| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2006, p. 9456-9470, Vol. 26, No. 24
0270-7306/06/$08.00+0 doi:10.1128/MCB.00759-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
and
Kenji Sobue1*
Department of Neuroscience (D13), Osaka University Graduate School of Medicine, Yamadaoka 2-2, Suita, Osaka 565-0871,1 Department of Fixed Prosthodontics, Osaka University Graduate School of Dentistry, 1-8 Yamadaoka, Suita, Osaka 565-0871, Japan2
Received 2 May 2006/ Returned for modification 13 June 2006/ Accepted 22 September 2006
| ABSTRACT |
|---|
|
|
|---|
and caldesmon). We further investigated
interactions between Msx1 and myocardin/serum response factor
(SRF)/CArG-box motif (cis element for SRF) using
coimmunoprecipitation, gel-shift, and chromatin immunoprecipitation
assays. Our results showed that Msx1 or Msx2 formed a ternary complex
with SRF and myocardin and inhibited the binding of SRF or
SRF/myocardin to the CArG-box motif, resulting in inhibition of their
transcription. | INTRODUCTION |
|---|
|
|
|---|
, caldesmon (CaD), and calponin, is markedly
down-regulated (37,
46). Accumulating
evidence suggests that the VSMC-specific expression of these genes is
regulated by the coordination of serum response factor (SRF), its
associated homeobox protein (Nkx 3.2) and GATA (GATA6) transcription
factors (35), or by
cysteine-rich LIM-only proteins (CRP1 and CRP2)
(9). Recently, the
SMC/cardiac myocyte-restricted SRF activator, myocardin (Mycd) was
identified as a central regulator of SMC marker expression occurring
via the SRF-dependent mechanism
(10,
50). In fact, the ectopic
expression of Mycd can activate the SMC differentiation program in
multilineaged mesenchymal 10T1/2 cells
(51). Changes in the
expression levels of SRF and Mycd in differentiated and
dedifferentiated VSMCs are, however, less significant, indicating that
the down-regulation of SMC marker expression during VSMC
dedifferentiation cannot be simply explained by the expression levels
of these positive transcription factors. It has been speculated that repressor proteins that interact with SRF and/or signaling pathways may negatively regulate the Mycd/SRF/CArG-mediated transcription. Elk1 (52), Kruppel-like transcription factor 4 (KLF4) (30), HES-related repressor protein 1 (13), and Foxo4 (31) are candidates for such regulators. We previously reported that the IGF-I-stimulated phosphoinositide 3-kinase (PI3-K)/protein kinase B [PKB(Akt)] pathway plays a critical role in maintaining the differentiated phenotype of VSMCs, whereas the coordinated activation of extracellular signal-regulated kinase and p38 mitogen-activated protein kinase triggered by platelet-derived growth factor-BB, epidermal growth factor family members, basic fibroblast growth factor, or unsaturated lysophosphatidic acids induces the dedifferentiation of VSMCs (17, 18). Based on these findings, we hypothesized that changes in the balance between the strengths of the PI3-K/PKB(Akt) pathway and the two mitogen-activated protein kinase pathways determine the VSMC phenotype. In support of this hypothesis, Liu et al. recently identified one of the downstream targets of the PI3-K/PKB(Akt) pathway in VSMCs as a forkhead transcription factor, Foxo4. Foxo4 interacts with Mycd and represses its transactivation of SMC marker gene transcription, and this inhibition is released by the phosphorylation of Foxo4 by PKB(Akt), followed by its nuclear export (31). The molecular mechanism of the down-regulation of SMC markers at the transcriptional level, however, remains unclear.
Calcification within the vessel wall is one of the progressive features of atherosclerosis (20, 32, 45). Bone morphogenetic protein 2 (BMP2), BMP4, and BMP6 are detected in atherosclerotic lesions that are accompanied by calcification (5, 12, 43). BMP2, in particular, has been shown to up-regulate the osteogenic gene expression in passaged VSMCs (11). These properties of BMP2 are closely associated with the induction of Msx1 and Msx2, transcription factors involved in osteogenic gene expression (11). It is, however, unclear whether the BMPs released from atherosclerotic lesions act solely to induce the osteogenic transition from dedifferentiated VSMCs or whether they also act as an autocrine/paracrine factor for the progression of the dedifferentiation of the surrounding intact VSMCs. In this study, we found that BMPs strikingly induce phenotypic modulation of VSMCs, and we further uncovered the molecular mechanism of the BMP-induced down-regulation of SMC marker expression at the transcriptional level. Our results showed that the BMP-induced Msx transcription factors, Msx1 and Msx2, formed a complex with SRF and Mycd and inhibited the binding of SRF or SRF/Mycd to the CArG-box motif located in the promoters of SMC marker genes, resulting in the inhibition of their transcription. This is the first report demonstrating that Msx transcription factors directly interact with both SRF and Mycd and are involved in the negative regulation of SMC gene transcription.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-tubulin (DM 1A) antibodies
(Sigma); anti-hemagglutinin (anti-HA, 3F10) antibody (Roche
Applied Science); anti-Msx1, anti-Msx2, anti-SRF, anti-Mycd, and
anti-Myc (9E10) antibodies (Santa Cruz Biotechnology);
anti-SM22
antibody (Novocastra Laboratories). Secondary
antibodies were conjugated to Alexa 488, Alexa 568, and Alexa 350
(Molecular Probes). The anti-CaD antibody was prepared in our
laboratory
(16).
Plasmids.
The chicken CaD promoter region was
isolated from GP2CAT (54)
and inserted into the pGL3-Basic vector (Promega) (CaD GP2-Luc). A
mutation in the CArG-box motif of the CaD promoter (CaD GP2-Luc
CArGmut) was introduced as described elsewhere
(54). The promoter region
of chicken SM22
(29) was isolated from a
chicken genomic library, and the BalI-NdeI fragment was inserted into
pGL3 Basic (SM22P-Luc). Mutations in the proximal CArG (pCArG)-box
motif, the distal CArG (dCArG)-box motif, or both of them (dpCArGmut)
in the SM22
promoter were introduced as follows: pCArG
mutation, from CCAAATATGG to
CCAAGTATAC; dCArG mutation, from
CCTATAAAAGG to CAGATAAAAGT.
We used pGL3 control (Promega) as a control luciferase reporter gene
carrying the simian virus 40 promoter. The cDNAs of mouse full-length
Mycd (GenBank accession number
AF384055), Msx1, and Msx2 were
amplified by reverse transcriptase-PCR (RT-PCR) and were inserted into
the mammalian expression plasmid, pCS2+, with the indicated
tags. Deletion mutants of Mycd and Msx1 were constructed by
PCR-mediated mutagenesis. Expression plasmids for human SRF and its
derivative with point mutations, SRF Pm143-146, were described
previously (34,
39). Expression plasmids
for the SRF derivatives, SRF PRGI-In206, SRF
MADS (133 to 266),
and MADS (133 to 266), were constructed using PCR-mediated methods. The
sequences of these constructs were
confirmed.
Cell cultures and transfection. Culture conditions for rat VSMCs were described previously (17, 18). 10T1/2 and Cos7 cells were grown in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum. Transfections were performed using Lipofectamine 2000 (Invitrogen) for Cos7 cells or Trans IT-LT1 for 10T1/2 cells (Pan Vera Corporation) under 10% fetal calf serum-stimulated conditions, according to the manufacturer's instructions. For analyses of protein-protein interactions in Cos7 cells, the cells were shifted to DMEM with 2% horse serum (HS) 4 h after transfection and cultured for another 20 h. For analyses of promoters, expression of endogenous SMC markers, and chromatin immunoprecipitation (ChIP), 10T1/2 cells were shifted to DMEM-2% HS 4 h after transfection and cultured for 44 h.
Promoter assays. The cell extracts were prepared by passive lysis buffer (Promega) according to the manufacturer's instructions, and then assayed for luciferase activity using the luciferase assay kit (Promega). The relative promoter activity was expressed in luminescence units normalized to the ß-galactosidase activity of pSVß-gal (Promega) in the cell extracts. These assays were performed in triplicate and were repeated at least three times.
Expression of Msx transcription factors and SMC markers.
The expression of Msx1, Msx2, and SMC
markers, h- and l-CaDs, SM22
, calponin, and
MHC SM2 at the mRNA level was quantified by RT-PCR normalized to the
expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA, as
described previously (18,
47). In brief, we first
estimated the GAPDH mRNA levels in each sample by RT-PCR using
differentially diluted single-stranded cDNA mixtures (1x,
0.5x, 0.25x, 0.1x) with different PCR cycles.
PCR products were sampled at intervals of two cycles between 18 to 26
cycles and were separated on 1.2% agarose gels. The intensities of the
GAPDH cDNA bands stained with SYBR green I (FMC Bioproducts) were
determined using a Fluor Imager (Amersham Pharmacia Biotech) at cycle
numbers where the intensities were linearly increased. Next, we
amplified the target cDNAs using defined amounts of single-stranded
cDNA mixtures containing equal amounts of GAPDH cDNA. PCR products of
each target cDNA were sampled at intervals of two cycles between 22 to
38 cycles and were quantified as described above. The specific primers
for rat Msx1 and Msx2 were as follows: Msx1 sense primer,
ATGACTTCTTTGCCACTCGGTG; Msx1 antisense primer,
CTATGTCAGGTGGTACATGCTG; Msx2 sense primer,
ATGAGCCCCACCACCTGCCACCC; Msx2 antisense primer,
TTAGGATAGATGGTACATGCCATATC. The specific primer
sets for the rat SMC markers, rat GAPDH
(18,
47), mouse SMC markers
(SM22
and MHC-SM2), and mouse GAPDH
(7) were described
elsewhere. The specific primer sets for mouse calponin and CaD were as
follows: calponin sense primer,
ATGTCTTCTGCACATTTTAACC; calponin antisense
primer, GCTCAAATCTCCGCTCTTG; CaD sense primer,
ATGCTTAGCGGATCCGGGTC; CaD antisense primer,
GGGCCTGAGAGACTGCCATC. The expression of Msx1,
Msx2, h- and l-CaD, and SM22
at the protein
levels was analyzed by immunoblots normalized to the expression of
-tubulin.
Quantitative real-time PCR.
The
expressions of Msx1, Msx2, SM22
, and h- and
l-CaD in VSMCs cultured under indicated conditions were
quantified by 7500 real-time PCR System (Applied Biosystems). Total
RNAs were reverse transcribed by using TaqMan reverse transcription
reagents (Applied Biosystems) according to the manufacturer's protocol.
Real-time PCR was performed using TaqMan gene expression assays
(Applied Biosystems), and the expression levels of respective mRNAs
were normalized to the GAPDH
mRNA.
Immunocytochemistry. Cells were fixed with 4% formaldehyde for 30 min, permeabilized, and blocked with 0.1% Triton X-100 and 0.2% bovine serum albumin in phosphate-buffered saline for 1 h at room temperature. The cells were then incubated with the indicated primary antibodies for 1 h followed by the indicated secondary antibodies with or without Hoechst 33258 for 1 h at room temperature. Fluorescence images were collected using a cooled charge-coupled device camera (Roper Scientific, Tucson, AZ) mounted on an Olympus IX-70 microscope with the appropriate filters and MetaMorph software.
Protein-protein interaction analyses. Whole-cell extracts were prepared from Cos7 cells transfected with the indicated expression plasmids according to methods described elsewhere (49) with some modifications. In brief, cells were incubated for 30 min at 0°C in lysis buffer, and then the salt concentration was decreased to 100 mM KCl and 50 mM NaCl, and cells were further incubated for 30 min. Equal amounts (400 µg of protein) of the cell extracts thus obtained were first treated with control immunoglobulin G (IgG)-bound protein A- or protein G-Sepharose beads for clearance of nonspecific interactions and then incubated with the indicated antibodies for 6 h at 4°C. The immune complexes were collected by incubating with protein A- or protein G-Sepharose beads for 3 h at 4°C. Proteins in the immunoprecipitates were detected by immunoblotting using the indicated antibodies. In vitro translation was performed using the TNT quick coupled transcription/translation systems (Promega) according to the manufacturer's instructions. The indicated in vitro-translated proteins were incubated in the same lysis buffer described above containing 100 mM KCl and 50 mM NaCl for 1 h at 0°C, and the interactions were analyzed by immunoprecipitation followed by immunoblotting using the indicated antibodies according to the procedures described above. Target proteins were detected with a SuperSignal chemiluminescence detection kit (Pierce).
Gel shift assay.
A probe containing the proximal
CArG-box motif sequence of the chicken SM22
promoter was
prepared by annealing the respective sense and antisense synthesized
oligonucleotides to form duplex DNA. The sequence of the sense strand
of this probe was
TTTTCGGAGTCTTTCCCCAAATATGGTGTCTGGGCTGGAA. The
probe was labeled by T4 polynucleotide kinase with [32P]ATP.
The gel shift assay was carried out using the indicated in
vitro-translated proteins as described previously
(6).
ChIP assay.
ChIP assays were
carried out using the ChIP assay kit (Upstate Biotech) according to the
manufacturer's protocol with some modifications. DNAs isolated from
input chromatin fragments and those from precipitated chromatin
fragments by anti-SRF antibody or control IgG were subjected to PCR
using primers flanking the proximal CArG-box motif from rat/mouse
SM22
promoter and the CArG-box motif from rat/mouse CaD
promoter. These primer sequences, which are conserved between rat and
mouse SM22
and CaD promoter regions, are as follows:
SM22
sense primer,
CTGCCCATAAAAGGTTTTTCCC; SM22
antisense
primer, GCCCATGGAAGTCTGCTTGG; CaD sense primer,
GCTCTATTTGTGTTCTACAAGAC; CaD antisense primer,
GCAGGCTGCCAAAACCAGC.
| RESULTS |
|---|
|
|
|---|
, h- and l-CaD, calponin, and
MHC-SM2, was apparent 2 to 3 days after BMP treatment. Similar
expression profiles of Msx1, Msx2, and SMC markers (SM22
and
h- and l-CaD) in VSMCs treated with IGF-I or BMP2
were confirmed by real-time PCR analysis (Fig.
1F). These results
indicate that the expression of Msx1 and Msx2 is stimulated by BMPs and
precedes the down-regulation of SMC marker
expression.
|
and
CaD promoters. The SM22
and CaD promoters carry two CArG-box
motifs (29) and a single
CArG-box motif (54),
respectively. We constructed reporter genes containing wild-type and
mutant promoters of SM22
and CaD and analyzed the
Mycd-dependent transactivation of these promoters in 10T1/2 cells. In
the mutant SM22
and CaD reporter genes, either or both of the
two CArG-box motifs of the SM22
promoter and the sole CArG-box
motif of the CaD promoter were mutated. We confirmed that the pCArG box
motif of the SM22
promoter was essential for the
Mycd-dependent transactivation (Fig.
2A, lanes 1, 2, 5, and 6), but the distal one (dCArG) had only a moderate
role (Fig. 2A, lanes 1 to
4). The single CArG-box motif of the CaD promoter was critical for the
Mycd-dependent transactivation (Fig.
2B, lanes 1 to
4).
|
(13-fold activation) and CaD (10-fold activation) (lanes
1 and 2), whereas either Msx1 or Msx2 suppressed these activations in a
dose-dependent manner (lanes 3 to 6). The inhibitory effect of Msx1 or
Msx2 was more potent for the CaD promoter than for the SM22
promoter. We confirmed the expression of Mycd and its nuclear
localization and the similar expression levels of Msx1 and Msx2 and
their nuclear localization in 10T1/2 cells using antibodies against
their respective tags (data not shown). Although the coexpression of
Mycd and SRF activated both promoters, the activation rates were lower
than those obtained with Mycd alone (lanes 2 and 7). This may be due to
the occupation of the Mycd or the CArG-box motifs in the promoters by
excess SRF. In these cases, suppression of the Mycd-dependent promoter
activities by Msx1 and Msx2 was low (lanes 8 to 11). Exogenous SRF
alone slightly activated the promoters of SM22
(3.5-fold
activation) and CaD (2-fold activation), whereas the suppressive effect
of Msx1 or Msx2 on the SRF-dependent activation of both promoters was
less significant than their suppression of the Mycd-dependent
activation (data not shown). The basal promoter activities of
SM22
and CaD were slightly suppressed by Msx1 or Msx2 (lanes 1
and lanes 12 to 15). In a control, exogenous Mycd and/or Msx1 or Msx2
had no effect on the simian virus 40 promoter activity (Fig.
2E). These data indicate
that Msx transcription factors inhibit the Mycd-dependent transcription
of SMC marker genes.
Msx-dependent regulation of the Mycd-induced expression of endogenous SMC markers.
Mycd-transfected
10T1/2 cells adopt an SMC lineage, as revealed by the endogenous
expression of SMC markers
(51). We examined the
effects of Msx1 and Msx2 on the Mycd-dependent expression of endogenous
SMC markers in 10T1/2 cells. In these cells, Mycd induced the
expression of endogenous SMC markers, such as SM22
, calponin,
and MHC-SM2, at the mRNA level (Fig.
3A, lane 2), and Msx1 potently inhibited their expressions (lane 3).
Compared with Msx1, Msx2 moderately interfered with the Mycd activity
(lane 4). In a control, Msx1 or Msx2 alone had no effect on the SMC
marker expression in 10T1/2 cells (lanes 5 and 6). The inhibitory
effects of Msx1 and Msx2 on the Mycd-induced expression of endogenous
SMC markers were also confirmed at the protein level. SM22
protein was expressed in 10T1/2 cells transfected with Mycd, and its
expression was reduced by the coexpression of Msx1 or Msx2 (Fig.
3B and C). The
SMC-specific CaD isoform, h-CaD, which has a molecular mass of
140 to 150 kDa, was not detected in the Mycd-transfected 10T1/2 cells
(Fig. 3B). The effect of
Mycd with or without Msx1 or Msx2 on the expression of CaD was moderate
at the mRNA and protein levels (Fig.
3A and B).
Immunocytochemical analysis revealed that 10T1/2 cells transfected with
Mycd expressed increased CaD protein, and the coexpression of Mycd with
Msx1 or Msx2 suppressed CaD's expression to the basal level (Fig.
3D). We also confirmed by
immunocytochemistry that the Mycd-induced expression of
endogenous calponin and anti-SM actin proteins was
suppressed by Msx1 or Msx2 (data not shown). These results indicate
that Msx transcription factors specifically suppress the Mycd-dependent
expression of endogenous SMC markers.
|
|
Domain mapping of the interactions between Msx1, SRF, and Mycd.
To identify the Msx1-interacting domain
in Mycd, we constructed a series of expression plasmids encoding
Flag-tagged Mycd deletion mutants and examined their interactions with
HA-Msx1 (Fig. 5A and
B). We used an in vitro translation system for the interaction analysis
because the Mycd deletions examined were not necessarily localized to
the nucleus when they were expressed in Cos7 cells (data not shown).
Compared with wild-type Mycd (Mycd wt) (lane 2), the N-terminal
deletions, Mycd
N51 lacking residues 1 to 51, Mycd
N80
lacking residues 1 to 80, and Mycd
N128 lacking residues 1 to
128, significantly reduced Mycd's ability to interact with
Msx1 (lanes 3, 4, and 7). Although a mutant Mycd with the N-terminal
basic sequence (residues 98 to 103) deleted
(Mycd
NB) fully retained its ability to interact
with Msx1 (lane 5), deletion of the central basic sequence (residues
243 to 260) (Mycd
CB) reduced this ability (lane 6).
Mycd
N128/
CB, which lacked residues 1 to 128 and the
central basic sequence, completely lost its ability to interact with
Msx1 (lane 8). An Mycd deletion mutant lacking the C-terminal region
from the central basic region (residues 243 to 935) retained its
Msx1-interacting ability (data not shown). These deletions showed the
same profiles for interacting with Msx2, and immunoprecipitation with
control IgG did not show any interaction (data not shown). These
results suggest that the N-terminal short region (amino acids 1 to 51)
and the central basic sequence of Mycd are the key regions required for
its interaction with Msx1 or Msx2.
|
MADS (133 to 266)], and the MADS domain
only [MADS (133 to 266)]. When SRFwt, Pm143-146, and PRGI-In206 were
expressed in Cos7 cells, they were localized to the nucleus. Most of
the SRF
MADS (133 to 266) and MADS (133 to 266) was also
observed in the nucleus, with faint labeling in the cytoplasm (Fig.
6A). SRFwt, SRF PRGI-In206, and MADS (133 to 266) interacted with Msx1 (Fig.
6B, lanes 1, 3, and 5),
but SRF
MADS (133 to 266) did not (lane 4), indicating that the
Msx1-interacting domain of SRF resides in the MADS domain. The MADS
(133 to 266) alone showed a strong Msx1-interacting ability compared
with SRFwt or SRF PRGI-In206. Adjusting for the higher expression
levels of MADS (133 to 266), the Msx1-interacting ability of MADS (133
to 266) was equivalent to that of SRFwt or SRF PRGI-In206 (lanes 1, 3,
and 5), indicating that the other parts of SRF, outside of MADS, do not
interfere with its interaction with Msx1. Compared with SRF PRGI-In206
(lane 3), SRF Pm143-146 markedly reduced the Msx1-interacting ability
(lane 2). Taken together, these results suggest that residues 143R,
145K, and 146I within the MADS domain of SRF, which are involved in
CArG-box motif binding, play a critical role in SRF's interaction with
Msx1.
|
H),
which was mainly localized to the cytoplasm of Cos7 and 10T1/2 cells,
did not interact with SRF or Mycd (Fig.
7A, lanes 3 and 6). Consistent with the results in Fig.
4B, Msx1 interacted more
potently with Mycd than with SRF (lanes 2 and 5). Our results,
summarized in Fig. 7B,
indicate that the homeodomain of Msx1 is important for its interaction
with SRF and Mycd.
|
promoter
containing the pCArG-box motif as a probe and in vitro-translated
Myc-tagged SRF (SRF-Myc), HA-Msx1, and Flag-Mycd proteins. SRF alone
formed an intense band with the CArG probe (Fig.
8A, lane 1), which was inhibited by the addition of excess amounts of a
specific competitor (lane 2) but not of a mutant one (lane 3). This
band was supershifted by an anti-Myc antibody (lane 4) but not by a
control antibody (lane 5). Notably, the addition of Msx1 protein
significantly reduced the SRF-specific band in an Msx1 dose-dependent
manner (lanes 6 to 8). Msx1 protein alone did not form any band with
this probe (lane 9). These results indicate that Msx1 inhibited the
direct interaction between SRF and the pCArG probe. In addition to the
band formed by the SRF/CArG interaction, a high-molecular-weight
(Mr) band was detected using SRF, Mycd, and the
pCArG probe (Fig. 8B, lane
1). This high-Mr band was supershifted by an
anti-Flag antibody but not by a control antibody (lanes 2 and 3),
indicating that the high-Mr band was a complex of
SRF, Mycd, and the pCArG probe. This complex was dose
dependently reduced by the addition of increasing amounts of Msx1
protein (lanes 4 to 6). These results, taken together with the promoter
assays (Fig. 2) and
analysis of endogenous SMC marker expression in 10T1/2 cells (Fig.
3), suggest that Msx1
inhibits formation of the Mycd/SRF/CArG or SRF/CArG complex, resulting
in the suppression of SMC-specific transcription.
|
and CaD genes (Fig.
8C, left panel, lane 3).
Similarly, 10T1/2 cells expressing Mycd enhanced bindings of SRF to
these chromatin DNAs, whereas these bindings were reduced in the cells
coexpressing Mycd and Msx1 (Fig.
8C, right panel, lane 3).
In this experiment, chromatin DNAs containing the CArG-box motifs in
both promoter regions were not precipitated by control IgG (Fig.
8C, lane 2). These results
are in good agreement with the regulation of endogenous SMC marker
expression in cultured VSMCs stimulated with BMPs (Fig.
1), 10T1/2 cells
expressing either Mycd or Mycd/Msx1 (Fig.
3), and gel-shift assay
(Fig. 8A and
B). | DISCUSSION |
|---|
|
|
|---|
and
CaD promoters and the endogenous expression of SMC markers in 10T1/2
cells. (iii) Msx transcription factors interacted with SRF and Mycd and
formed a ternary complex. (iv) The homeodomain of Msx1 was critical for
its interaction with Mycd and SRF. We identified both the N-terminal
short region (1 to 51 amino acids) and central basic sequence of Mycd
and the MADS domain of SRF as the Msx1-interacting domains. In the MADS
domain of SRF, a region encompassing 143R, 145K, and 146I, which is
essential for CArG-box motif binding, was critical for its
interaction with Msx1. (v) Msx1 inhibited the
interactions between the CArG-box motif and SRF or the SRF/Mycd complex
in gel-shift and ChIP assays. This is the first study
demonstrating the inhibition of Mycd activity by the
transcription of a homeodomain
protein. BMP-induced expression of Msx1 and Msx2. BMP-induced expression of Msx1 and Msx2 genes at the transcriptional level is partially characterized (4, 23); activation of Msx1 transcription is required for Smad8 and that of the Msx2 gene depends on Smad4 and lymphoid-enhancing factor, respectively. We also confirmed that BMP2 stimulation triggered a sustained activation of Smad1/5/8 for at least 2 days, but IGF-I stimulation did not (data not shown). BMP signaling has been shown to enhance the expression of Osterix (Osx) (53) and plasminogen activator inhibitor 1 (55) at posttranscriptional levels. The molecular mechanism of such posttranscriptional events, however, remains to be fully uncovered. It has been recently reported that Msx1 is sumoylated in vivo (15). In our present study, accumulation of in Msx1 protein in response to BMP stimulation was robust compared with that of its mRNA (Fig. 1). It is possible to speculate that the posttranscriptional regulation either via stabilization of Msx1 protein half-life or enhanced translation may be involved in such robust accumulation. Further study is required to address this point. Contrary to Msx transcription factors, there were no significant differences in the expression levels of SRF and Mycd (data not shown) and SRF/Mycd interaction in cultured VSMCs stimulated by IGF-I or BMP2 (Fig. 4D). Hendrix et al. have reported that the expression of Mycd mRNA is significantly decreased within 3 days after arterial injury compared to the uninjured control, but its expression returns to control levels by 7 days after injury (19). This difference in the expression levels of Mycd may be due to distinct assay systems. In our culture system, VSMCs were only stimulated by IGF-I or BMPs. In the arterial injury model, VSMCs may be affected by numerous factors such as blood-originated growth factors and cytokines in addition to a mechanical injury.
BMP-induced phenotypic modulation of VSMCs. Vascular calcification is one of the progressive features of atherosclerosis (32, 45). Based on these reported activities, BMPs are likely conveyers of such vascular remodeling. It has been indeed reported that BMP2, BMP4, and BMP6 are expressed in atherosclerotic lesions and suggested to be involved in vascular calcification (5, 12, 43). Of the BMP family, the role of BMP2 in this process is well studied. In the vasculature, oxidative stress, inflammation, hyperglycemia, and a high-fat diet induce the expression of BMP2 (21). Among the downstream effectors of BMP signaling, three transcription factors, Msx2, Msx1, and Runx/Cbfal, are known to regulate orthotopic tissue mineralization and osteogenic differentiation (1), and their expressions are up-regulated during vascular calcification (11). The roles of Msx2 and Runx/Cbfa1 in vascular calcification are partially characterized. Msx2 induces the up-regulation of Osx, a global transcription factor involved in mineralization and osteoblast differentiation mediated through Runx/Cbfa1 (21). Thus, the activation of Osx via Msx2 and Runx/Cbfa1 is thought to be the most likely cascade leading to vascular calcification. In contrast, the role of Msx1 in vascular calcification has not been uncovered. Most previous studies have focused on the roles of BMPs in osteogenic trans-differentiation of VSMCs; however, the effect of BMPs on the VSMC phenotype remains unclear. Msx2 is demonstrated to be a key factor for promoting arterial calcification (11, 44). Considering these findings, our present study suggests that the down-regulation of SMC marker expressions by Msx1/2 might be prerequisite for induction of transcription factors involved in arterial calcification. Recently, King et al. have reported that BMPs reduce the expression of SMC markers in passaged VSMCs exhibiting a dedifferentiated phenotype (24) and proposed that this reduction is associated with the binding of KLF4, which is up-regulated by BMP in VSMCs, to the transforming growth factor (TGF) control element in the promoter regions of SMC marker genes. However, they did not address the molecular mechanism of transcriptional suppression via KLF4/TGF control element. Here, we demonstrated that the BMP-triggered expression of Msx1 and Msx2 induced phenotypic modulation of VSMCs, as revealed by the down-regulation of SMC marker expression, and the molecular mechanism by which these Msx transcription factors repress SMC-specific transcription (Fig. 9). We also addressed the involvement of BMPs/Msx transcription factors in the progression of atherosclerosis. In our preliminary experiment, RT-PCR analysis revealed that the expression of BMP2, BMP6, Msx1, and Msx2 mRNAs was highly up-regulated in advanced human atherosclerotic arteries but not in normal arteries. In contrast, the expressional features of SMC markers were markedly down-regulated (data not shown). These results are partially in accordance with previous reports by Cheng et al. (11) and Tyson et al. (48); the expression of BMP2 and Msx2 is significantly increased in calcified arteries. They suggest that the BMPs/Msx transcription factor-mediated down-regulation of SMC marker expression would occur in atherosclerotic lesions. Our present study suggests a role for BMPs in the progression of atherosclerosis as an autocrine/paracrine factor for phenotypic modulation of VSMCs in addition to their involvement in the osteogenic trans-differentiation of VSMCs.
|
H lost the inhibitory effect on Mycd activity. As a
result, neither Msx1 nor Msx2 affected the transcriptional activity of
a constitutively active viral promoter. These results suggest that the
inhibitory activity of Msx1 depends on its interaction with Mycd and
SRF but not on other transcription factors, including general
transcription factors. Differentiated VSMCs predominantly express h-CaD, whereas dedifferentiated VSMCs and nonmuscle cells only express l-CaD (46). The basal expression of l-CaD in 10T1/2 cells might be regulated by a mechanism distinct from the CArG/SRF-dependent one, given that Msx1 or Msx2 suppressed the endogenous expression of l-CaD and its transcription, which were enhanced by Mycd, but not l-CaD's basal expression and promoter activity (Fig. 3A and B and Fig. 2D).
Brunelli et al. have recently reported that Msx2 also functions as a positive regulator for SMC marker expression in combination with a transcriptional corepressor, necdin, during the SMC-like differentiation of mesoangioblasts (7). Undifferentiated mesoangioblasts are capable of an SMC-like phenotype in response to TGFß1 stimulation. During this process, TGFß1 induces the simultaneous up-regulation of necdine and Msx2 followed by the expression of SMC marker genes. Kuwajima et al. have also shown that necdin and Msx2 form a stable complex via MAGE-D1 in C2C12 cells (25). In this case, Mycd would not be involved in transactivation of SMC marker genes because mesoangioblasts do not express Mycd (7). Mycd expression is largely restricted to a cardiovascular lineage. In contrast, Mycd-related transcriptions (MRTF-A and MRTF-B) are ubiquitously expressed in a broad range of embryonic and adult tissues and most culture cells (38). In our preliminary experiments, we have found that Msx1 also interacts with MRTF-A and inhibits the transcriptional activity of MRTF-A (data not shown), suggesting that the regulatory interactions described here may, generally occur in a wide variety of cells as well. Qiu et al. have reported that TGFß1-induced Smad3 directly binds to Mycd and activates the transcription of SMC marker genes (40). Based on these findings, we speculate that activation of MRTF-A and/or MRTF-B via Smad family members would result in the transcriptional activation of SMC marker genes in combination with counteracting the repressive effect of Msx2 by a ternary complexformation with necdin and MAGE-D1 in mesoangioblasts stimulated with TGFß1.
Interaction of Msx transcription factors with Mycd and SRF and the molecular mechanism of Msx-mediated transcriptional inhibition.
Our present results demonstrated that
Msx1 interacted with two regions of Mycd, the N-terminal short region
(amino acids 1 to 51) and the central basic sequence (Fig.
5). It has been reported
that the region encompassing the central basic sequence and glutamine
(Q)-rich domain of Mycd is required for its interaction with SRF
(50). The
Msx1-interacting site in the central basic sequence of Mycd should be
distinct from the SRF-interacting site because the interaction between
Mycd and Msx1 did not compete with SRF (Fig.
4). Mycd and MRTFs have a
conserved N-terminal domain composed of RPEL repeats that is critical
for the Rho-dependent nuclear import of MRTF-A
(33). However, Mycd is
constitutively located in the nucleus of Cos7 and 10T1/2 cells even
under low-serum culture conditions
(50) (Fig.
4A). Thus, the critical
role of the N-terminal region of Mycd has been obscure. Mycd
N128, which lacks the N-terminal region, interacted modestly
with Msx1, but its Msx1-interacting ability was weak compared with that
of Mycd wt, indicating that the N-terminal region of Mycd is necessary
for a stable interaction with Msx1 and exertion of the full inhibitory
effect of Msx1 on Mycd activity. Here, we demonstrated a biological
role for the N-terminal region of Mycd which is involved in
Rho-dependent nuclear import.
Msx1 also interacted with SRF via SRF's MADS domain (Fig. 6). The MADS domain of SRF plays a critical role in its DNA-binding activity and dimer formation (36). SRF PRGI-In206, which cannot form a dimer, interacted with Msx1 as well as SRFwt, whereas SRF Pm143-146, which lacks DNA-binding activity, lost almost all of its Msx1-interacting ability. These results suggest that SRF loses its DNA-binding ability by interacting with Msx1 because the Msx1-interacting site of SRF overlaps with its critical site for DNA binding. This property causes inhibition of the transactivation of SMC marker genes because of Msx1's masking of the interaction between Mycd/SRF and the CArG-box motif. The results of gel-shift and ChIP assays (Fig. 8) strongly support this notion.
VSMCs originate from two different sources. VSMCs in the dorsal aorta are derived from the mesoderm, and those in the aortic arch arteries are from the neural crest (28). Kwang et al. reported that Msx2 was a critical downstream target for Pax3, which represses the expression of Msx2 (26). Pax3-deficient mice showed neural crest defects including aortic arch anomalies, whereas double deficiency of Pax3/Msx2 rescues such defects. In embryonic day 9.5 (E9.5) mouse embryos, the expression of Msx1 gene is detected in the somites as monitored by Msx1nlacZ transgene, whereas such expression is no longer detectable in E10 embryos. In coincidence with the down-regulation of Msx1nlacZ transgene, an early myogenic regulatory factor, Myf5, is expressed (20). These results clearly indicate that Msx1 inhibits myogenic differentiation in vivo. A recent study has demonstrated that VSMCs in the dorsal aorta, in part, originate from the somites (14). In E10.5 mouse embryos, in which Msx1 is not expressed in the somites, anti-SM actin-positive cells derived from the somites are found in the dorsal aorta. In contrast, populations of such anti-SM actin-positive cells are low in E9.5 embryos, while the expression of Msx1 is detected in the somites. Considering these findings, Msx transcription factors would play a role in repression of SMC markers in distinct VSMC progenitors, such as mesoderm/somite-derived cells and neural crest-derived cells, in a mechanism similar to that demonstrated here.
We summarize the molecular mechanism of the Msx-mediated suppression of SMC marker gene transcription combined with predicted BMP signaling pathways in Fig. 9. A ternary complex of SRF/Mycd/Msx1 cannot access the CArG-box motif because the DNA-binding site of SRF is masked by Msx1 binding to the complex. As a result, the transcription of SMC marker genes is inhibited. The N-terminal Msx1-interacting region of Mycd might function to stabilize such a ternary complex. Some recent studies have reported transcription factors that interfere with the Mycd activity in VSMCs. These include HERP family factors (13), KLF4 (30), Foxo4 (31), and Elk-1 (52). These factors interact with either SRF or Mycd (13, 30, 31) or compete with Mycd for interaction with SRF (52), inhibiting the transactivation of SMC marker gene expression. The inhibitory mode of Msx1 presented here is unique and distinct from its previously identified modes of action as a transcriptional repressor.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Published ahead of print on 9 October 2006. ![]()
Present
address: Department of Laboratory Medicine, Ehime University School of
Medicine, Toon-shi, Ehime 791-0295, Japan. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Bendall, A. J., D. E. Rincon-Limas, J. Botas, and C. Abate-Shen. 1998. Protein complex formation between Msx1 and Lhx2 homeoproteins is incompatible with DNA binding activity.Differentiation 63:151-157.[CrossRef][Medline]
3. Bendall, A. J., J. Ding, G. Hu, M. M. Shen, and C. Abate-Shen. 1999. Msx1 antagonizes the myogenic activity of Pax3 in migrating limb muscle precursors.Development 126:4965-4976.[Abstract]
4. Binato, R., C. E. A. Martinez, L. Pizzatti, B. Robert, and E. Abdelhay. 2006. SMAD 8 binding to mice Msx1 basal promoter is required for transcriptional activation. Biochem. J. 393:141-150.[CrossRef][Medline]
5. Bostrom, K., K. E. Watson, S. Horn, C. Worthman, I. M. Herman, and L. L. Demer. 1993. Bone morphogenetic protein expression in human atherosclerotic lesions.J. Clin. Investig. 91:1800-1809.[Medline]
6. Brennan,
T. J., and E. N. Olson. 1990.
Myogenin resides in the nucleus and acquires high affinity for a
conserved enhancer element on heterodimerization. Genes
Dev.
4:582-595.
7. Brunelli,
S., E. Tagliafico, F. G. De Angelis, R. Tonlorenzi, S.
Baesso, S. Ferrari, M. Niinobe, K. Yoshikawa, R. J. Schwartz,
I. Bozzoni, S. Ferrari, and G. Cossu. 2004. Msx2 and
necdin combined activities are required for smooth muscle
differentiation in mesoangioblast stem cells. Circ. Res.
94:1571-1578.
8. Catron, K. M., H. Zhang, S. C. Marshall, J. A. Inostroza, J. M. Wilson, and C. Abate. 1995. Transcriptional repression by Msx-1 does not require homeodomain DNA-binding sites. Mol. Cell. Biol. 15:861-871.[Abstract]
9. Chang, D. F., N. S. Belaguli, D. Iyer, W. B. Roberts, S. P. Wu, X. R. Dong, J. G. Marx, M. S. Moore, M. C. Beckerle, M. W. Majesky, and R. J. Schwartz. 2003. Cysteine-rich LIM-only proteins CRP1 and CRP2 are potent smooth muscle differentiation cofactors. Dev. Cell 4:107-118.[CrossRef][Medline]
10. Chen, J., C. M. Kitchen, J. W. Streb, and J. M. Miano. 2002. Myocardin: a component of a molecular switch for smooth muscle differentiation. J. Mol. Cell Cardiol. 34:1345-1356.[CrossRef][Medline]
11. Cheng,
S. L., J. S. Shao, N. Charlton-Kachigian,
A. P. Loewy, and D. A. Towler.2003
. Msx2 promotes osteogenesis and suppresses adipogenic
differentiation of multipotent mesenchymal progenitors.J. Biol. Chem.
278:45969-45977.
12. Dhore,
C. R., J. P. Cleutjens, E. Lutgens, K. B.
Cleutjens, P. P. Geussens, P. P. Kitslaar,
J. H. Tordoir, H. M. Spronk, C. Vermeer, and
M. J. Daemen. 2001. Differential expression
of bone matrix regulatory proteins in human atherosclerotic plaques.Arterioscler. Thromb. Vasc. Biol.
21:1998-2003.
13. Doi,
H., T. Iso, M. Yamazaki, H. Akiyama, H. Kanai, H. Sato, K.
Kawai-Kowase, T. Tanaka, T. Maeno, E. Okamoto, M. Arai, L. Kedes, and
M. Kurabayashi. 2005. HERP1 inhibits myocardin-induced
vascular smooth muscle cell differentiation by interfering with SRF
binding to CArG box. Arterioscler. Thromb. Vasc. Biol.
25:2328-2334.
14. Esner,
M., S. M. Meilhac, F. Relaix, J. F. Nicolas, G.
Cossu, and M. E. Buckingham. 2006. Smooth
muscle of the dorsal aorta shares a common clonal origin with skeletal
muscle of the myotome. Development
133:737-749.
15. Gupta, V., and M. Bei. 2006. Modification of Msx1 by SUMO-1.Biochem. Biophys. Res. Commun. 345:74-77.[CrossRef][Medline]
16. Hayashi,
K., H. Saga, Y. Chimori, K. Kimura, Y. Yamanaka, and K. Sobue.1998
. Differentiated phenotype of smooth muscle cells
depends on signaling pathways through insulin-like growth factors and
phosphatidylinositol 3-kinase. J. Biol. Chem.
273:28860-28867.
17. Hayashi,
K., M. Takahashi, K. Kimura, W. Nishida, H. Saga, and K. Sobue.1999
. Changes in a balance of phosphoinositide
3-kinase/protein kinase B (Akt) and the mitogen-activated protein
kinases (ERK/p38MAPK) determine the phenotype of smooth muscle cells.J. Cell Biol.
145:727-740.
18. Hayashi,
K., M. Takahashi, M, W. Nishida, K. Yoshida, Y. Ohkawa, A. Kitabatake,
J. Aoki, H. Arai, and K. Sobue. 2001. Phenotypic
modulation of vascular smooth muscle cells induced by unsaturated
lysophosphatidic acids. Circ. Res.
89:251-258.
19. Hendrix,
J. A., B. R. Wamhoff, O. G. McDonald, S.
Sinha, T. Yoshida, and G. K. Owens. 2005.
5' CArG degeneracy in smooth muscle
-actin is required
for injury-induced gene suppression in vivo.J. Clin. Investig.
115:418-427.[CrossRef][Medline]
20. Houzelstein1, D., G. Auda-Boucher, Y. Cheraud, T. Rouaud, I. Blanc1, S. Tajbakhsh, M. E. Buckingham, J. Fontaine-Perus, and B. Robert.1999 . The homeobox gene Msx1 is expressed in a subset of somites, and in muscle progenitor cells migrating into the forelimb.Development 126:2689-2701.[Abstract]
21. Hruska,
K. A., S. Mathew, and G. Saab. 2005. Bone
morphogenetic proteins in vascular calcification. Circ.
Res.
97:105-114.
22. Hu, G., H. Lee, S. M. Price, M. M. Shen, and C. Abate-Shen. 2001. Msx homeobox genes inhibit differentiation through upregulation of cyclin D1.Development 128:2373-2384.
23. Hussein,
S. M., E. K. Duff, and C. Sirard.2003
. Smad4 and ß-catenin co-activators
functionally interact with lymphoid-enhancing factor to regulate graded
expression of Msx2. J. Biol. Chem.
278:48805-48814.
24. King,
K. E., V. P. Iyemere, P. L. Weissberg,
and C. M. Shanaha. 2003. Kruppel-like factor
4 (KLF4/GKLF) is a target of bone morphogenetic proteins and
transforming growth factor ß1 in the regulation of vascular
smooth muscle cell phenotype. J. Biol. Chem.
278:11661-11669.
25. Kuwajima,
T., H. Taniura, I. Nishimura, and K. Yoshikawa. 2004.
Necdin interacts with the Msx2 homeodomain protein via MAGE-D1 to
promote myogenic differentiation of C2C12 dells. J.
Biol. Chem.
279:40484-40493.
26. Kwang, S. J., S. M. Brugger, A. Lazik, A. E. Merrill, L. Y. Wu, Y. H. Liu, M. Ishii, F. O. Sangiorgi, M. Rauchman, H. M. Sucov, R. L. Maas, and R. E. Maxson, Jr.2002 . Msx2 is an immediate downstream effector of Pax3 in the development of the murine cardiac neural crest.Development 129:527-538.
27. Lee,
H., R. Habas, and C. Abate-Shen. 2004. MSX1 cooperates
with histone H1b for inhibition of transcription and myogenesis.Science
304:1675-1678.
28. Le Lievre, C. S., and N. M. Le Douarin.1975 . Mesenchymal derivatives of the neural crest: analysis of chimaeric quail and chick embryos. J. Embryol. Exp. Morphol. 34:125-154.[Medline]
29. Li,
L., Z. Liu, B. Mercer, P. Overbeek, and E. N. Olson.1997
. Evidence for serum response factor-mediated
regulatory networks governing SM22
transcription in smooth,
skeletal, and cardiac muscle cells. Dev. Biol.
187:3113-3121.
30. Liu,
Y., S. Sinba, O. G. McDonald, Y. Shang, M. H.
Hoofnagle, and G. K. Owens. 2005.
Kruppel-like factor 4 abrogates myocardin-induced activation of smooth
muscle gene expression. J. Biol. Chem.
280:9719-9727.
31. Liu, Z. P., Z. Wang, H. Yanagisawa, and E. N. Olson.2005 . Phenotypic modulation of smooth muscle cells through interaction of Foxo4 and myocardin. Dev. Cell 9:261-270.[CrossRef][Medline]
32. Magne, D., M. Julien, C. Vinatier, F. Merhi-Soussi, P. Weiss, and J. Guicheux. 2005. Cartilage formation in growth plate and arteries: from physiology to pathology. Bioessays 27:708-716.[CrossRef][Medline]
33. Miralles, F., G. Posern, A. I. Zaromytidou, and R. Treisman.2003 . Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell 113:329-342.[CrossRef][Medline]
34. Momiyama, T., K. Hayashi, Y. Chimori, T. Nishida, T. Ito, W. Kamiike, H. Matsuda, and K. Sobue. 1998. Functional involvement of serum response factor in the transcriptional regulation of caldesmon gene.Biochem. Biophys. Res. Commun. 242:429-435.[CrossRef][Medline]
35. Nishida,
W., M. Nakamura, S. Mori, M. Takahashi, Y. Ohkawa, S. Tadokoro, K.
Yoshida, K. Hiwada, K. Hayashi, and K. Sobue. 2002. A
triad of serum response factor and the GATA and NK families governs the
transcription of smooth and cardiac muscle genes. J.
Biol. Chem.
277:7308-7317.
36. Norman, C., M. Runswick, R. Pollock, and R. Treisman. 1988. Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element.Cell 55:989-1003.[CrossRef][Medline]
37. Owens,
G. K. 1995. Regulation of differentiation of
vascular smooth muscle cells. Physiol. Rev.
75:487-517.
38. Pipes,
G. C. T., E. E. Creemers, and
E. N. Olson. 2006. The myocardin family of
transcriptional coactivators: versatile regulators of cell growth,
migration, and myogenesis. Genes Dev.
20:1545-1556.
39. Prywes,
R., and H. Zhu. 1992. In vitro squelching of
activated transcription by serum response factor: evidence for a common
coactivator used by multiple transcriptional activators. Nucleic
Acids Res.
20:513-520.
40. Qiu,
P., R. P. Ritchie, Z. Fu, D. Cao, J. Cumming, J. M.
Miano, D. Z. Wang, H. J. Li, and L. Li.2005
. Myocardin enhances Smad3-mediated transforming
growth factor-ß1 signaling in a CArG box-independent manner.Circ. Res.
97:983-991.
41. Satokata, I., and R. Maas. 1994. Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development.Nat. Genet. 6:348-356.[CrossRef][Medline]
42. Satokata, I., L. Ma, H. Ohshima, M. Bei, I. Woo, K. Nishizawa, T. Maeda, Y. Takano, M. Uchiyama, S. Heaney, H. Peters, Z. Tang, R. Maxson, and R. Maas. 2000. Msx2 deficiency in mice causes pleiotropic defects in bone growth and ectodermal organ formation. Nat. Genet. 24:391-395.[CrossRef][Medline]
43. Schluesener, H. J., and R. Meyerman. 1995. Immunolocalization of BMP-6, a novel TGF-ß related cytokine, in normal and atherosclerotic smooth muscle cells.Atherosclerosis 113:153-156.[CrossRef][Medline]
44. Shao, J. S., S. L. Cheng, J. M. Pingsterhaus, N. Charlton-Kachigian, A. P. Loewy, and D. A. Towler. 2005. Msx2 promotes cardiovascular calcification by activating paracrine Wnt signals. J. Clin. Investig. 115:1210-1220.[CrossRef][Medline]
45. Shao,
J. S., J. Cai, and D. A. Towler.2006
. Molecular mechanisms of vascular calcification:
lessons learned from the aorta. Arterioscler. Thromb. Vasc.
Biol.
26:1423-1430.
46. Sobue, K., K. Hayashi, and W. Nishida. 1999. Expressional regulation of smooth muscle cell-specific genes in association with phenotypic modulation. Mol. Cell. Biochem. 190:105-118.[CrossRef][Medline]
47. Takahashi, M., K. Hayashi, K. Yoshida, K., Y. Ohkawa, T. Komurasaki, A. Kitabatake, A. Ogawa, W. Nishida, M. Yano, M., N. Monden, and K. Sobue. 2003. Epiregulin as a major autocrine/paracrine factor released from the ERK- and p38MAPK-activated vascular smooth muscle cells. Circulation 108:2524-2529.
48. Tyson,
K. L., J. L. Reynolds, R. McNair, Q. Zhang,
P. L. Weissberg, and C. M. Shanahan.2003
. Osteo/chondrocytic transcription factors and their
target genes exhibit distinct patterns of expression in human arterial
calcification. Arterioscler. Thromb. Vasc. Biol.
23:489-494.
49. Vlahopoulos,
S., W. E. Zimmer, G. Jenster, N. S. Belaguli,
S. P. Balk, A. O. Brinkmann, R. B. Lanz,
V. C. Zoumpourlis, and R. J. Schwartz.2005
. Recruitment of the androgen receptor via serum
response factor facilitates expression of a myogenic gene.J. Biol. Chem.
280:7786-7792.
50. Wang, D., P. S. Chang, Z. Wang, L. Sutherland, J. A. Richardson, E. Small, P. A. Krieg, and E. N. Olson. 2001. Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor.Cell 105:851-862.[CrossRef][Medline]
51. Wang,
Z., D. Wang, G. C. Pipes, and E. N. Olson.2003
. Myocardin is a master regulator of smooth muscle
gene expression. Proc. Natl. Acad. Sci. USA
100:7129-7134.