![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orbán Komonyi,2,
Tibor Pankotai,2 and
Imre M. Boros1,2*
Institute of Biochemistry, Biological Research Center, Temesvári krt. 62, H-6726 Szeged, Hungary,1 Department of Genetics and Molecular Biology, University of Szeged, Közép fasor 52, H-6726 Szeged, Hungary2
Received 31 July 2006/ Returned for modification 3 September 2006/ Accepted 2 October 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Recently, we and others found that, in contrast with the single Ada2 gene present in Saccharomyces cerevisiae, the Drosophila melanogaster genome contains two genes, referred to as dAda2a and dAda2b, encoding related Ada2 proteins (21, 24). In several other metazoan organisms, including mouse, human, and Arabidopsis thaliana, there are also two Ada2-type coactivators (4, 11, 34).
Biochemical separation of Ada2-containing Drosophila complexes indicated that dAda2a is present in a smaller (0.8 MDa) complex and dAda2b is present in a larger (2 MDa) complex, most probably corresponding to Drosophila ADA (dADA) and Drosophila SAGA (dSAGA), respectively (21, 24, 25). Recently, Guelman et al. reported the biochemical separation of a further dAda2a-dGcn5-containing complex, ATAC (18). Other variants of Gcn5-containing HAT complexes have also been identified in both yeast and mammalian cells. They include SALSA (SAGA altered and Spt8 absent) (32), SLIK (SAGA-like) (28), and STAGA (SPT3-TAF-GCN5 acetylase) (23). In all of these, the Gcn5 and Ada2 proteins are common constituents (for a review, see reference 13), which raises the question of how the functional divergence of these complexes is determined.
In a number of independent studies, a direct physical interaction between Ada2 and Gcn5 has been demonstrated both in vitro and in vivo, and the SANT domain of Ada2 has been implicated in the interaction (8, 22, 34). Ada2 also associates physically with TATA binding protein and a number of acidic activators (3). Numerous studies on the Ada2-Gcn5 interaction thus suggest that Ada2 is required for the assembly of Gcn5-containing complexes, within which it is involved in activator and TATA binding protein recruitment and, by virtue of its SANT domain, also effects Gcn5 activity (1-3, 7, 22, 34, 35). Accordingly, the deletion of the Ada2 SANT domain has the same negative effect as that of Gcn5 deletion on the activation of the yeast PHO promoter (2).
Recombinant yeast Gcn5 (yGcn5) acetylates free histone 3 (H3), but exhibits little activity towards histones assembled into nucleosome particles. Together with Ada2 and Ada3 proteins, yGcn5 acetylates an expanded set of lysines and exhibits a preference for the lysines of nucleosomal H3 substrate. The results of in vitro acetylation assays performed using H3 peptides and nucleosomal H3 as a substrate led to the conclusion that the Ada2 and Ada3 proteins play roles in enhancing Gcn5 HAT activity and determining the enzyme substrate specificity (17, 21). yGcn5 mutations were also found to reduce acetylation at each of the four acetylation sites of the H4 N terminus (36).
Mutant alleles of Drosophila Ada2a, Ada2b, and Gcn5 have recently been reported (12, 25, 29). Immunostaining of polytene chromosomes with antibodies specific for differently acetylated forms of H3 and H4 revealed that, with the lack of dAda2b, the acetylation of H3 K9 and K14 is greatly reduced (25, 29). However, dAda2b mutations did not affect the acetylation level of H4. Carre et al. found that dGcn5 mutations abolished the K9 and K14 acetylation of H3 but had no effect on H4 K8 acetylation (12). While these studies significantly extended the knowledge on the function of Gcn5-containing Drosophila HAT complexes, they also left several questions unanswered. Most importantly, is there indeed a functional link between dGcn5 and dAda2a? To address this question, we studied the dAda2a-dGcn5 genetic interaction. After establishing a functional link between the two factors in vivo, we extended our previous studies on the acetylation state of nucleosomal histones in dAda2 mutants to reveal that dAda2a is involved in the acetylation of lysines 5 and 12 of H4. The data presented here, combined with recent results reported by ourselves and others, demonstrate that related adaptor proteins present in several metazoan organisms can provide HAT complexes with functional diversity by targeting them to different histone residues.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Plasmid constructs for yeast two-hybrid experiments were generated using pBTM116 and pGAD424 vectors and PCR-generated cDNA fragments of the desired genes. Detailed descriptions of the constructs used are available on request. Two-hybrid experiments were performed as described in the Clontech manual.
For the quantitative determination of transcripts of early-response ecdysone genes, larvae were staged at the second- to third-instar molt, and 42 h later (which corresponds to the time of spiracle eversion in wild types), total RNA was isolated with the QIAGEN RNeasy kit according to the manufacturer's instructions. First-strand cDNA was synthetized from 1 µg RNA by using TaqMan reverse transcription reagent (ABI). The relative abundances of Broad-Complex-, E74A-, and E75A-specific mRNAs were quantified by Q-RT-PCR (ABI Prism 7300) using 18S rRNA as control. The primers for ecdysone early-response transcripts were as follows: BR-C L, GCCCTGGTGGAGTTCATCTA; BR-C R, CAGATGGCTGTGTGTGTCCT; Eip74 AL, GTTGCCGGAACATTATGGAT; Eip74 AR, ATCAGCCGAATTGTCAATCA; Eip75 AL, GCGGTCCAGAATCAGCAG; and Eip75 AR, GAGGATGTGGAGGAGGATGA. 18S rRNA-specific primers 18Fw and 18Rev have been described previously (25). Cycle threshold values were set against a calibration curve ranging over 2 orders of magnitude.
Drosophila stocks, genetic crosses and phenotype analysis. Fly stocks were raised, and crosses were performed at 25°C on standard medium containing nipagin. Deletion 189, encompassing the Ada2a/Rpb4/Dtl locus, has been described previously (20, 25). dGcn5-null and hypomorph alleles dGcn5E333st and dGcn5C137T were kindly provided by C. Antoniewski (12). The dGcn55 allele was generated by remobilizing a P element located in line CB-0434-3R at approximately 5 kb downstream to the dGcn5 coding region within the best gene. Improper jump-outs were first selected by genetic crosses and then characterized by PCR amplification of fragments corresponding to the dGcn5 coding region. Finally, a fragment containing the endpoints of the deletion was sequenced to determine that dGcn55 is a null allele in which a deletion removed two-thirds of the dGcn5 coding region and part of the adjacent best gene.
dAda2a and dGcn5 alleles were kept as heterozygotes with TM6C, Tb Sb, or T(2;3)TSTL, Cy; Tb Hu balancer chromosomes and mutants were selected on the basis of the Tb+ phenotype.
To produce dAda2a dGcn5 double mutants, dGcn5E333st and d189 or, alternatively, dGcn5C137T and d189 alleles were recombined into the same chromosome.
dAda2a-null dGcn5 hypomorph mutants (P[DtlRpb4]/+; dGcn5E333std189/dGcn5C137Td189) were obtained from crosses P[DtlRpb4]; dGcn5E333std189/TM6C x dGcn5C137Td189/TM6C. The overexpression of Gcn5 in an Ada2a mutant background was achieved by crossing P[act-GAL4]; P[DtlRpb4]d189/T(2;3)TSTL to P[UAS-Gcn5]; d189/TM6C. The genotypes P[DtlRpb4]/+; P[DtlAda2a]79/1d189/d189 and +/+; P[DtlAda2a]79/1d189/P[DtlRpb4]d189 represent dAda2a hypomorphs and for simplicity are labeled dAda2ahyp1 and dAda2ahyp2, respectively. dAda2ahyp1 in a wild-type or heterozygous dGcn5 background was obtained from the crosses P[DtlRpb4]; P[DtlAda2a]79/1 d189/TM6C x d189/TM6C and P[DtlRpb4]; P[DtlAda2a]79/1 d189/TM6C x dGcn5E333std189/TM6C, respectively. In order to obtain dAda2ahyp2 in combination with normal or overexpressed dGcn5 levels, the following crosses were performed: P[DtlAda2a]79/1d189/TM6C x P[act-GAL4]; P[DtlRpb4]d189/T(2;3)TSTL and P[UAS-Gcn5]; P[DtlAda2a]79/1d189/TM6C x P[act-GAL4]; P[DtlRpb4]d189/T(2;3)TSTL, respectively. Transgene carrier lines were generated by injection of embryos and selection for the mini white marker in the offspring as described earlier (20, 25).
Immunohistochemistry. H3 and H4 acetylation in dAda2a, dAda2b, and dGcn5 mutants and wild-type animals was compared by the immunostaining of polytene chromosomes obtained from the salivary glands of wandering larvae (or dAda2a larvae corresponding to this stage, according to their age). H3-AcK14-, H3-AcK9-, and H4-AcK8-specific antibodies were from Upstate; H4-AcK5 and H4-AcK12 were from ABCAM and from SEROTEC. Ecdysone receptor antibody (EcRB) was from the Developmental Studies Hybridoma Bank, University of Iowa. Mouse anti-polymerase II (Pol II) (7G5) antibodies were raised against specific peptides as reported previously (15). The secondary antibodies were Alexa Fluor 488-conjugated goat anti-mouse immunoglobulin and Alexa Fluor 555-conjugated goat anti-rabbit immunoglobulin (Molecular Probes). Primary antibodies were used at 100- to 500-fold and secondary antibodies at 500-fold dilutions. Polytene chromosome preparation and immunostaining were performed as described in reference 27.
In vitro and in vivo ecdysone treatments. For in vitro ecdysone treatment, larvae were synchronized at the second- to third-instar molt and collected 24 h later at mid-L3 stage. The salivary glands were removed and placed into Robb medium. Each gland was divided into two parts; one part was ecdysone treated, and the other was mock treated. For ecdysone treatment, 20 µM 20-OH-ecdysone (Sigma) was added to the medium and the lobes of the glands were incubated at 25°C for 2 h. Following incubation, ecdysone and mock-treated control salivary glands were used to prepare polytene chromosome squashes. Chromosome preparations were visualized under a phase-contrast microscope and photographed, and the widths of the puffs were determined by comparison with a nearby band as reference. Data were analyzed by averaging the widths of puffs observed in ecdysone-treated and mock-treated lobes of the same glands.
For in vivo ecdysone treatment, L3 larvae were placed on autoclaved yeast containing 1 mM 20-OH-ecdysone.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
Yeast two-hybrid experiments also indicate dGcn5 dAda2a interaction: while we detected only weak interaction between dAda2a and dAda3, a strong interaction between dAda2a and dGcn5 was repeatedly observed (Fig. 3A).
|
Failure in ecdysone response in dAda2a mutants. The phenotypic features of dAda2a mutants indicate a developmental block at the time of the larva-pupa transition. Since major developmental transitions during the onset of metamorphosis are triggered by the steroid hormone ecdysone, we wondered whether the induction of ecdysone-responsive genes in dAda2a mutants was affected. Late larval and prepupal pulses of ecdysone trigger a sequential induction of puffs in the giant polytene chromosomes of the larval and prepupal salivary glands. The puffs correspond to a loose chromatin structure where genes are actively transcribed. Among the early responding puffs in the salivary glands are those in the cytological regions 2B5, 74EF, and 75B. Importantly, during normal development, puffs corresponding to the above regions are visible in the last stage of the third instar, from the beginning of the wandering phase, when the larvae stop feeding and prepare for puparium formation. To establish whether the dAda2a mutation has an effect on ecdysone-induced puff formation, we staged wild-type and dAda2a189 larvae at the second- to third-instar molt and then sampled at regular intervals. Polytene chromosome squashes were prepared from salivary glands dissected from wandering wild-type animals and dAda2a189 animals of similar age, and the presence and size of puffs in the cytological regions 2B5, 74EF, and 75B were determined. Figure 4A illustrates salivary gland squashes for control wild-type and dAda2a larvae. The puffs present in the regions 2B5, 74EF, and 75B in the wild-type animals are significantly larger than those in the dAda2a mutants. The reduced size of early ecdysone-responsive puffs was also observed in dGcn5 mutants (12). Since the ecdysone levels change dynamically in this stage, and the response to the hormone is rapid, there is inevitably some degree of heterogeneity in the developmental age of the late third instars, which makes the timing of the comparison critical. This is of particular concern when the puffs of wild-type and dAda2a mutants are compared, since the development of the latter in the L3 stage is slowed down considerably compared with that of their control siblings. With this in mind, we also tested whether dAda2a mutants retained their abilities to form puffs in response to in vitro ecdysone treatment. For ectopic ecdysone treatment, salivary glands were dissected from mid-third-instar larvae and cultured at 25°C for 2 h either in the absence or in the presence of ecdysone. Figure 4B reveals that ecdysone treatment induces puff formation at 2B5, 74EF, and 75B in the salivary glands from the wild-type larvae. In the dAda2a mutants, the puffs are consistently smaller. Thus, the reduced abilities of these loci to be induced by ecdysone in late-third-instar dAda2a salivary glands can be overcome only partially by ectopic ecdysone treatment. In accord with this observation, we found that an in vivo increase in the ecdysone level of dAda2a mutant L3 larvae results in a partial phenotypic rescue: animals whose control siblings remain in the L3 stage for more than 10 days mostly form deformed pupa-like structures when placed on ecdysone-containing medium for 1 day (data not shown). The failure of ecdysone-induced transcription induction in dAda2a mutants can also be observed by comparing the levels of hormone-induced mRNA in mutant and wild-type animals. Early puffs at 2B5, 74EF, and 75B contain complex transcription units (Broad-Complex, Eip74, and Eip75, respectively), each encoding a family of transcription factors. Q-RT-PCRs indicated that the mRNA level corresponding to a representative transcript from each locus is markedly decreased in the dAda2a samples compared with that of the control late-L3 wild-type larvae (Fig. 4C). The difference in the levels of the Eip74A message of the wild-type and dAda2a mutants was consistently the highest upon repetition, reaching more than 2 log differences. These results indicate that the ecdysone-triggered transcription activation that directs developmental responses is severely attenuated in the dAda2a mutants.
|
The decreased level of gene expression, however, is not the result of a general failure of transcriptional activation in dAda2a mutants. On the one hand, different ecdysone-induced genes are affected to different extents (Fig. 4D) and, on the other hand, a number of genes are not affected or, on the contrary, show increased expression in dAda2a mutants. The expression of rp49 (Fig. 4D), Dp53, rosy, and the microtubule-associated protein coding gene MAP205, for example, is not affected by the loss of dAda2a function, while the levels of rosy and MAP205 are decreased significantly in dAda2b mutants (25) (data not shown). On the contrary, the level of FROST mRNA is increased to severalfold in dAda2a mutants and to a lesser extent in dAda2b mutants compared to that of the wild type (data not shown).
The lack of dAda2a function results in decreased H4 acetylation. Gcn5 is the catalytic component of several complexes which acetylate nucleosomal histones. Both we and others recently determined that H3 acetylation at lysines 9 and 14 is significantly reduced in Ada2b mutants of Drosophila. dAda2a mutations, however, do not affect the acetylation of these lysine residues. Furthermore, the loss of either of the dAda2 functions does not change the acetylation of H4 at lysine 8 (25, 29). To extend these studies, we compared the acetylation of further lysine residues of H4 in dAda2a, dAda2b, and dGcn5 mutants. We assessed the H4 acetylation level via the immunostaining of polytene chromosomes with antibodies specific for H4 acetylated at K5 (H4-AcK5), and K12 (H4-AcK12). As a control, we used RNA Pol II antibody. Fluorescent microscopic images of wild-type, dAda2a, dAda2b, and dGcn5 polytene chromosomes stained with antibodies recognizing Pol II and H4 acetylated at different lysine residues are presented in Fig. 5A. All staining and data recording procedures were performed under identical conditions. The comparison of the staining intensities indicates that the levels of H4-AcK12 and H4-AcK5 are significantly less in the dAda2a mutants than in the wild type. The detection of K12 and K5 acetylated H4 in extracts of dAda2a larvae by Western blotting also indicates significant reductions in the levels of H4-AcK12 and H4-AcK5 (Fig. 5D). Similarly, dGcn5 mutation results in reduced H4 K12 and also H4 K5 acetylation (Fig. 5A and D). In contrast, neither the loss of dAda2a nor the loss of dGcn5 changed the level of H4-AcK8 to an extent detectable by immunostaining (data not shown) (see references 12 and 25). Chromosomes of dAda2b mutants do not reveal decreased acetylation of either of the two lysines of H4 tested in these experiments (Fig. 5A and D). We also did not observe a change in Ada2a or Gcn5 mutants in the intensity of H4-AcK16 staining, detectable on the X chromosomes as part of the dosage compensation (Fig. 6).
|
|
A full-length Gcn5 transgene restores the level of K12 acetylation to the level of the wild type in Gcn5 mutants, while transgenes with deletions in the ADA interaction or in the HAT domain do not (Fig. 7). This indicates that a normal level of H4 acetylation at K12 requires Gcn5 Ada2a interaction.
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our previous
genetic analysis clearly demonstrated that the two dAda2s are
functionally distinct and both we and, independently from us, Qi et al.
have shown that one of them, Ada2b, is involved in histone acetylation
(25,
29). Those studies,
however, did not indicate dAda2a involvement in histone modification.
Moreover, Carre et al. recently reported that a deletion variant of
dGcn5 (Gcn5
Ada), lacking the domain believed to be involved in
Gcn5-Ada2 interaction, appeared normally distributed on polytene
chromosomes and restored H3 acetylation in dGcn5 mutants.
However, dGcn5 mutants were not rescued by the
Gcn5Ada transgene and were arrested at puparium formation
(12). The observations
detailed above prompted us to search for direct evidence of the
dGcn5-dAda2a interaction in vivo. For this, we studied the genetic
interaction of dGcn5 and dAda2a. Our observation that
the characteristic phenotypic features of the dAda2 mutants
are suppressed or enhanced, depending on the dGcn5 genetic
background, indicates an in vivo functional interplay between the two
proteins. The finding that the level of dGcn5 alters the manifestation
of a hypomorph dAda2a allele (Fig.
3) and vice versa (data
not shown) is in accord with the proposed Ada2a-Gcn5 functional link,
the former playing a role in facilitating the HAT activity of the
latter. As expected from this scenario, the effect resulting from a
change in the level of dGcn5 is compensated for by a change in the
opposite direction in the dAda2a level or, vice versa, changes in
dAda2a level are compensated by changes in the level of dGcn5. The
similar phenotypes of dGcn5 and dAda2a mutants, with
characteristic developmental defects at the larva-pupa transition (Fig.
2) (for details, see
reference 12), indicate
that the two proteins play essential roles in the regulatory hierarchy
controlled by the steroid hormone ecdysone at the end of the
third-larval instar. The observation that puff formation at chromosomal
regions containing early ecdysone response genes is reduced in both
dAda2a and dGcn5 mutants (Fig.
4) supports this
conclusion and indicates a lack of appropriate transcriptional
activation upon the appearance of the regulatory signal. The reduced
level of puff formation correlates with the failure in hormone-induced
gene activation, as indicated by the drastically reduced level of mRNAs
corresponding to the early ecdysone-induced genes (Fig.
4C and D). The lack of
transcription induction is not simply a result of a decreased hormone
level, since dAda2a mutants are defective in puff formation
even if the hormone is ectopically provided (Fig.
4B). Furthermore, the
expression of EcR mRNA and localization of EcR to polytene chromosomes
is also reduced in dAda2a mutants. Overall, we conclude from
these observations that the lack of the dAda2a (and similarly, the lack
of the dGcn5) function reduces transcription activation at specific
loci. The effect is gene specific since the lack of Ada2a did not
affect the expression of several genes we tested, and in other cases,
an increase in the mRNA level in the absence of dAda2a can be
observed.
The specificity of recombinant yGcn5 and partially purified Gcn5-containing HAT complexes for particular lysine residues of the core histones has been analyzed on both free and nucleosomal histone substrates (9, 17). These studies indicated that yGcn5 has a preference for the lysines of H3, and that the components of the Gcn5-containing complexes influence both HAT activity and specificity. From these studies, it was concluded that the major targets of yGcn5 HAT are the lysines of nucleosomal H3. However, other studies also suggested the involvement of yGcn5-containing complexes in the acetylation of histones other than H3. By analyzing the in vivo effects of changes in the specific lysines in the N termini of the histones in the absence and in the presence of yGcn5, Zhang et al. found that the loss of Gcn5 caused a diminution of acetylation at each of the four lysines in the N terminus of H4 (36). Recently, we and Qi et al. observed that the lack of dAda2b greatly reduced the K9 and K14 acetylation of H3, while not affecting H4 acetylation (25, 29). In concert with these data, Carre et al. reported that mutations of dGcn5 reduced H3 K9 and K14 acetylation but had no effect on the acetylation of H4 K8 (12).
The acetylation state of other lysine residues of H4 in dGcn5 mutants, however, was not tested rigorously. The immunostainings and Western blots presented here show that, in dAda2a mutants, the extent of H4 K12 and K5 acetylation is significantly reduced (Fig. 5). On the other hand, polytene dAda2a chromosomes do not display a significant change in K9- and K14-acetylated H3 staining and neither of the dAda2s has a strong effect on H3 K18 or H4 K8 and K16 acetylation (Fig. 6 and data not shown) (12, 25, 29).
Polytene chromosomes of dGcn5-null mutants display reduced H4-AcK5 and H4-AcK12 staining, and transgenes with a deletion in the ADA-interacting region or in the HAT domain fail in rescuing the acetylation (Fig. 7).
The staining of wild-type chromosomes with anti-H4-AcK5 and anti-H4-AcK12 antibodies reveals a banded pattern, indicating that regions with high DNA content are enriched in these types of modifications (Fig. 5B). Strong staining is also visible in the centromeric heterochromatic region for both H4-AcK5 and H4-AcK12.
The colocalization of Pol II- and K5- or K12-acetylated H4 staining occurs in some regions along the chromosome, but, as a general rule, intensely transcribed loci are not enriched in the acetylation deposited by dAda2a-containing complexes (Fig. 5B). A similar distribution of dAda2b-dependent acetylation of H3 (K14 and K9) and its loss in dAda2b mutants were observed earlier (25, 29). Taken together, these data indicate that dAda2a and dAda2b are functionally similar in playing roles in histone acetylation distributed along the chromosomes in rough proportion with the DNA content. However, dAda2a and dAda2b participate in dGcn5-containing complexes that acetylate specific residues of H4 and H3, respectively.
dAda2a and dAda2b also differ in that the complexes containing them participate in the transcriptional activation of distinct sets of genes: the hormone induction of early-response genes requires the dAda2a function (Fig. 4), while dAda2b is involved in p53-mediated processes among others (25). Accordingly, we propose dual functions for Ada2-Gcn5-containing complexes: the deposition of uniformly distributed H3 and H4 acetylation along the chromosomes and the targeted acetylation of histones at specific loci. A decrease in the former might contribute to the observed structural change in dAda2a chromosomes, while a loss of the latter function results in an altered transcription activity at specific loci. Our data clearly indicate that, regarding the first function, dAda2a- and dAda2b-containing complexes have distinct preferences for H4 and H3, respectively. Whether the same specificity of dAda2a and dAda2b-containing complexes exists in promoter-specific modifications remains to be determined.
Guelman et al. recently reported the identification of a novel Ada2a-containing HAT complex, ATAC, in Drosophila (18). In an in vitro acetylation assay, ATAC was found to display strong nucleosomal H4 activity. The specificity of ATAC for in vivo histone acetylation is at present unknown. Therefore, it is an intriguing possibility that in vivo the Ada2b-containing SAGA complexes acetylate H3 lysines, while the Ada2a-containing ATAC complexes target lysines at the N terminus of H4. It should be noted, however, that in the ATAC complex, the presence of an additional protein with a putative HAT domain was also detected (18). Alternatively, our data do not exclude the possibility that dAda2a, and perhaps also dAda2b, participates in gene-specific transcription regulation independently of dGcn5. Indeed, several independent observations indicate the presence of dAda2a independently of dGcn5, which might reflect a dGcn5-independent role for dAda2a. On glycerol gradient sedimentation of Drosophila embryo extract, a significant fraction of dAda2a did not cosediment with dGcn5 but was present in fractions corresponding to smaller Mw complexes (24). Immunocolocalization studies of polytene chromosomes revealed that dAda2a was enriched at many sites independently of dGcn5, and only a little overlap was observed between the two proteins (21). Furthermore, the amount of dAda2a and dGcn5 does not seem to be tightly linked at different stages of Drosophila development (21). Our observation that dGcn5 dAda2a double mutants cause a stronger phenotype than that of either null mutant alone can also be interpreted as an indication of separate functions of the two proteins.
The observations that dAda2 and dGcn5 (and also dAda2b) mutants survive until the late-larva stage suggest that the uniformly deposited acetylation by the complexes containing these factors either is not essential or can be accomplished without these factors or can be compensated for by other acetyl transferases. On the other hand, the gene-specific effects of dGcn5- and dAda2a-containing complexes, which lead to the onset of the metamorphosis program or those carried out by Ada2b-containing complexes in regulating p53-mediated processes, cannot be compensated for. It is interesting that the partial phenotypic rescue resulting from the increased ecdysone level in hormone-fed larvae indicates further complexity in the gene regulatory circuits: while these animals form cuticle readily in response to the hormone pulse, no response in the development in their imaginal discs is apparent and they perish as malformed pupae.
A dual role for yGcn5 in promoter-targeted acetylation and in maintaining low levels of uniform acetylation in surrounding regions has also been proposed by Howe et al. (19). Our findings on the role of Drosophila Ada2-Gcn5-containing complexes are in full accord with their suggestion and also with observations that yeast cells can tolerate large decreases in histone acetylation without affecting the cell viability (19).
|
ACKNOWLEDGMENTS |
|---|
Pcaf
Ada Hat transgenes and Pol II antibody,
respectively, and for critical comments and discussion of the results
prior to publication. We thank IstvánTombácz and Norbert Pardi for their contribution to the
selection of dGcn5 mutants and Zsuzsanna
Újfaludi for her help with Q-PCR. SelenMuratoglu and Zsolt Tóth participated in the early phase
of these studies. We are grateful for their contribution. We are very
grateful to L. Lebedeva for her help with polytene chromosome
immunostaining. This work was supported by grants from the Hungarian Science Fund (OTKA T046414) and EU FP-6 (LSHG-CT-2004-502950). A.C. is a European Community RTN Marie Curie research fellow, supported by grant HPRN-CT-2004-504228.
|
FOOTNOTES |
|---|
Published
ahead of print on 9 October 2006.
These
authors contributed equally to this work.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Barbaric,
S., H. Reinke, and W. Horz. 2003. Multiple
mechanistically distinct functions of SAGA at the PHO5
promoter. Mol. Cell. Biol.
23:3468-3476.
3. Barlev,
N. A., R. Candau, L. Wang, P. Darpino, N. Silverman, and
S. L. Berger. 1995. Characterization of
physical interactions of the putative transcriptional adaptor, ADA2,
with acidic activation domains and TATA-binding protein.J. Biol. Chem.
270:19337-19344.
4. Barlev,
N. A., A. V. Emelyanov, P. Castagnino, P. Zegerman,
A. J. Bannister, M. A. Sepulveda, F. Robert, L.
Tora, T. Kouzarides, B. K. Birshtein, and S. L.
Berger. 2003. A novel human Ada2 homologue functions
with Gcn5 or Brg1 to coactivate transcription. Mol. Cell.
Biol.
23:6944-6957.
5. Belotserkovskaya, R., and S. L. Berger. 1999. Interplay between chromatin modifying and remodeling complexes in transcriptional regulation. Crit. Rev. Eukaryot. Gene Expr. 9:221-230.[Medline]
6. Berger, S. L., B. Pina, N. Silverman, G. A. Marcus, J. Agapite, J. L. Regier, S. J. Triezenberg, and L. Guarente. 1992. Genetic isolation of ADA2: a potential transcriptional adaptor required for function of certain acidic activation domains. Cell 70:251-265.[CrossRef][Medline]
7. Bhaumik,
S. R., and M. R. Green. 2002.
Differential requirement of SAGA components for recruitment of
TATA-box-binding protein to promoters in vivo. Mol. Cell.
Biol.
22:7365-7371.
8. Boyer, L. A., M. R. Langer, K. A. Crowley, S. Tan, J. M. Denu, and C. L. Peterson.2002 . Essential role for the SANT domain in the functioning of multiple chromatin remodeling enzymes. Mol. Cell 10:935-942.[CrossRef][Medline]
9. Brown, C. E., T. Lechner, L. Howe, and J. L. Workman.2000 . The many HATs of transcription coactivators.Trends Biochem. Sci. 25:15-19.[CrossRef][Medline]
10. Brownell, J. E., J. Zhou, T. Ranalli, R. Kobayashi, D. G. Edmondson, S. Y. Roth, and C. D. Allis.1996 . Tetrahymena histone acetyltransferase A: a homolog to yeast Gcn5p linking histone acetylation to gene activation.Cell 84:843-851.[CrossRef][Medline]
11. Candau, R., P. A. Moore, L. Wang, N. Barlev, C. Y. Ying, C. A. Rosen, and S. L. Berger.1996 . Identification of human proteins functionally conserved with the yeast putative adaptors ADA2 and GCN5. Mol. Cell. Biol. 16:593-602.[Abstract]
12. Carre,
C., D. Szymczak, J. Pidoux, and C. Antoniewski. 2005.
The histone H3 acetylase dGcn5 is a key player in Drosophila
melanogaster metamorphosis. Mol. Cell. Biol.
25:8228-8238.
13. Carrozza, M. J., R. T. Utley, J. L. Workman, and J. Cote. 2003. The diverse functions of histone acetyltransferase complexes. Trends Genet. 19:321-329.[CrossRef][Medline]
14. Fischle, W., Y. Wang, and C. D. Allis. 2003. Histone and chromatin cross-talk. Curr. Opin. Cell Biol. 15:172-183.[CrossRef][Medline]
15. Georgieva,
S., D. B. Kirschner, T. Jagla, E. Nabirochkina, S. Hanke, H.
Schenkel, C. de Lorenzo, P. Sinha, K. Jagla, B. Mechler, and L.
Tora. 2000. Two novel Drosophila
TAFIIs have homology with human TAFII30 and are
differentially regulated during development. Mol. Cell.
Biol.
20:1639-1648.
16. Grant,
P. A., L. Duggan, J. Cote, S. M. Roberts,
J. E. Brownell, R. Candau, R. Ohba, T. Owen-Hughes,
C. D. Allis, F. Winston, S. L. Berger, and
J. L. Workman. 1997. Yeast Gcn5 functions in
two multisubunit complexes to acetylate nucleosomal histones:
characterization of an Ada complex and the SAGA (Spt/Ada) complex.Genes Dev.
11:1640-1650.
17. Grant,
P. A., A. Eberharter, S. John, R. G. Cook,
B. M. Turner, and J. L. Workman.1999
. Expanded lysine acetylation specificity of Gcn5 in
native complexes. J. Biol. Chem.
274:5895-5900.
18. Guelman,
S., T. Suganuma, L. Florens, S. K. Swanson, C. L.
Kiesecker, T. Kusch, S. Anderson, J. R. Yates III,
M. P. Washburn, S. M. Abmayr, and J. L.
Workman. 2006. Host cell factor and an uncharacterized
SANT domain protein are stable components of ATAC, a novel
dAda2A/dGcn5-containing histone acetyltransferase complex in
Drosophila. Mol. Cell. Biol.
26:871-882.
19. Howe,
L., D. Auston, P. Grant, S. John, R. G. Cook, J. L.
Workman, and L. Pillus. 2001. Histone H3 specific
acetyltransferases are essential for cell cycle progression.Genes Dev.
15:3144-3154.
20. Komonyi,
O., G. Papai, I. Enunlu, S. Muratoglu, T. Pankotai, D. Kopitova, P.
Maroy, A. Udvardy, and I. Boros. 2005. DTL, the
Drosophila homolog of PIMT/Tgs1 nuclear receptor
coactivator-interacting protein/RNA methyltransferase, has an essential
role in development. J. Biol. Chem.
280:12397-12404.
21. Kusch,
T., S. Guelman, S. M. Abmayr, and J. L.
Workman. 2003. Two Drosophila Ada2 homologues
function in different multiprotein complexes. Mol. Cell.
Biol.
23:3305-3319.
22. Marcus, G. A., N. Silverman, S. L. Berger, J. Horiuchi, and L. Guarente. 1994. Functional similarity and physical association between GCN5 and ADA2: putative transcriptional adaptors.EMBO J. 13:4807-4815.[Medline]
23. Martinez,
E., T. K. Kundu, J. Fu, and R. G. Roeder.1998
. A human SPT3-TAFII31-GCN5-L acetylase complex
distinct from transcription factor IID. J. Biol.
Chem.
273:23781-23785.
24. Muratoglu,
S., S. Georgieva, G. Papai, E. Scheer, I. Enunlu, O. Komonyi, I.
Cserpan, L. Lebedeva, E. Nabirochkina, A. Udvardy, L. Tora, and I.
Boros. 2003. Two different Drosophila ADA2
homologues are present in distinct GCN5 histone
acetyltransferase-containing complexes. Mol. Cell. Biol.
23:306-321.
25. Pankotai,
T., O. Komonyi, L. Bodai, Z. Ujfaludi, S. Muratoglu, A. Ciurciu, L.
Tora, J. Szabad, and I. Boros. 2005. The homologous
Drosophila transcriptional adaptors ADA2a and ADA2b are both
required for normal development but have different functions.Mol. Cell. Biol.
25:8215-8227.
26. Papai, G., O. Komonyi, Z. Toth, T. Pankotai, S. Muratoglu, A. Udvardy, and I. Boros. 2005. Intimate relationship between the genes of two transcriptional coactivators, ADA2a and PIMT, of Drosophila.Gene 348:13-23.[CrossRef][Medline]
27. Pile, L. A., and D. A. Wassarman. 2002. Localizing transcription factors on chromatin by immunofluorescence.Methods 26:3-9.[CrossRef][Medline]
28. Pray-Grant,
M. G., D. Schieltz, S. J. McMahon, J. M.
Wood, E. L. Kennedy, R. G. Cook, J. L.
Workman, J. R. Yates III, and P. A. Grant.2002
. The novel SLIK histone acetyltransferase complex
functions in the yeast retrograde response pathway. Mol. Cell.
Biol.
22:8774-8786.
29. Qi,
D., J. Larsson, and M. Mannervik. 2004.
Drosophila Ada2b is required for viability and normal histone
H3 acetylation. Mol. Cell. Biol.
24:8080-8089.
30. Saleh,
A., V. Lang, R. Cook, and C. J. Brandl.1997
. Identification of native complexes containing the
yeast coactivator/repressor proteins NGG1/ADA3 and ADA2.J. Biol. Chem.
272:5571-5578.
31. Sendra,
R., C. Tse, and J. C. Hansen. 2000. The
yeast histone acetyltransferase A2 complex, but not free Gcn5p, binds
stably to nucleosomal arrays. J. Biol. Chem.
275:24928-24934.
32. Sterner,
D. E., R. Belotserkovskaya, and S. L. Berger.2002
. SALSA, a variant of yeast SAGA, contains truncated
Spt7, which correlates with activated transcription. Proc. Natl.
Acad. Sci. USA
99:11622-11627.
33. Sterner,
D. E., and S. L. Berger. 2000.
Acetylation of histones and transcription-related factors.Microbiol. Mol. Biol. Rev.
64:435-459.
34. Stockinger,
E. J., Y. Mao, M. K. Regier, S. J.
Triezenberg, and M. F. Thomashow. 2001.
Transcriptional adaptor and histone acetyltransferase proteins in
Arabidopsis and their interactions with CBF1, a transcriptional
activator involved in cold-regulated gene expression. Nucleic
Acids Res.
29:1524-1533.
35. Syntichaki,
P., and G. Thireos. 1998. The Gcn5.Ada complex
potentiates the histone acetyltransferase activity of Gcn5.J. Biol. Chem.
273:24414-24419.
36. Zhang, W., J. R. Bone, D. G. Edmondson, B. M. Turner, and S. Y. Roth. 1998. Essential and redundant functions of histone acetylation revealed by mutation of target lysines and loss of the Gcn5p acetyltransferase. EMBO J. 17:3155-3167.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
