25-µl reaction volumes. SYBR-Green dye was used to detect amplified DNA. RAG1 or RAG2 transcript was normalized to CD19 expression using standard curves generated for each sample by a series of four consecutive 10-fold dilutions of the cDNA template with iCycler iQ analyzing software.

Western blotting. Protein was extracted from normal primary B cells or B-cell tumors arising in Eµ-Myc transgenic mice, as previously described, with modifications (5). Briefly, cells or tumors were sonicated seven times for 1 s each in ice-cold lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 100 mM Na₃VO₄, 50 mM NaF, 0.1 mM EDTA, 1% Triton X-100, 1 mM dithiothreitol, 0.4 mM phenylmethylsulfonyl fluoride, 3 µg/ml aprotinin, 2 µg/ml pepstain A, 1 µg/ml leupeptin). Lysates were cleared of debris at 12,000 x g for 15 min, and protein in the supernatant was quantified. Protein (100 to 150 µg/lane) was separated in sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis (SDS-10% PAGE), transferred to nitrocellulose membranes, and blotted with antibodies specific for Arf (Ab80; Abcam), p53 (Ab7; Calbiochem), p27^Kip1 (K25020; BD Transduction Labs), PLC2 (sc-407; Santa Cruz Biotechnology), RAG1 (sc-363; Santa Cruz Biotechnology), and actin (1378996; Boehringer Mannheim).

Southern blotting. Genomic DNA was isolated from normal tissue or tumors arising in PLC2^+/+ Eµ-Myc, PLC2^+/– Eµ-Myc, or PLC2^–/– Eµ-Myc transgenic mice. Genomic DNAs (20 µg) were digested with AflII or BamHI, separated in 0.8% agarose gels, transferred to Nytran membranes (Schleicher & Schuell), and probed with the cDNAs coding for Arf (exon 1ß) (AflII digested) or p53 (exons 2 to 10) (BamHI digested).

	RESULTS

Top Abstract Introduction Materials and Methods Results Discussion References

 
PLC2 deficiency results in an increase of large pre-B cells. PLC2 deficiency impedes BCR-mediated B-cell maturation (13, 64). Our recent studies have indicated that PLC2 might play a role in early B-cell development (67). To further study the role of PLC2 in pre-BCR-mediated early B-cell development, we analyzed in detail the development of bone marrow (BM) B cells in PLC2-deficient mice. Based on the expression of the cell surface markers BP-1 and CD24, B220⁺ CD43⁺ B-cell progenitors can be divided into pre-pro-B (fraction A) (B220⁺ CD43⁺ BP-1^– CD24^–), early pro-B (fraction B) (B220⁺ CD43⁺ BP-1^– CD24⁺), late pro-B (fraction C) (B220⁺ CD43⁺ BP-1⁺ CD24⁺⁾, and large pre-B (also termed early pre-B) (fraction C') (B220⁺ CD43⁺ BP-1⁺ CD24^hi) cells (9, 10). FACS analyses of BM cells demonstrated that PLC2-deficient mice had marked reductions in late-stage B cells (B220⁺ CD43^–), which should be due to drastic reductions in mature B (B220^hi IgM⁺) cells (13, 64), and increased proportions of B220⁺ CD43⁺ B-cell progenitors (Fig. 1A). Similar to CD43, c-Kit is also expressed on B-cell progenitors (10). Staining of BM cells with B220 and c-Kit also demonstrated that proportions of B220⁺ c-Kit⁺ B-cell progenitors were increased in PLC2^–/– relative to wild-type mice, although the increases were less dramatic than those of B220⁺ CD43⁺ progenitors (Fig. 1B). Within the B220⁺ CD43⁺ cells, PLC2^–/– mice displayed marked increases in large pre-B cells (fraction C'; B220⁺ CD43⁺ BP-1⁺ CD24^hi) and decreases in early pro-B cells (fraction B) (Fig. 1C). In contrast, the pre-pro-B (fraction A) and late pro-B (fraction C) populations were comparable in wild-type and PLC2^–/– mice (Fig. 1C). In addition, CD25 is only expressed on large and small pre-B cells during B-cell development (10, 50). Although the total population of B220⁺ CD25⁺ B cells was decreased in PLC2^–/– relative to wild-type mice (data not shown), the proportions of large pre-B versus small pre-B among this population were increased in mutant mice compared with wild-type mice (Fig. 1D). Therefore, PLC2 deficiency impairs early B-cell development, resulting in an increase of large pre-B cells (fraction C').

View larger version (30K): [in this window] [in a new window]   FIG. 1. PLC2-deficient mice have a marked increase in the proportions of large pre-B cells. (A) PLC2–/– mice have an increase in B220+ CD43+ B-cell progenitor populations. Bone marrow cells from the indicated mice were stained with anti-B220 and anti-CD43 antibodies. Percentages indicate cells in the gated live BM B220+ populations. Data are representative of at least 12 mice per genotype. (B) PLC2–/– mice have an increase in B220+ c-Kit+ B-cell progenitor populations. BM cells from the indicated mice were stained with anti-B220 and anti-c-Kit antibodies. Percentages indicate cells in the gated live BM B220+ populations. Data are representative of six mice per genotype. (C) PLC2–/– mice have an increase of fraction C', the large pre-B-cell subpopulation. BM cells from mice of the indicated genotypes were stained with anti-B220, anti-CD43, anti-BP-1, and anti-CD24 antibodies. FACS analysis with BP-1 and CD24 staining of B220+ CD43+ gated cells is shown. Percentages indicate cells in the gated B220+ CD43+ populations. Data are representative of 12 mice per genotype. (D) PLC2–/– mice have increased proportions of large pre-B versus small pre-B cells among B220+ CD25+ cells. BM cells from the indicated mice were stained with anti-B220 and anti-CD25 antibodies and examined by forward light-scatter analysis. Percentages indicate cells in the gated B220+ CD25+ populations. Data are representative of six mice per genotype. (E) PLC2–/– BM B cells display augmented rates of proliferation in response to IL-7. B220+ B cells were purified from BM derived from PLC2+/+ and PLC2–/– mice, and their rates of proliferation in response to IL-7 were determined by the incorporation of [3H]thymidine. Data are representative of three independent experiments. (F) PLC2–/– large pre-B cells display augmented rates of [3H]thymidine incorporation in response to IL-7. B220+ CD43+ BP-1+ CD24hi large pre-B cells were sorted from BM derived from PLC2+/+ and PLC2–/– mice, and their rates of proliferation in response to IL-7 were determined by the incorporation of [3H]thymidine. Data are representative of three independent experiments. (G) PLC2–/– large pre-B cells display augmented rates of BrdU incorporation in response to IL-7. B220+ CD43+ BP-1+ CD24hi large pre-B cells were sorted from BM derived from PLC2+/+ and PLC2–/– mice, and their rates of proliferation in response to IL-7 were determined by the incorporation of BrdU. Data are representative of two independent experiments.

PLC2 deficiency impairs pre-BCR-mediated functions. Signals emanating from functional pre-BCR receptors downregulate IL-7 signaling following the transition of pre-BCR-negative late pro-B cells (fraction C) to pre-BCR-positive large pre-B cells (fraction C') (9, 10, 34, 66). To initially assess whether the IL-7 hyperresponsiveness of fraction C' PLC2-deficient B cells was due to alterations of this regulatory loop, we determined the growth potential of B-cell progenitor subsets derived from the in vitro culture of BM from wild-type and PLC2^–/– mice. Interestingly, the in vitro culture of wild-type BM predominately gave rise to IL-7-responsive B220⁺ CD43^{+ – –} B-cell progenitors (Fig. 2A to C). These progenitors were BP-1⁺ CD24^hi large pre-B cells (Fig. 2D) that were pre-BCR^– (pre-BCR is detected with a monoclonal antibody [SL156] that recognizes the surrogate light chain component 5 in association with µ protein) (69) (Fig. 2E), indicating a selection for the growth of progenitors that were at an intermediate developmental stage between late pro-B (fraction C) and large pre-B (fraction C') cells. In contrast, the IL-7 culture-derived progenitors from PLC2^–/– BM were pre-BCR⁺ (Fig. 2E), indicating a selection for a distinct intermediate developmental stage that again lies between fraction C and C' cells.

View larger version (18K): [in this window] [in a new window]   FIG. 2. PLC2-deficient BM cells emerge as highly IL-7-responsive large pre-B cells following in vitro IL-7 culture. BM cells from the indicated mice were cultured in IL-7-containing media for 8 days and then stained with a combination of antibodies to B220, , and , to B220, CD43, BP-1, and CD24, and to B220 and pre-BCR (SL156). (A) FACS analysis of B220 and CD43 expression. Percentages indicate cells in B220+ gated cells. (B) FACS analysis of B220 and expression. Percentages indicate cells in the gated live cells. (C) FACS analysis of B220 and expression. Percentages indicate cells in the gated live cells. (D) FACS analysis of BP-1 and CD24 expression in B220+ CD43+ cells. Percentages indicate cells in the gated B220+ CD43+ populations. (E) FACS analysis of B220 and pre-BCR (SL156) expression. Percentages indicate cells in the gated live cells. Data are representative of three independent experiments.

View larger version (42K): [in this window] [in a new window]   FIG. 3. PLC2 deficiency impairs pre-BCR-mediated functions. (A) PLC2 deficiency impairs pre-BCR-mediated downregulation of IL-7 receptors. BM cells from indicated mice were cultured in vitro with IL-7 for 8 days as described in the legend to Fig. 2. The levels of IL-7 receptor expression on the emerged B-cell progenitors were then determined by FACS analysis with anti-IL-7R antibodies. (B) BM culture-derived PLC2–/– large pre-B cells are hyperresponsive to IL-7. BM IL-7 culture-derived B-cell progenitors were obtained as described above. Their rates of proliferation in response to IL-7 were then determined by the incorporation of [3H]thymidine. (C) PLC2 deficiency impairs pre-BCR-mediated Ca2+ flux. BM cells derived from the indicated mice were stained with antibodies to B220 as well as to and chains, followed by incubation with indo-1AM. Cells were then washed and stimulated with anti-µ antibodies. Pre-BCR-induced Ca2+ flux was determined in B220+ – – gated B-cell progenitors by flow cytometry. Anti-µ antibodies were added at times indicated by the arrows. (D) PLC2 deficiency impairs IgHEL-mediated downregulation of mRNA of RAGs in IL-7-responsive B-cell progenitors. BM cells from PLC2+/+ IgHEL and PLC2–/–IgHEL transgenic mice were cultured in IL-7-containing media for 5 days. Total mRNA extracted from the cells was subjected to semiquantitative RT-PCR using primers designed to detect RAG1 or RAG2. RT-PCR products from the ß-actin gene served as controls for the quantity of the mRNA. (E) Impairment of IgHEL-mediated downregulation of mRNA of RAGs in IL-7-responsive B-cell progenitors by PLC2 deficiency is detected by real-time RT-PCR. The cDNAs derived in experiments depicted in panel D were subjected to real-time PCR using primers designed to detect RAG1 or RAG2. The data are expressed as the ratio of RAG1 or RAG2 transcript to CD19 transcript. Data are representative of four independent experiments. (F) PLC2 deficiency impairs IgHEL-mediated downregulation of RAG1 proteins in IL-7-responsive B-cell progenitors. Total cell lysates from the cells derived in the experiments depicted in panel D were subjected to SDS-PAGE and direct Western blot analysis with anti-RAG1 or anti--actin antibodies. (G) PLC2 deficiency impairs pre-BCR-mediated downregulation of RAG. BM IL-7 culture-derived B-cell progenitors from PLC2+/+ and PLC2–/– mice were obtained as described in the legend to Fig. 2. Total cell lysates were subjected to SDS-PAGE and direct Western blot analysis with anti-RAG1 or anti--actin antibodies. (H) PLC2 deficiency impairs IgHEL-mediated downregulation of VpreB and 5 in BM B cells. BM cells from PLC2+/+ IgHEL and PLC2–/– IgHEL transgenic mice were stained with a combination of antibodies to CD19, VpreB, and 5. Percentages indicate cells in CD19+ gated cells. Data are representative of two mice per genotype.

During B-cell development, rearrangements of the Ig heavy and light chain loci are mediated by recombination activating enzymes RAG1 and RAG2. The expression of these two proteins is also tightly controlled during B-cell development, as they are highly expressed in early and late pro-B cells, are low in pre-BCR-positive large pre-B cells, and are then elevated again in small pre-B cells (8, 31). Signals from the pre-BCR mediates downregulation of RAGs in pre-BCR-positive early pre-B cells (8). Thus, we examined whether PLC2 deficiency also impaired pre-BCR-mediated downregulation of RAGs. The mixed subpopulations of BM B cells in both wild-type and PLC2^–/– mice hindered these analyses. To overcome this difficulty, we employed Ig^HEL transgenic mice, in which BM B cells are largely a single population and uniformly express the hen egg lysozyme (HEL)-specific BCR (7). BM cells from wild-type Ig^HEL and PLC2^–/– Ig^HEL transgenic mice were cultured in vitro with IL-7 for 5 days, and the levels of RAG1 and RAG2 expression on the emerging B-cell progenitors were determined by semiquantitative RT-PCR. Expression of both RAG1 and RAG2 was low in wild-type IL-7-responsive Ig^HEL-positive B-cell progenitors, yet it was markedly increased in PLC2^–/– IL-7-responsive Ig^HEL-positive progenitors (Fig. 3D). The elevation of RAG1 and RAG2 in PLC2^–/– IL-7-responsive Ig^HEL-positive progenitors was confirmed by real-time PCR (Fig. 3E). In addition, the elevation of RAG1 in PLC2^–/– IL-7-responsive Ig^HEL-positive progenitors was also confirmed by immunoblot analysis (Fig. 3F). Thus, in the absence of PLC2, HEL-specific BCR fails to downregulate RAGs in B-cell progenitors. Moreover, failure of pre-BCR to downregulate RAG without PLC2 was confirmed in PLC2^–/– progenitors. BM cells from wild-type and PLC2^–/– mice were cultured in vitro with IL-7 for 8 days, and the levels of RAG1 expression in the emerging B-cell progenitors were determined by immunoblot analysis. Expression of RAG1 was markedly increased in pre-BCR-positive large pre-B PLC2^–/– progenitors relative to wild-type IL-7-responsive pre-BCR-negative late pro-B progenitors (Fig. 3G). Therefore, PLC2 deficiency leads to a failure of the pre-BCR to downregulate RAGs.

During B-cell development, signals from the pre-BCR also mediate downregulation of VpreB and 5 (44, 65). Thus, we examined whether PLC2 deficiency also impaired pre-BCR-mediated downregulation of VpreB and 5 by examining BM cells from PLC2^–/– Ig^HEL transgenic mice. HEL-specific BCR expression is initiated in pro-B cells, and nearly all BM B cells from wild-type Ig^HEL and PLC2^–/– Ig^HEL transgenic mice were Ig^HEL positive (data not shown). As expected, few PLC2^+/+ Ig^HEL BM B cells expressed VpreB or 5 on the cell surface, at least by conventional staining techniques (65) (Fig. 3H). In contrast, the vast majority of PLC2^–/– Ig^HEL BM B cells expressed VpreB or 5 (Fig. 3H). PLC2^–/– Ig^HEL BM B cells also expressed higher levels of VpreB and 5 protein in their cytoplasm (data not shown). Thus, PLC2 deficiency also impairs pre-BCR-mediated downregulation of VpreB or 5.

PLC2 deficiency accelerates Myc-induced lymphomagenesis. PLC2 deficiency results in an increase of large pre-B cells with hyperresponsiveness to IL-7 and high recombinogenic activities. These PLC2-deficient large pre-B cells are likely at risk for mutations that lead to transformation. Although spontaneous B-cell lymphomas have not been detected in PLC2^–/– mice, we reasoned that the susceptibility of PLC2-deficient large pre-B cells to transformation might be revealed in the context of other lesions that promote lymphomagenesis. To test this hypothesis, we examined the contribution of PLC2 to B-cell lymphomagenesis in Eµ-Myc transgenic mice, which overexpress c-Myc in B cells by virtue of the IgH Eµ enhancer and die of clonal pre-B- and B-cell lymphoma beginning at 4 months of age (1).

Congenic C57Bl/6 Eµ-Myc transgenic mice were bred to C57Bl/6 PLC2^+/– mice, and the PLC2^+/– Eµ-Myc F₁ offspring were bred with PLC2^+/– mice to obtain PLC2^+/+, PLC2^+/–, and PLC2^–/– Eµ-Myc mice. These littermates were then monitored for their course of disease. Wild-type Eµ-Myc littermates displayed a mortality curve typical for these mice, with a mean mortality of 19 weeks (Fig. 4A) (1). Notably, there were no effects of PLC2 heterozygous deficiency on tumor development, as PLC2^+/– Eµ-Myc mice died at rates comparable to those of wild-type transgenics (Fig. 4A), suggesting PLC2 did not behave as a classic tumor suppressor. Nonetheless, PLC2^–/– Eµ-Myc transgenics displayed a greatly accelerated course of disease, with a mean mortality of 10 weeks (Fig. 4A). By 8 weeks of age, most PLC2^–/– Eµ-Myc transgenics had massively enlarged lymph nodes, a hallmark of Eµ-Myc-induced lymphoma (1), whereas this was not evident in wild-type Eµ-Myc and PLC2^+/– Eµ-Myc littermates (Fig. 4B and data not shown). Further, FACS analyses showed that cells from the lymph nodes of control wild-type, PLC2^–/–, and precancerous wild-type Eµ-Myc mice were small lymphocytes as expected, whereas cells from the lymph nodes of 8-week-old diseased PLC2^–/– Eµ-Myc transgenics were mainly large B cells (Fig. 4C and D). Therefore, loss of PLC2 accelerates Myc-induced lymphomagenesis.

View larger version (58K): [in this window] [in a new window]   FIG. 4. PLC2 deficiency accelerates Myc-induced lymphomagenesis. (A) Kaplan-Meier survival curves of PLC2+/+, PLC2–/–, PLC2+/+ Eµ-Myc, PLC2+/– Eµ-myc, and PLC2–/– Eµ-Myc mice. The genotypes of the mice are indicated next to the survival curves, and the numbers of mice in each group are indicated by the n values. Vertical lines indicate ages of surviving mice. Although PLC2 deficiency alone led to some mortality, this appears due to immune deficiency and bleeding (64), and the majority of PLC2–/– mice survived more than 40 weeks when supplemented with the antibiotic sulfatrim (a condition under which all mice were maintained). (B) PLC2–/– Eµ-Myc transgenic mice develop rapid lymphoma. A substantial portion of PLC2–/– Eµ-Myc mice (8 weeks old) had enlarged lymph nodes, whereas PLC2+/+ Eµ-Myc mice (8 weeks old) had normal lymph nodes (upper). Examination of these same mice displayed massive enlargement of axillary and inguinal lymph nodes of PLC2–/– Eµ-Myc mice (lower). (C) Lymphoma arising in the lymph nodes derived from PLC2–/– Eµ-Myc mice consists of large cells. Lymph node cells from 8-week-old PLC2+/+, PLC2–/–, PLC2+/+ Eµ-Myc, and PLC2–/– Eµ-Myc mice were examined by forward and side light-scatter analysis. The very large lymphoma cells arising in the lymph nodes are typical of PLC2–/– Eµ-Myc mice. (D) Lymphoma arising in the lymph nodes derived from PLC2–/– Eµ-Myc mice is a B-cell type. Lymph node cells from the indicated mice were stained with anti-B220 and anti-Thy1.2. Percentages indicate cells in the gated live cell populations. Data are representative of at least 12 mice per genotype.

PLC2 deficiency selects for transformation of large pre-B cells.

View larger version (24K): [in this window] [in a new window]   FIG. 5. PLC2-deficient Eµ-Myc mice exclusively develop lymphomas of large pre-B-cell origin. (A) Lymphoma cells from PLC2–/– Eµ-Myc mice are exclusively B220+ CD43+ B-cell progenitors. Lymphoma cells from the indicated mice were stained with anti-B220 and anti-CD43. Percentages indicate cells in the gated live cell populations. Data are representative of 18 mice per genotype. (B) Lymphoma cells from the vast majority of PLC2–/– Eµ-Myc mice are of B220+ CD43+ BP-1+ CD24hi large pre-B-cell origin. Lymphoma cells from PLC2–/– Eµ-Myc mice were stained with anti-B220, anti-CD43, anti-BP-1, and anti-CD24 antibodies. FACS analysis in the gated B220+ CD43+ populations is shown. Percentages indicate cells in the gated B220+ CD43+ populations. Data are representative of 15 B220+ CD43+ PLC2–/– Eµ-Myc lymphomas. (C) Lymphoma cells from PLC2–/– Eµ-Myc mice are pre-BCR+. Lymphoma cells from PLC2–/– Eµ-Myc mice were stained with anti-B220 and anti-pre-BCR (SL156). Percentages indicate cells in the gated live cell populations. Data are representative of 18 PLC2–/– Eµ-Myc lymphomas. (D) Lymphoma cells from PLC2–/– Eµ-Myc mice are µ+ +. Lymphoma cells from PLC2–/– Eµ-Myc mice were stained with anti-B220, anti-µ, and anti-. Percentages indicate cells in the gated B220+ populations. Data are representative of 18 PLC2–/– Eµ-Myc lymphomas. (E) Lymphoma cells from PLC2–/– Eµ-Myc mice respond to IL-7. The rates of proliferation of lymphoma cells from the indicated individual mouse in the absence (–) or presence (IL-7) of IL-7 were determined by the incorporation of [3H]thymidine. Data are representative of four PLC2+/+ Eµ-Myc and four PLC2–/– Eµ-Myc lymphomas from individual mice.

View this table: [in this window] [in a new window]   TABLE 1. Lymphomas arising in PLC2+/+ Eµ-Myc and PLC2–/– Eµ-Myc micea

Moreover, lymphoma cells arising in most wild-type Eµ-Myc mice (four of five examined) proliferated comparably in the absence and presence of IL-7 (Fig. 5E). In contrast, IL-7 further markedly enhanced proliferation of lymphoma cells arising in all PLC2^–/– Eµ-Myc mice we examined (Fig. 5E), demonstrating expression of IL-7 receptors on the PLC2^–/– Eµ-Myc lymphoma cells. Taken together, the PLC2 deficiency selectively leads to transformation of IL-7-responsive B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B cells, and these are highly prone to unscheduled immunoglobulin gene rearrangements.

Lymphomas from PLC2^–/– Eµ-Myc transgenic mice exhibited a loss of p27^Kip1 and often displayed alterations in Arf or p53. Myc accelerates cell proliferation at least in part through its ability to promote degradation of the cyclin-dependent kinase (Cdk) inhibitor p27^Kip1 (2, 39, 41, 45, 63), and loss of p27^Kip1 accelerates Myc-induced lymphomagenesis (36). We therefore evaluated whether the effects of the PLC2 deficiency in accelerating Myc-induced lymphoma development could be attributed to its effects upon p27^Kip1. As expected, p27^Kip1 levels were reduced in precancerous Eµ-Myc B cells compared to those present in wild-type B cells, but loss of PLC2 alone had no effect on p27^Kip1 levels or on the reduced levels of p27^Kip1 expressed in Eµ-Myc B cells )(Fig. 6A.Nevertheless, the Myc-to-p27^Kip1 pathway was targeted in lymphomas, as levels of p27^Kip1 were essentially undetectable in lymphomas derived from both wild-type Eµ-Myc and PLC2^–/– Eµ-Myc transgenic mice (Fig. 6A). Therefore, suppression of p27^Kip1 is a hallmark of lymphoma development in Eµ-Myc transgenic mice, and in the absence of PLC2, Myc still induces lymphoma development by targeting p27^Kip1. B-cell lymphomas lacking p27^Kip1 expression arise within 1 to 2 months in PLC2^–/– Eµ-Myc mice versus 4 to 6 months in wild-type Eµ-Myc mice.

View larger version (62K): [in this window] [in a new window]   FIG. 6. PLC2 deficiency accelerates the rate of loss of p27Kip1 and mutations in the Arf-p53 pathway. (A) Expression of p27Kip1, p53, Arf, and PLC2 in lymphomas arising in PLC2+/+ Eµ-Myc, PLC2+/– Eµ-Myc, and PLC2–/– Eµ-Myc mice. Total cell lysates of pro/pre and lymph node (LN) B cells and of lymphomas from the indicated mice were subjected to SDS-PAGE and Western blot analysis with the indicated antibodies. Lymphomas harboring p53 mutations and/or overexpressing Arf protein are indicated by an asterisk. (B) Southern blot analysis of the lymphomas. Genomic DNAs were extracted from the indicated lymphomas, digested with AflII, and hybridized with an Arf probe that detects a fragment containing Arf exon 1ß. BamHI-digested DNAs were hybridized with a p53 probe that detects a fragment containing p53 exons 2 to 10. Samples with deletion of p53 or Arf alleles are indicated by an asterisk. Lymphomas from 14 PLC2+/+ Eµ-Myc or PLC2+/– Eµ-Myc mice and from 21 PLC2–/– Eµ-Myc mice were analyzed.

	DISCUSSION

Top Abstract Introduction Materials and Methods Results Discussion References

 
PLC2 is predominantly expressed in B cells and is activated following ligation of the pre-BCR or BCR (3, 17). The PLC2 deficiency severely impairs the late stages of B-cell development and abolishes the mitogenic response following BCR engagement (13, 64), yet the studies reported herein revealed that the PLC2 deficiency also has profound effects on early B-cell development, as there are substantial increases in the B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ fraction C' cells, the large recycling pre-B cells (11). Increases in this compartment are indicative of an impaired transition of large recycling CD43⁺ pre-B cells to small resting CD43^– pre-B cells (11). Previous studies have demonstrated that functions of IL-7 receptors are not impaired by the absence of PLC2 (67), and indeed here we have shown that the IL-7 response is augmented in pre-BCR-positive large pre-B PLC2^–/– progenitors. Thus, the pre-BCR requires PLC2 to direct this developmental transition, and in the absence of PLC2 there is an expansion of the IL-7-responsive large pre-B cells. Interestingly, a blockade in the transition of large recycling CD43⁺ pre-B cells to small resting CD43^– pre-B cells is also observed in mice lacking the Btk or SLP-65 signaling effector, which functions immediately upstream of PLC2 in directing pre-BCR and BCR signals (22, 37, 43, 70), and Btk- or SLP-65-deficient large pre-B cells are also hyperresponsive to IL-7 (6, 25).

During the progression of pre-BCR^– late pro-B (fraction C) cells to pre-BCR⁺ large pre-B (fraction C') cells, signals emanating from newly formed pre-BCR not only promote B-cell differentiation but also rapidly downregulate IL-7 receptor signaling (9, 10, 34, 66). PLC2 deficiency impairs pre-BCR signaling, and this results in a failure to downregulate IL-7 receptors such that the in vitro culture of BM progenitors from PLC2^–/– mice in IL-7 generates B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B-cell progenitors that have elevated, rather than reduced, levels of IL-7 receptors. These IL-7-responsive/pre-BCR⁺ B-cell progenitors may represent an intermediate developmental stage between late pro-B (fraction C) and large pre-B (fraction C') cells, which might exist only momentarily and are thus not readily detected in wild-type mice. Finally, these PLC2^–/– large pre-B cells have dramatically increased capacities in IL-7-mediated proliferation, and this is associated with marked increases in B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B-cell progenitors in PLC2^–/– mice (64). Similarly, Btk- and SLP-65-deficient bone marrow B cells show an enhanced proliferative expansion in response to IL-7 in vitro, consistent with increases in large pre-B cells observed in these knockout mice (6, 37). Given these similarities, we predict that the Btk and SLP-65 deficiencies also generate increased numbers of B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺ large pre-B-cell progenitors that have augmented levels of IL-7 receptors.

In vivo, large recycling pre-B cells are the most rapidly proliferating subset of B-cell progenitors (11) and are inherently susceptible to genetic insults. The high susceptibility of this compartment is caused by the recombination machinery driven by the expression of the RAG recombinases in these cells (19, 31, 71). Normally, the expression of RAG proteins is tightly controlled and undergoes three waves of expression, being high in early and late pro-B cells, low in pre-BCR⁺ large pre-B cells, and then high again in small pre-B cells (8, 31). Signals from the pre-BCR downregulate the expression of RAGs in pre-BCR⁺ large pre-B cells (8). Interestingly, PLC2 is here revealed to be required for suppressing RAG expression in pre-BCR⁺ large pre-B cells, and this finding is in accord with the rapidly arising lymphomas of PLC2^–/– Eµ-Myc transgenic mice, which originate exclusively from large pre-B cells (B220⁺ CD43⁺ BP-1⁺ CD24^hi pre-BCR⁺) and that have unscheduled rearrangements of light chain loci. RAG activity has been linked to an increased tendency for chromosomal translocations and for tumor development (72). Despite the evidence that high levels of RAG activities might play a role in the PLC2 deficiency-caused acceleration of Myc-induced lymphomagenesis, we couldn't directly examine the role of RAG in this process by deletion of RAG in PLC2^–/– Eµ-Myc mice, as the RAG deficiency results in a complete absence of pre-B cells (38, 57), which would prevent large pre-B-cell lymphoma formation in PLC2^–/– Eµ-Myc mice. However, introduction of the Ig^HEL transgene into RAG^–/– PLC2^–/– Eµ-Myc and RAG^+/+ PLC2^–/– Eµ-Myc mice and subsequent studies of the kinetics of development of lethal B-cell lymphomas in RAG^–/– PLC2^–/– Eµ-Myc Ig^HEL and RAG^+/+ PLC2^–/– Eµ-Myc Ig^HEL mice would address the role of RAG in the acceleration of Myc-induced lymphomagenesis by PLC2 deficiency and would be warranted. Regardless, our findings are consistent with a model where highly proliferating and genetically unstable large pre-B cells are at a very high risk for progression to frank lymphoma once oncogenic insults arise. Further, these findings suggest that mice lacking Btk and/or SLP-65 would also display accelerated rates of large pre-B-cell lymphoma development in the face of an oncogenic insult such as Myc.

Despite these findings, we fail to observe spontaneous B-cell lymphomas in PLC2-deficient mice (although splenomegaly is frequently evident). At face value these findings would appear to contrast with those reported for SLP-65-deficient mice, as these mice have been reported to develop pre-B-cell lymphomas (6). However, the reported frequency of these tumors in SLP-65-deficient mice is also low, and differences in tumor incidence could be easily attributed to different strain backgrounds (the PLC2-deficient mice used here are on a C57Bl/6 background, whereas SLP-65-deficient mice were on a BALB/c background (6, 22). Furthermore, Btk-deficient mice are not prone to the development of B-cell lymphomas (25). Alternatively, the SLP-65 deficiency could be more severe in impairing the transition from large cycling pre-B cells to small resting pre-B cells than that observed in PLC2- and Btk-deficient mice, a scenario that would increase the numbers of at-risk cells that are prone to transformation. In support of this notion, mice lacking both Btk and SLP-65, which have arrested early B-cell development at the large cycling pre-B-cell stage, are highly prone to lymphoma development (25). Collectively, these findings strongly support the simple concept that the larger the compartment of proliferating large pre-B cells, the higher the risk of developing lymphoma.

Myc's ability to provoke tumorigenesis is held in check by the p27^Kip1 Cdk inhibitor that restricts G₁- to S-phase cell cycle progression (2, 39, 41, 45, 63) and by the Arf-p53 pathway that provokes apoptosis (5, 56). Loss of PLC2 has essentially no effect on the overall frequency of mutations in the Arf-p53 pathway. Nonetheless, B-cell lymphomas with disrupted Arf or p53 arise within 1 to 2 months in PLC2^–/– Eµ-Myc mice versus 4 to 6 months in wild-type Eµ-Myc mice. It seems that PLC2 deficiency might accelerate the rate of disruption of this tumor suppressor pathway during in vivo lymphomagenesis. However, it is equally possible that the rate of Arf or p53 disruption is unchanged, but the overall probabilities increase due to enlarged pools and/or enhanced proliferation rates of target cells in the absence of PLC2. In addition, loss of p27^Kip1 is also revealed here as a hallmark of lymphoma development, but this occurs regardless of PLC2 status. B-cell lymphomas lacking p27^Kip1 expression arise within 1 to 2 months in PLC2^–/– Eµ-Myc mice versus 4 to 6 months in wild-type Eµ-Myc mice. Again, the rate of p27^Kip1 suppression could be hastened by PLC2 deficiency, or, equally possible, the probabilities but not the rate of p27^Kip1 disappearance increase as pools and/or proliferation rates of target cells increase in the absence of PLC2.

Most importantly, these findings support the notion that signals orchestrated by the pre-BCR serve as guardians against B-cell transformation by holding proliferation and genome stability in check and by limiting the numbers of cells that are at highest risk for transformation. In this light PLC2 could be cast as a tumor suppressor, as suggested for SLP-65 (25). However, cells heterozygous for mutations in classic tumor suppressors such as Rb, p53, and Arf nearly always display loss of the wild-type allele or silencing of the gene, and as a consequence there are always significant effects of heterozygous deficiency on tumor formation. Such is not the case for Eµ-Myc mice heterozygous deficient for PLC2, which develop lymphomas at the same pace as wild-type transgenics, do not display loss of the wild-type PLC2 allele, and which sustain PLC2 expression. In accord, B-cell tumors have also never been reported in Btk^+/– or SLP-65^+/– mice, as would be expected for mice bearing lesions in bona fide tumor suppressors (6, 25). Therefore, we propose that PLC2, and by inference SLP-65 and Btk, behave as guardians that prevent B-cell transformation by coordinating developmental cues with cell proliferation.

	ACKNOWLEDGMENTS

 
We gratefully acknowledge the technical support of Shoua Yang and Elsie White.

This work is supported in part by NIH grants R01 AI52327 (R.W.), R01 HL073284 (D.W.), and RO1 CA76379 (J.L.C.), by the American Cancer Society grant RSG CCG-106204 (D.W.), Cancer Center Core grant CA-21765, and by the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital.

	FOOTNOTES

 
* Corresponding author. Mailing address: Blood Research Institute, 8727 Watertown Plank Road, Milwaukee, WI 53226. Phone: (414) 937-3874. Fax: (414) 937-6284. E-mail for Renren Wen: renren.wen{at}bcw.edu. E-mail for Demin Wang: demin.wang{at}bcw.edu.

Published ahead of print on 9 October 2006.

These authors contributed equally to this work.

	REFERENCES

Top Abstract Introduction Materials and Methods Results Discussion References

 
1. Adams, J. M., A. W. Harris, C. A. Pinkert, L. M. Corcoran, W. S. Alexander, S. Cory, R. D. Palmiter, and R. L. Brinster.1985 . The c-myc oncogene driven by immunoglobulin enhancers induces lymphoid malignancy in transgenic mice.Nature 318:533-538.[CrossRef][Medline]

2. Bouchard, C., K. Thieke, A. Maier, R. Saffrich, J. Hanley-Hyde, W. Ansorge, S. Reed, P. Sicinski, J. Bartek, and M. Eilers. 1999. Direct induction of cyclin D2 by Myc contributes to cell cycle progression and sequestration of p27. EMBO J. 18:5321-5333.[CrossRef][Medline]

3. Coggeshall, K. M., J. C. McHugh, and A. Altman.1992 . Predominant expression and activation-induced tyrosine phosphorylation of phospholipase C-gamma 2 in B lymphocytes.Proc. Natl. Acad. Sci. USA 89:5660-5664.[Abstract/Free Full Text]

4. Dalla-Favera, R., M. Bregni, J. Erikson, D. Patterson, R. C. Gallo, and C. M. Croce. 1982. Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc. Natl. Acad. Sci. USA 79:7824-7827.[Abstract/Free Full Text]

5. Eischen, C. M., J. D. Weber, M. F. Roussel, C. J. Sherr, and J. L. Cleveland.1999 . Disruption of the ARF-Mdm2-p53 tumor suppressor pathway in Myc-induced lymphomagenesis. Genes Dev. 13:2658-2669.[Abstract/Free Full Text]

6. Flemming, A., T. Brummer, M. Reth, and H. Jumaa. 2003. The adaptor protein SLP-65 acts as a tumor suppressor that limits pre-B cell expansion. Nat. Immunol. 4:38-43.[CrossRef][Medline]

7. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, and K. Raphael. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676-682.[CrossRef][Medline]

8. Grawunder, U., T. M. Leu, D. G. Schatz, A. Werner, A. G. Rolink, F. Melchers, and T. H. Winkler.1995 . Down-regulation of RAG1 and RAG2 gene expression in pre-B cells after functional immunoglobulin heavy chain rearrangement.Immunity 3:601-608.[CrossRef][Medline]

9. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, and K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B-cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213-1225.[Abstract/Free Full Text]

10. Hardy, R. R., and K. Hayakawa. 2001. B cell development pathways. Annu. Rev. Immunol. 19:595-621.[CrossRef][Medline]

11. Hardy, R. R., Y. S. Li, D. Allman, M. Asano, M. Gui, and K. Hayakawa. 2000. B-cell commitment, development and selection. Immunol. Rev. 175:23-32.[CrossRef][Medline]

12. Harris, A. W., C. A. Pinkert, M. Crawford, W. Y. Langdon, R. L. Brinster, and J. M. Adams.1988 . The E mu-myc transgenic mouse. A model for high-incidence spontaneous lymphoma and leukemia of early B cells.J. Exp. Med. 167:353-371.[Abstract/Free Full Text]

13. Hashimoto, A., K. Takeda, M. Inaba, M. Sekimata, T. Kaisho, S. Ikehara, Y. Homma, S. Akira, and T. Kurosaki. 2000. Cutting edge: essential role of phospholipase C- 2 in B cell development and function. J. Immunol. 165:1738-1742.[Abstract/Free Full Text]

14. Haupt, Y., R. Maya, A. Kazaz, and M. Oren. 1997. Mdm2 promotes the rapid degradation of p53. Nature 387:296-299.[CrossRef][Medline]

15. Healy, J. I., and C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors.Annu. Rev. Immunol. 16:645-670.[CrossRef][Medline]

16. Hemann, M. T., A. Bric, J. Teruya-Feldstein, A. Herbst, J. A. Nilsson, C. Cordon-Cardo, J. L. Cleveland, W. P. Tansey, and S. W. Lowe. 2005. Evasion of the p53 tumour surveillance network by tumour-derived MYC mutants.Nature 436:807-811.[CrossRef][Medline]

17. Hempel, W. M., R. C. Schatzman, and A. L. DeFranco. 1992. Tyrosine phosphorylation of phospholipase C-gamma 2 upon cross-linking of membrane Ig on murine B lymphocytes. J. Immunol. 148:3021-3027.[Abstract]

18. Hombach, J., T. Tsubata, L. Leclercq, H. Stappert, and M. Reth.1990 . Molecular components of the B-cell antigen receptor complex of the IgM class. Nature 343:760-762.[CrossRef][Medline]

19. Hsu, L. Y., J. Lauring, H. E. Liang, S. Greenbaum, D. Cado, Y. Zhuang, and M. S. Schlissel. 2003. A conserved transcriptional enhancer regulates RAG gene expression in developing B cells. Immunity 19:105-117.[CrossRef][Medline]

20. Jacobs, J. J., B. Scheijen, J. W. Voncken, K. Kieboom, A. Berns, and M. van Lohuizen. 1