Previous Article | Next Article ![]()
Molecular and Cellular Biology, December 2006, p. 9544-9554, Vol. 26, No. 24
0270-7306/06/$08.00+0 doi:10.1128/MCB.00599-06
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
,
Shaun E. Peterson,2 and
Lorraine S. Symington3*
Graduate Program in Cellular, Molecular and Biophysical Studies,1 Graduate Program in Biological Sciences,2 Department of Microbiology, Columbia University Medical Center, New York, New York 100323
Received 6 April 2006/ Returned for modification 2 June 2006/ Accepted 3 October 2006
|
|
|---|
|
|
|---|
To address the role of ATP binding and hydrolysis in Rad51 function, the invariant lysine residue within the Walker A motif of the yeast Rad51 and human Rad51 proteins has been substituted with alanine or arginine. The yeast Rad51-K191A protein is unable to hydrolyze ATP or bind to ssDNA in vitro, and this allele confers a rad51 null phenotype in vivo and is dominant negative in the presence of wild-type RAD51 (10, 29, 45, 56). Although the human Rad51-K133A protein binds to DNA, the filaments formed are inactive, and as in yeast, the rad51-K133A allele is phenotypically null and confers a dominant-negative phenotype in RAD51+/+ mouse embryonic stem (ES) cells (8, 30, 48, 49). By contrast, the yeast Rad51-K191R and human Rad51-K133R proteins are active for DNA binding and strand exchange (8, 30, 56). The phenotype of yeast cells expressing the rad51-K191R allele depends on the expression level of the mutant allele. When expressed in single copy from the native RAD51 promoter, a rad51-K191R strain shows high sensitivity to IR and is defective for mating-type switching, a DSB-induced gene conversion event (29). However, when expressed at high levels, the rad51-K191R allele fully complements the IR and methyl methanesulfonate sensitivity of a rad51 null strain (29, 56). Expression of the human Rad51-K133R protein in a chicken DT40 cell line was able to support proliferation after depletion of the native protein in some cell lines, suggesting that ATP hydrolysis is not required for the essential function of Rad51 in vertebrates; however, the mutant protein was expressed at higher levels than wild-type Rad51 in the viable cell lines (30). A dominant-negative effect on homologous recombination was observed when the human RAD51-K133R allele was expressed in mouse ES cells, consistent with an important role for ATP hydrolysis in RAD51 function (48, 49).
In the case of RecA, the RecA-K72R protein shows highly attenuated ATPase activity but is still able to bind nucleotide cofactor (dATP), forms extended filaments on ssDNA, and promotes limited strand exchange (38, 42). However, the recA-K72R allele is unable to complement the UV sensitivity of a recA null strain (24). While these results suggest ATP hydrolysis is essential for RecA function in vivo, there are other ATPase-defective alleles of recA that confer less-profound DNA repair and recombination deficiency in vivo (5).
In a previous
study we reported suppression of the IR sensitivity of haploid
rad51-K191R cells by expression of both mating-type alleles
(MATa and MAT
) or by high-copy-number
expression of RAD54
(29). Although the
suppression by mating-type heterozygosity is not understood, it is
likely to function by increasing the activity of Rad51, because some
other DNA repair mutants that are suppressed by mating-type
heterozygosity (rad55
, rad57
,
rad52-20, and rad52-327) are also suppressed by
overexpression of RAD51
(3,
13,
16,
25,
41). Rad54 stabilizes the
Rad51 nucleoprotein filament in vitro, but the major function of Rad54
in recombination is thought to be postsynaptic, because Rad51 is still
able to associate with DSBs in vivo in rad54 mutants
(20,
27,
28,
52). Furthermore, Rad54
is able to displace Rad51 from duplex DNA, leading to the suggestion
that one function of Rad54 is in turnover of Rad51 by removing it from
heteroduplex joints following strand exchange
(47). Thus, one
hypothesis for the rad51-K191R defect in vivo is an inability
to turn over at the end of recombination. Such a defect would be
consistent with the suppression by high levels of Rad54 and also with
overexpression of the Rad51-K191R protein
(29,
56). Studies with the
human Rad51-K133R protein have shown formation of more stable D loops
by the mutant protein, which could be explained by more
stable binding to the heteroduplex DNA joint molecule following strand
exchange (46). The
biochemical studies predict that strand exchange is initiated but not
completed in the rad51-K191R mutant, resulting in the mitotic
recombination and repair defects. To test this hypothesis, we analyzed
the recruitment of Rad51-K191R to DSBs in vivo, as well as genetic
interactions with Srs2, a helicase that displaces Rad51 from ssDNA
(19,
60). In contrast to our
expectations, the defect caused by the rad51-K191R allele is
at an early step, preventing normal association of Rad51 with ssDNA. We
suggest that the Rad51-K191R protein is unable to
form a competent nucleoprotein filament and this can be
overcome by high levels of Rad54 or by deletion of
SRS2.
|
|
|---|
Yeast strains and plasmids. Saccharomyces cerevisiae strains used in this study are listed in Table 1. All strains are in the RAD5-corrected W303 background (his3-11,15 leu2-3,112 trp1-1 ura3-1 ade2-1 can1-100 RAD5) except JKM179 and its derivatives, LSY1750-1 and LSY1751. The yellow fluorescent protein (YFP) fusion strains were made by crossing the appropriate haploid parents, sporulating the resulting diploids, and screening the haploid progeny for the correct phenotype; the expression of YFP was confirmed by epifluorescence microscopy. To construct LSY1576 and LSY1752, pRS406-rad51-K191R or pRS406-rad51-K191A, respectively, was cut with Bsu36I and transformed into the YFP-RAD51 strain, W4121-20D (20). The resulting Ura+ transformants were patched to synthetic medium containing 5-fluoroorotic acid to select for pop-out events and then screened for ionizing radiation sensitivity conferred by the rad51-K191 or rad51-K191A allele. The RAD51 locus of these strains was PCR amplified and sequenced to confirm the substitution of the RAD51 allele with either rad51-K191R or rad51-K191A. LSY1750-1 was made by the same method, using pRS406-rad51-K191R and transforming into strain JKM179 (52) (kindly provided by J. Haber). LSY1751 was made by a one-step gene replacement of the RAD51 locus in the JKM179 strain with a linear PCR fragment containing homologous 5' and 3' flanking sequences from the rad51::KANMX deletion strain, resulting in the integration of the KANMX marker and the loss of the wild-type RAD51 allele. LSY1753-1C was made by mating LSY1102-1B and LSY977 and screening the haploid segregants from sporulated diploids for the correct phenotype. The presence of the 3x hemagglutinin (HA) epitope tag at the carboxy terminus encoded by RAD52 was confirmed by PCR using primers 5'AAGAACTGGGGCCTCATATG and 5'GATCCCCGGGAATTGCCATGAGCGTAATCTGGAACGTC. LSY1755-1 was made by transforming the HIS3-containing pRS413 or the LEU2-containing pRS415 vector into LSY1309-1 or LSY1205-2A, respectively, and mating the resulting transformants of each strain to each other. Diploids were selected on SC medium minus histidine and leucine.
|
View this table: [in a new window] |
TABLE 1. Yeast
strains used in this
work
|
Gamma irradiation survival assays. Cells were grown in liquid medium to mid-log phase. The cultures were serially diluted, and aliquots of each dilution were plated on solid medium. The plates were irradiated in a Gammacell-220 irradiator containing 60Co for the designated dose. The plates were incubated for 3 days at 30°C before survivors were counted. For spot assays, cells were grown as described above, serially diluted, and spotted onto YPD plates. The plates were irradiated and incubated at 30°C for 3 days.
Microscopy.
Cells were grown in SC medium or SC
lacking the appropriate amino acid until an optical density at 600 nm
(OD600) of 0.2, at which time the liquid cultures were
exposed to the defined doses of
-rays in a Gammacell-220
60Co irradiator or left unirradiated, and aliquots of the
cultures were processed immediately for imaging or for the time
indicated postirradiation as described previously
(21). Live cell images
were captured as described previously
(20). YFP fluorescence
was acquired using Openlab software (Improvision) and quantified using
Volocity software
(Improvision).
Physical analysis of mating-type switching. Strains W1588-4A, LSY1205-2A, and LSY1388-1C were transformed to Trp+ with plasmid pFH800 (33). Cells were grown in raffinose-containing SC medium minus Trp to an OD600 of 0.5. Induction of the HO endonuclease and hourly sample collections were carried out as described previously (23). Genomic DNA was extracted and digested with StyI, and DNA fragments were separated on 0.8% agarose gels and transferred to nylon membranes. Membranes were hybridized with a PCR fragment generated by amplification of a 405-bp sequence distal to the HO cut site (23).
Rad51 antibody affinity purification. Anti-Rad51 polyclonal antibodies from rabbit were purified from crude serum by affinity chromatography as described previously (12). The chromatography column was prepared by concentrating approximately 3 mg of Rad51 protein in 600 µl of 0.1 M HEPES (pH 7.0) buffer and covalently coupled to a 200-µl bed volume of Affi-gel 15 beads (Bio-Rad).
ChIP. Cells were grown in YP lactate at 30°C to an OD600 between 0.33 and 0.50, at which time galactose was added to a final concentration of 2% for induction of the HO endonuclease. Chromatin immunoprecipitation (ChIP) was carried out as previously described (50) with the following modifications. The lysis buffer contained 50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 0.1% sodium dodecyl sulfate, 1% Triton X-100, and 0.1% sodium deoxycholate. Proteins were cross-linked with 1% formaldehyde (final concentration) in 45 ml of cell culture for 10 min, followed by quenching with 125 mM glycine (final concentration) for 5 min. Cells were lysed with glass beads in 400 µl of lysis buffer with 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, 0.5 µl/ml octanol, and 4 µg/ml leupeptin-pepstatin A-aprotinin. The volume of the extracts was adjusted to 1.2 ml with lysis buffer plus protease inhibitors and sonicated for a total of 100 s, with 0.9 s pulse-on and 7 s pulse-off (model 250; Branson). For immunoprecipitation (IP), 10 µl of affinity-purified anti-Rad51 antibody was incubated with 1.2 mg of extract in 1 ml of lysis buffer overnight at 4°C and then bound to 60 µl of 50% (vol/vol) protein A-agarose beads for 2 h at 4°C. The protein-bound beads were separated by centrifugation, and 300 µl of the unbound extracts was set aside as input samples and stored at 20°C. The beads were taken through a series of washes, followed by elution of the proteins. The IP and input samples were then incubated at 65°C for 6 h to reverse the cross-links. The samples were subjected to proteinase-K treatment, phenol extraction, and ethanol precipitation.
PCR amplification. The immunoprecipitated DNAs (undiluted) were quantified by real-time PCR amplification as described previously (6). MAT Z-specific primers, located 239 to 486 bp CEN distal to the HO cut site, were MATZ-5' (ATGTGAACCGCATGGGCAGT)and MATZ-3' (ACCCTTATCTACTTGCCTCT) (6). Primers specific for the ACT1 promoter were ACT1-5' (TTTGAAACCAAACTCGCCTCTCTC) and ACT1-3' (CTTGGTTTGAGTAGAAAGGGGAAGG) (6). The relative IP is the signal from immunoprecipitated DNA divided by the signal from the corresponding input DNA (1:1,000 dilutions). Each resulting IP/input ratio from the MAT locus was divided by the IP/input ratio obtained at the control ACT1 locus. The final number represents the n-fold enrichment over the value for the zero time point.
Coimmunoprecipitation. Cells were grown to mid-log phase in YPD at 30°C, at which time 50 ml of cells were collected, washed twice with 20 mM Tris (pH 7.5)-400 mM NaCl, and stored at 80°C. Cells were resuspended in 400 µl lysis buffer (50 mM HEPES-KOH [pH 7.5], 400 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 1:1,000 dilution of Protease Cocktail IV [Calbiochem], 1 mM phenylmethylsulfonyl fluoride, 1 mM benzamidine, and 1 µg/ml leupeptin). Extracts were prepared and immunoprecipitated as previously described (50). For immunoprecipitations of native Rad51 or Rad51-K191R proteins, extracts were incubated with 12.5 µl anti-Rad51 crude serum antibody at 4°C for 3 h and then incubated with 60 µl 50% (vol/vol) protein A-agarose beads at 4°C for 1 h. Immunoprecipitated complexes were analyzed by Western blotting using a 1:500 dilution of anti-HA monoclonal antibody (12CA5; Roche) to detect Rad52-HA.
Protein purification. Rad51 was expressed in E. coli strain BL21(DE3)/pLysS (Novagen, Inc., Madison, WI) using plasmid pEZ5139 and purified as previously described (64). The Rad51-K191R protein was purified by the same procedure.
DNA binding assay.
DNA binding was measured by retention
of protein-DNA complexes on nitrocellulose filters as previously
described (63). pUC19 DNA
was linearized with EcoRI and end labeled with Klenow fragment in the
presence of [
-32P]dATP. Single-stranded DNA was
made by heat denaturing the labeled DNA and then quenching on ice.
Increasing amounts of protein were incubated with 100 nM of ssDNA in
binding buffer (40 mM morpolineethanesulfonic acid [pH 6.4], 4 mM
magnesium chloride, 1 mM dithiothreitol, 1 mM ATP, 5% glycerol).
Reactions were incubated at 37°C for 15 min and then passed
through the nitrocellulose and DEAE membranes in a vacuum manifold. DNA
binding was measured as the amount of DNA retained on the
nitrocellulose membrane over the total amount retained on both
membranes. Data were quantified with a Molecular Dynamics Storm 445 SI
PhosphorImager and IMAGE-QUANT software. The data shown represent
averages for three
trials.
|
|
|---|
![]() View larger version (12K): [in a new window] |
FIG. 1. ATP
hydrolysis by Rad54 is required for suppression of the -ray
sensitivity conferred by the rad51-K191R allele. Strain LSY979
(rad51-K191R) containing plasmids expressing the
RAD54, rad54-K341R, or rad54-K341A allele
was irradiated as described in Materials and
Methods.
|
irradiation. Although the
YFP-Rad51 fusion protein is not fully functional, it is recruited to
DSBs with kinetics similar to that of untagged Rad51 as monitored by
ChIP (20,
52). Both Rad51 and
Rad51-K191R form foci in response to DNA damage, but Rad51-K191R foci
are about six times less bright than Rad51 foci (Fig.
2). By Western blot analysis, the steady-state level of the
YFP-Rad51-K191R protein was similar to that of YFP-Rad51 (data not
shown). In coimmunoprecipitation experiments, Rad51-K191R retains
normal association with Rad52 (data not shown); therefore, the dimmer
Rad51-K191R foci are not a result of less-efficient recruitment of
Rad51 by Rad52 at resected DSBs and most likely result from a reduced
pool of protomers or reduced retention of Rad51-K191R at break sites.
The Rad51-K191A protein, which fails to bind DNA in vitro
(56,
58), was fused to YFP as
a control for foci formation. Whereas every budded RAD51 and
rad51-K191R cell contains at least 1 focus after exposure to
irradiation, only 1 focus was observed in about 50 irradiated
rad51-K191A cells. Furthermore, the rare Rad51-K191A foci are
very dim compared to those formed by Rad51 or Rad51-K191R (Fig.
2A).
![]() ![]() View larger version (29K): [in a new window] |
FIG. 2. Rad51-K191R
is recruited to DSBs less efficiently than Rad51. (A)
Ionizing radiation-induced focus formation. YFP fusions were made with
Rad51 and Rad51 mutant proteins (strains W4121-20D, LSY1576, and
LSY1752, respectively). The strains were exposed to 20 krads of gamma
radiation, followed by microscopy to monitor focus formation.
(B) Distribution of focus brightness. The brightness of each
focus was quantified and plotted; at least 30 foci were analyzed for
each strain. The mean focus brightness for each strain is represented
by a black bar. (C) Defective recruitment of Rad51-K191R to
an HO-induced DSB. HO endonuclease was induced in a donorless strain
that cannot repair the DSB at the MAT locus, and recruitment
of native Rad51 (JKM179; diamonds) or Rad51-K191R (LSY1750-1; squares)
was monitored by chromatin immunoprecipitation. A rad51 null
strain (LSY1751; triangles) was used as a negative control. HO was
induced at time zero and samples analyzed at 30-min time intervals
after HO induction. The relative IP at each time point represents the
amount of immunoprecipitated DNA divided by the amount of input DNA,
normalized to the control ACT signal at time zero.The data represent averages for three independent
trials.
|
Deletion of SRS2 suppresses IR sensitivity of the rad51-K191R strain.
The localization
studies suggest Rad51-K191R forms a partial or unproductive filament on
ssDNA, preventing initiation of recombination. Because the Srs2
helicase has been shown to displace Rad51 from ssDNA, we reasoned that
Srs2 would be more effective in removing Rad51-K191R if the mutant
protein exhibits less-stable binding to ssDNA in vivo. Consistent with
this hypothesis, deletion of SRS2 resulted in an almost
complete suppression of the IR sensitivity of the rad51-K191R
strain (Fig.
3A). The srs2 rad51
double mutant showed a
sensitivity to IR equivalent to that of the rad51
strain, indicating suppression requires Rad51 and is not due to
activation of an alternate pathway (data not shown). The
ATPase-defective srs2-K41A strain
(18) also suppressed the
IR sensitivity of the rad51-K191R strain to the same level as
that of the srs2 null strain (data not shown), suggesting that
the removal of the Srs2 ssDNA translocase activity and the resulting
stabilization of the Rad51-K191R-ssDNA filament is responsible
for the rescue of the rad51-K191R DNA repair defect. We have
shown previously that the rad51-K191R strain is defective in
mating-type switching, a gene conversion event that is initiated by a
DSB made by the HO endonuclease
(29). In addition to
suppressing the IR sensitivity of rad51-K191R, the deletion of
SRS2 also rescued the mating-type switching defect of the
rad51-K191R strain (Fig.
3B), suggesting that the
absence of Srs2 stabilizes the Rad51-K191R filament at DSB
sites.
![]() ![]() View larger version (31K): [in a new window] |
FIG. 3. The
DNA repair defect of the rad51-K191R strain is suppressed by
deletion of SRS2. (A) Deletion of SRS2
suppresses the -ray sensitivity of the rad51-K191R
strain. The wild-type strain is W1588-4C; the
srs2::HIS3 strain is HKY590-1D;
the rad51-K191R strain is LSY977, and the rad51-K191R
srs2 strain is LSY1388-1C. (B) The mating-type switching
defect of the rad51-K191R strain is suppressed by the deletion
of SRS2. A cartoon of the MAT locus showing
the location of the HO cut site and probe for Southern blots is shown
in the upper panel. Switching to MATa produces a novel 0.9-kb
StyI fragment. Kinetic analysis of mating-type switching in
RAD51 (W1588-4A), rad51-K191R (LSY1205-2A), and
rad51-K191R srs2 (LSY1388-1C) strains is shown in the lower
panel. Galactose was added to the cultures for 1 h at time
zero to induce expression of HO, and samples were removed every hour
for DNA
analysis.
|
![]() View larger version (14K): [in a new window] |
FIG. 4. The rad51-K191R strain is defective in assembly of IR-induced
Rad54 foci. YFP fusions with the Rad54 protein were made in various
genetic backgrounds: RAD51 (W4644-4A), rad51-K191R
(LSY1743-5C), rad51-K191A (LSY1745), rad51-K191R srs2
(LSY1754), and rad51-K191A srs2 (LSY1748). Rad54 focus
formation was monitored by microscopy after irradiation at 20 krads.
Each gray bars represents the total number of nuclei analyzed; each
black bar represents the number of nuclei that contained at least one
Rad54 focus. At least 60 cells were analyzed for each
strain.
|
strain
(52), similar to the
delay seen in the recruitment of the Rad51-K191R protein by chromatin
immunoprecipitation (Fig.
2C). We determined the
fluorescence intensity for IR-induced Rad51-YFP foci in a
rad55
strain and found the foci to exhibit the same
brightness as Rad51-K191R foci in a RAD55 background (Fig.
2B). Consistent with these results, the rad55 and rad57 mutant strains showed sensitivities to IR similar to that of the rad51-K191R strain (Fig. 5; also data not shown). As in the case of rad51-K191R, the IR sensitivity of rad57 can be partially suppressed by deletion of SRS2 (Fig. 5) or by RAD54 present in high copy number (29), suggesting that the Rad51 filament formed in the rad57 strain has characteristics similar to those of the Rad51-K191R filament even in the presence of the Rad55-Rad57 mediator. The suppression of the IR sensitivity of the rad57 mutant by srs2 is less than that observed for the rad51-K191R strain. It is possible that the Rad55-Rad57 heterodimer has other functions in addition to the mediator role that cannot be rescued by the deletion of SRS2 (22). While the deletion of SRS2 can suppress the IR sensitivity of the rad51-K191R or rad57 single mutants, srs2 cannot suppress the IR sensitivity of a rad51-K191R rad57 double mutant (Fig. 5), indicating that Rad51 filament formation is severely impaired when both the Rad55-Rad57 heterodimer and Rad51 ATP hydrolysis are absent. In addition to suppression by srs2, the IR sensitivity of rad51-K191R, rad55, or rad57 single mutants can be suppressed by mating-type heterozygosity (16, 25, 29). However, like srs2, mating-type heterozygosity is unable to suppress the IR sensitivity of the rad51-K191R rad57 double mutant (data not shown).
![]() View larger version (76K): [in a new window] |
FIG. 5. The
-ray sensitivity of the rad57 rad51-K191R srs2 triple
mutant is more severe than that of either the rad57 srs2 or
rad51-K191R srs2 double mutant. Serial dilutions of the
strains were spotted onto YPD plates and left unirradiated or
irradiated at 40 krads. Survival was assessed following growth for 3
days at 30°C. Strains used were W1588-1C (wild type), LSY411
(rad51::URA3), LSY977
(rad51-K191R), HKY598-2C
(rad57::LEU2), LSY1197
(rad51-K191R rad57::LEU2),
LSY1391 (rad57::LEU2
srs2::HIS3), LSY1388-1C
(rad51-K191R srs2), and LSY1596-4A (rad51-K191R
rad57::LEU2
srs2::HIS3).
|
rad51-K191R strain was mated to a
RAD51 haploid strain with a deletion of the MAT locus
rendering it a default a-mater
(51). The use of a
mat
strain was necessary because heterozygosity at
the MAT locus (the normal situation in diploids) suppresses
the phenotype conferred by the rad51-K191R allele
(29). The resulting
diploid strain (MAT
/mat
rad51-K191R/RAD51) shows greater sensitivity to IR than a
MAT
/mat
rad51
/RAD51 diploid, indicating semidominance of
the rad51-K191R allele (Fig.
6).
![]() View larger version (17K): [in a new window] |
FIG. 6. The
rad51-K191R allele is semidominant. Serial dilutions of the
strains were spotted onto YPD plates and left unirradiated or
irradiated at 20 krads. Survival was assessed following growth for 3
days at 30°C. Strains used were W1588-1C (wild type), LSY977
(rad51-K191R), LSY1759 (RAD51/RAD51), LSY1755-1
(RAD51/rad51-K191R), and LSY1781
(RAD51/rad51::HIS3).
|
![]() View larger version (9K): [in a new window] |
FIG. 7. Rad51-K191R
shows reduced DNA binding compared with that of Rad51. (A)
Binding of wild-type Rad51 (squares) or Rad51-K191R (triangles) to
single-stranded DNA. Increasing concentrations of either wild-type
Rad51 or Rad51-K191R were incubated with a constant amount of ssDNA and
passed through alkali-treated nitrocellulose and DEAE filters. The
percent bound represents the amount of DNA retained on nitrocellulose
compared with the total DNA. (B) The same as in panel A
except in the presence of 150 mM
NaCl.
|
|
|
|---|
By chromatin immunoprecipitation and live imaging of YFP-tagged Rad51-K191R, we detected reduced recruitment of Rad51-K191R to DSBs generated by HO endonuclease or IR (Fig. 2). A twofold reduction in the number of IR-induced Rad51 foci was previously reported for chicken DT40 cells expressing the human Rad51-K133R protein, but these cell lines have elevated expression of the mutant protein (30). We did not detect reduced numbers of IR-induced foci in the YFP-rad51-K191R strain, but the foci were six- to sevenfold less bright than in the YFP-RAD51 strain. In live cells, several DSBs are recruited to recombination centers represented by foci; therefore, by this method we are unable to distinguish between reduced numbers of DSBs with Rad51-K191R recruited or less Rad51-K191R at all DSBs (21). The defect in mating-type switching (Fig. 3B) is more consistent with formation of an incomplete or inactive filament at most lesions. Furthermore, the inability to detect IR-induced Rad55 or Rad54 foci in the rad51-K191R mutant suggests a defect in Rad51-K191R filament formation at the majority of break sites (Fig. 4). By Western blot analysis, the steady-state level of Rad51-K191R is similar to that of wild-type Rad51; thus, the reduced recruitment in vivo is not due simply to lower expression of the mutant protein (29). Consistent with a defect in an early step during homologous recombination, we found that the rad51-K191R mutation suppresses the synthetic lethality of srs2 rad54 double mutants (data not shown). Because the srs2 rad54 synthetic lethality is suppressed by deletion of RAD51, RAD52, or RAD55, all early recombination functions, this suggests the rad51-K191R defect is also at an early step.
The defect in recruitment of Rad51-K191R to break sites is similar to the defect reported for Rad51 recruitment in rad55 mutants (20, 52, 62). The rad51-K191R and rad57 (phenotypically the same as rad55) mutants show similar sensitivity to IR and are suppressed by srs2, by RAD54 expressed from a high-copy-number plasmid, or by mating-type heterozygosity (Fig. 5) (29). The rad55 and rad57 mutants are also suppressed by overexpression of Rad51 or by rad51 alleles that encode gain-of-function proteins with a higher affinity for DNA (11, 13, 16). These data suggest the Rad51 filament formed in rad55 and rad57 mutants is incomplete or less stable, and this impediment can be overcome by increasing the pool of free Rad51 or creating a more stable presynaptic filament. Because of the similarity in phenotype between rad51-K191R and rad55 (or rad57), we suspect the Rad51-K191R filament to be incomplete or less stable than Rad51. In vitro, we observed slightly reduced DNA binding to ssDNA by the Rad51-K191R protein compared with results for Rad51, and formation of Rad51-K191R-ssDNA complexes was sensitive to high salt levels (Fig. 7). The defect in ssDNA binding could be the result of a lower affinity of the Rad51-K191R protein for ATP (W. D. Heyer, personal communication). Although formation of Rad51-K191R DNA complexes is sensitive to high salt levels, once formed the complexes show greater stability than those formed by wild-type Rad51 (W. D. Heyer, personal communication). In one study, the human Rad51-K133R protein was reported to show slightly reduced binding to DNA (30), but in a more recent article, the human Rad51-K133R protein demonstrated binding affinity similar to that of wild-type Rad51 and was shown to form more stable complexes with DNA than was observed for wild-type Rad51 (8). Furthermore, the human Rad51 protein forms very stable DNA complexes when ATP hydrolysis is inhibited by Ca2+ ions or the nonhydrolyzable ATP analog, AMP-PNP (8, 40). Binding of yeast Rad51 to ssDNA is not supported by AMP-PNP or stimulated by Ca2+ indicating distinct differences between the yeast and human proteins (4, 31). The in vitro ssDNA-binding defect observed for yeast Rad51-K191R could result in reduced recruitment of the mutant protein to break sites in vivo and is consistent with the suppression by srs2 or by overexpression of the rad51-K191R allele. However, the observation of a semidominant phenotype for the rad51-K191R allele when expressed in diploids suggests that the DNA recombination defect is not due simply to less-efficient recruitment of Rad51-K191R at break sites, and there is an additional impediment that results from a lack of ATP hydrolysis. Because the human Rad51-K133R and yeast Rad51-K191R proteins form more stable complexes with DNA (8) (W. D. Heyer, personal communication), it is possible that the dominant-negative phenotype observed for yeast and mouse cells results from poor turnover of the mixed filament after strand invasion. Removal of Srs2 results in an almost complete suppression of the rad51-K191R phenotype (Fig. 3A and 5), and this could result from a reduced pool of free Rad51-K191R due to a defect in turnover of the mutant protein. Srs2 only displaces Rad51 from ssDNA (19, 60); therefore, we interpret the suppression by srs2 as stabilization of the Rad51-K191R-ssDNA filament rather than increasing the pool of free Rad51-K191R by mobilization from dsDNA.
Another possible explanation for the similarity in phenotype of the rad51-K191R and rad55 or rad57 mutants is that Rad55 and Rad57 promote ATP hydrolysis by Rad51. The human Xrcc2 protein enhances ADP/ATP processing by human Rad51, resulting in more-efficient strand exchange (44). Although no stimulation of Rad51 ssDNA binding by Xrcc2 was observed, the Rad51 filament might be more dynamic in vivo, requiring multiple cycles of binding and release in order to form an active presynaptic filament. By this scenario, the dominant-negative effect might be due to trapping of the wild-type protein with Rad51-K191R in unproductive partial filaments that are unable to undergo the necessary cycles of binding and release to create the active filament.
Previously, we found the IR sensitivity of the rad51-K191R mutant to be suppressed by RAD54 in high copy number (29), and in this study we determined that the suppression requires Rad54 ATPase activity (Fig. 1). Because high-copy-number expression of the rad54-K341R allele failed to suppress the IR sensitivity of the rad51-K191R strain, it seems unlikely that the Rad54 suppressive effect is in stabilization of the Rad51-K191R filament. Indeed, we found that Rad54 overexpression cannot rescue the reduction in brightness of Rad51-K191R-YFP foci (data not shown). The failure to restore normal YFP-Rad51-K191R foci argues against a stabilization role by Rad54 overexpression and also is inconsistent with mobilizing Rad51-K191R bound to dsDNA. We had expected the Rad51-K191R protein to show a greater association with non-DSB-site DNA by ChIP if it was trapped on chromatin due to decreased turnover, but this was not observed. Although we cannot rule out the possibility that overexpression of Rad54 mobilizes Rad51-K191R from dsDNA to increase the protomer pool available for ssDNA binding, we currently have no evidence in support of this hypothesis. A recent study showed accumulation of the meiosis-specific RecA homolog, Dmc1, on chromatin in rdh54/tid1 mutants consistent with a role for Rdh54/Tid1 (a homolog of Rad54) in maintaining a pool of Dmc1 protomers by disruption of unproductive associations of Dmc1 with dsDNA (14). Like Rad54, Rdh54/Tid1 disrupts Rad51-dsDNA complexes in vitro and stimulates the strand exchange activity of Rad51 (7, 35). High-copy-number expression of RDH54 resulted in a weak suppression of the IR sensitivity of the rad51-K191R strain, but the suppression was much less than observed for high-copy-number RAD54 (data not shown). Rad54 has been shown to enhance Rad51-mediated strand exchange under suboptimal conditions, and it is possible that additional Rad54 supports strand exchange for the suboptimal Rad51-K191R filament, resulting in the observed suppression (59).
In summary, the recombination defect conferred by the rad51-K191R allele appears to be due to inefficient presynaptic filament formation. This defect can be suppressed by removal of the Srs2 helicase, overexpression of Rad54, or by overexpression of the mutant protein. Increased stability of Rad51-K191R-DNA complexes could prevent turnover of the protein, resulting in a reduced pool of free Rad51-K191R for binding to ssDNA generated at DSBs. Alternatively, the filament formed by Rad51-K191R could be qualitatively different from the filament formed by wild-type Rad51 and unable to undergo the necessary structural transitions to form a competent presynaptic filament.
This research was supported by Public Health Service grants GM054099 (L.S.S.), T32 GM08224 (C.W.F.), and T32 CA09503 (G.S.F. and C.W.F.) from the National Institutes of Health.
Published ahead of print on 9 October 2006. ![]()
Supplemental material for this article may be found at
http://mcb.asm.org/. ![]()
Present
address: Abbott Laboratories, Inc., 2201 Pennsylvania Avenue, Rm. 1103,
Philadelphia, PA 19130. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»