| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Nutritional Sciences, College of Agriculture and Life Sciences, Cornell University, Ithaca, New York 14853,1 Roswell Park Cancer Institute, Buffalo, New York 142632
Received 11 January 2006/ Returned for modification 13 February 2006/ Accepted 25 September 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Rasgrf1 is one of the few loci at which the cis-acting DNA sequences controlling establishment of germ line DNA methylation have been described previously. Transgenic studies showed that sequences from Igf2r (2) and Snrpn (1, 15) may control establishment of maternal allele methylation. However, the role of the Igfr2 sequences in the germ line or at the endogenous locus is unknown. Similarly, the importance of the Snrpn sequences at the endogenous locus has not been tested. In gene targeting experiments in which the mouse Snrpn imprinting center was replaced by orthologous sequences from human SNRPN, results showed that the human sequences on the maternal mouse chromosome enabled establishment of maternal methylation in oocytes; however, methylation was not maintained in somatic tissue (12). This suggested that sequences important for methylation establishment on the maternal allele of Snrpn are conserved between mice and humans; however, the human sequences lack features present in the mouse that are needed for methylation maintenance. The dichotomy between mechanisms controlling methylation establishment and maintenance was also demonstrated at H19. Promoter-proximal sequences that acquired DNA methylation in the paternal germ line did not require all sequences within the DMD for their establishment; however, an intact DMD was needed for efficient maintenance of these marks (35, 36). Also, methylation that spread from the DMD to the paternal promoter in zygotes required the DMD for its maintenance in more-differentiated tissue (35). In transgenic mice with a 100-kbp human H19 transgene, germ line DNA methylation was properly established, but it was not maintained in somatic tissue (13). A negatively acting signal that includes CTCF binding sites at the endogenous H19 locus maintains the maternal allele in an unmethylated state (26, 29). A comparable negative signal from Snrpn may maintain the paternal allele in the unmethylated state (16), but its activity at the endogenous locus is not known.
The relationship between mechanisms that establish and maintain DMD methylation remains unknown. Although we showed that the Rasgrf1 repeats regulate establishment of DNA methylation in the male germ line (40), nothing is known about their role, if any, in maintaining methylation during somatic development. To address this question, we designed a conditional deletion of the repeats by flanking the repeat sequence at Rasgrf1 with LoxP sites. By crossing these mice with various cre transgenics to delete the repeats, we identified distinct roles for the repeats at different times during development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-R, were produced by Gail Martin (19) and provided, with her permission, by Barbara Knowles. Other cre transgenics were from Jackson Laboratories (stock numbers 003771, 003574, and 003755). All mice were maintained on a C57BL/6 background, except for allelic expression analysis, where F1 mice from a C57BL/6 and PWK cross were used (see Fig. 2c only). Primers for DNA analysis were P1 (ATGATTGAACAGATGGATTGCAC), P2 (TTCGTCCAGATCATCCTGATCGAC), P3 (CTGCACCGCTGCCGCTAAGC), P4 (CCTGCAGGTCGACATAACTTC), P5 (GCACTTCGCTACCGTTTCGC), P6 (TTTCTGCCATCATCCCAGCC), P7 (TGTCCTCCACCCCTCCACC), P10 (ATACTTTCTCGGCAGGAGCA), P11 (GGGTGGGCTTTGAGTGTTTA), Timp1F (GTCATAAGGGCTAAATTCATGGG), and Timp1R (ACTCTTCACTGCGGTTCTGGGAC).
|
Methylation analysis. We used proteinase K to extract genomic DNA from tail, neonatal brain, liver, sperm, and preimplantation embryos and included glycogen (15 µg) to precipitate the embryonic DNAs. Methylation analysis of the DMD using restriction enzymes was as previously described (40). Primers used, in addition to those described above, were PGKF (CTTTGCTCCTTCGCTTTCTG) and PGKR (ACGTCCAGCTTGTCCAAAGT). Bisulfite sequencing was carried out as described previously (10) with some modifications, using fresh solutions. Briefly, we denatured 1.0 µg of DNA in 50 µl Tris-EDTA by adding 5 µl 3 M NaOH and incubating the mixture at 37°C for 10 min. After adding 30 µl 10 mM hydroquinone and 510 µl 3.9 M sodium bisulfite, we allowed deamination to proceed at 55°C for 16 h. We purified treated DNA using a QIAquick gel extraction kit according to the manufacturer's instructions (QIAGEN) and eluted DNA from the kit column in 50 µl elution buffer. The bisulfite reaction was completed by adding 5 µl 3 M NaOH and incubating the mixture at room temperature for 5 min. We purified DNA again using a QIAquick gel extraction kit and eluted it in 30 µl. For PCR, we amplified 1 µl of DNA using primers MF (GAGTATGTAAAGTTAGAGTT) and MR (ATAAACTACTACAACAACTT) for 40 cycles, gel purified all PCR products, and then cloned them using the Topo pCR2.1 cloning kit (Invitrogen). Clones with the correct insert size were sequenced using M13F and M13R primers. Embryonic bisulfite DNAs were amplified with a nested PCR. First-round primers used were MF (as above) and nMR (ACTATCCTCCACCCCTCCAC); a second round of PCR used MF and MR.
| RESULTS |
|---|
|
|
|---|
|
|
-R. The transgenes that we used express cre in different tissues at different developmental times and included Zp3-cre (oocytes [19]), Meox2-cre (embryonic ectoderm of the day 5.5 [e5.5] epiblast [34]), Nestin-cre (e11 central nervous system [7]), and Albumin-cre (by postpartum day 1 [P1] liver [27]). To confirm that the maternal cre deleted the paternal repeats in the progeny of these crosses, we used a PCR assay that detected the recombination product (Fig. 1d) and Southern blot assays that distinguished the wild-type and mutated alleles, both recombined (
-R) and unrecombined (flox-R) (Fig. 3). The sources of DNAs for these tests were the tails of neonatal progeny of Zp3-cre and Meox2-cre females and brain and liver, respectively, for progeny of Nestin-cre and Albumin-cre females. Each cre transgene was able to delete the repeats in the tissues tested with efficiencies ranging from virtually 100% for Zp3- and Nestin-cre to approximately 90% and 20% for Meox2-cre and Albumin-cre, respectively (Fig. 1d and 3).
Our Southern blot assays used NotI- and BanII-digested DNAs. Unlike PstI digestion, this combination allowed us to differentiate, in mosaic animals, alleles with excised repeats (
-R) from those that cre failed to touch (flox-R). At the same time, this digest evaluated the methylation status of the NotI site. BanII digestion alone produces a 10-kbp wild-type band and a 5.6-kbp mutant band in mice carrying the
-R allele. Further digestion with NotI will present a 5.4-kbp band in the absence of methylation (Fig. 1 and 3). In DNAs from progeny of Zp3-cre dams and flox-R sires, both the 10-kbp maternal and the 5.6-kbp paternal bands were digested to 5.4 kbp by NotI. This indicated that the paternal allele methylation that had been established on the flox-R allele (Fig. 2a) could not be maintained in neonates after Zp3-cre-mediated recombination converted it to the repeat-deficient
-R allele in the zygote (Fig. 3a). This implicates the repeats as playing a role in methylation maintenance as well as in methylation establishment as we previously showed (40). In sharp contrast, when maternal cre deleted the paternal repeats at later times in the epiblast, central nervous system, or postpartum liver as directed by the Meox2-cre, Nestin-cre, or Albumin-cre transgenes, respectively, the
-R allele consistently maintained a high level of methylation (Fig. 3a). This indicated that the role of the Rasgrf1 repeats in DNA methylation maintenance depends on the developmental stage of the embryo.
We extended our methylation analysis beyond the NotI site detected by Southern blots to the HhaI sites in the DMD by using a methylation-sensitive PCR assay. DNAs used in Southern blot assays shown in Fig. 3a were digested with the methylation-sensitive enzyme HhaI or left undigested and then amplified with primers that were specific for the
-R allele. HhaI digestion prevented any detectable amplification when assays were done using DNA from progeny of Zp3-cre females, but amplification products were readily detected in DNAs from other cre transgenic females (Fig. 3b). This was consistent with the Southern blot results and showed that additional CpGs in the DMD failed to maintain methylation after the repeats were deleted in the zygote.
Finally, we confirmed the Southern and PCR results with bisulfite sequencing (Fig. 3c). As predicted from the restriction analysis (Fig. 3a and b), repeat-deficient DNAs from progeny of the Zp3-cre cross had lost virtually all their DMD methylation from the paternal allele while DNAs from progeny of the Meox2-cre and Nestin-cre crosses had maintained virtually all of their methylation (Fig. 3c). This further confirmed our previous observations that the methylation states of the NotI and HhaI sites accurately predict the methylation status of at least 26 CpGs in the DMD (9, 40).
Our interpretation of these data is that not only are the Rasgrf1 repeats required for establishing DNA methylation at the paternal DMD in the male germ line as we previously showed (40) and they are also required to maintain the established methylation after fertilization. Furthermore, the interval between fertilization and the epiblast stage is the critical period when the repeats must be present in cis for maintaining paternal allele methylation at Rasgrf1 in mice. The shared requirement for the repeats during methylation establishment and maintenance suggests that a common mechanism is used for the two processes at Rasgrf1.
Loss of methylation maintenance silences Rasgrf1. To evaluate the effects of the cre-mediated deletions on Rasgrf1 expression, we performed real-time RT-PCR using neonatal brain cDNAs from progeny of the Zp3-, Meox2-, and Nestin-cre crosses. Rasgrf1 is not expressed in liver or in early embryos, and so progeny of the Albumin-cre crosses and preimplantation embryos were not analyzed. We detected wild-type levels of Rasgrf1 RNA in progeny of the Meox2- and Nestin-cre crosses that maintained DMD methylation and markedly reduced levels in Zp3-cre progeny that lost DMD methylation (Fig. 3d). This was consistent with our previous data showing that DMD methylation is needed for expression of Rasgrf1 in neonatal brain (9, 40). Loss of imprinted expression in neonates did not produce overt developmental changes.
The critical interval for methylation maintenance is between fertilization and the epiblast stage.
Our methylation analysis of the
-R allele in progeny of Zp3-cre dams and flox-R sires was done using tissue taken from neonates. The lack of
-R allele methylation in these mice may have been due to a gradual loss of methylation between fertilization, the earliest time when the deletion could occur, and the perinatal period, when tissues for methylation assays were taken. Alternatively, there may have been a rapid loss of methylation immediately after repeat deletion and prior to implantation, a period when the genome undergoes extensive global changes in the methylation state (14, 22, 23, 25, 28). These are not mutually exclusive possibilities. To determine how quickly methylation could be lost from the
-R allele after being formed by zygotic cre, we examined the methylation states of DNAs from two-cell, four-cell, morula-, and blastocyst-stage embryos isolated from Zp3-cre transgenic dams that were mated with flox-R sires. The sires had normal methylation at their flox-R allele (not shown). We used a restriction enzyme-based assay (Fig. 4a) and bisulfite PCR (Fig. 4c). Both assays showed that loss of methylation could occur on the
-R allele as soon as the two-cell stage. However, two- and four-cell embryos also provided evidence of full methylation on the
-R allele, raising the possibility that failure of methylation maintenance was by a passive mechanism. By the morula and blastocyst stages, loss of methylation from the
-R allele was nearly complete. All embryonic stages assayed were mosaic for the recombined
-R and unrecombined flox-R allele, allowing us to monitor flox-R methylation. Importantly, the unrecombined allele remained methylated, presumably because of the maintenance function provided by the still-present repeats. Methylation of the paternal flox-R allele was also present in two- and four-cell embryos taken from wild-type female dams (Fig. 4c). Only the
-R allele, without repeats, failed to maintain the methylation that had been established in the paternal germ line.
|
| DISCUSSION |
|---|
|
|
|---|
The paternal flox-R allele was detected in blastocysts taken from Zp3-cre females, indicating that zygotic cre had not completely converted the flox-R allele to the
-R form at that stage. But by the end of gestation, we saw no mosaicism by PCR (Fig. 1d) or Southern blotting (Fig. 3a). We also saw no evidence of remaining DNA methylation at the end of gestation (Fig. 3). This indicates that failure of maintenance occurred if repeats were removed after the blastocyst stage. However, removing the repeats at the epiblast stage was not sufficient to disrupt methylation.
Our results are comparable to those showing that the paternal DMD at H19 is needed in the zygote for expansion of its germ line methylation mark into the promoter region but is dispensable in differentiated somatic tissue for maintenance of the expanded methylation (31, 32). However, unlike the Rasgrf1 repeats, the H19 DMD is not required for establishing methylation at the H19 promoter (35).
How the Rasgrf1 repeats regulate epigenetic programming at the locus either during establishment in the male germ line or during maintenance in the early embryo is unknown. The mechanism differs from those apparently operating at other imprinted loci because the same repeated sequences regulate both processes at Rasgrf1. Regulation by the repeats may involve small RNAs of the kind that can direct DNA methylation in plant and mammalian systems (17, 24, 38) and histone modifications in Schizosaccharomyces pombe (8, 37). Additionally, the repeats may attract chromatin-modifying (18) or remodeling (6) factors or other unknown components that, in turn, influence DMD methylation. None of these possibilities is mutually exclusive. It is not known how well mechanisms regulating epigenetic programming at imprinted loci reflect mechanisms operating at nonimprinted loci. It is clear, however, that imprinted loci undergo reprogramming failure in animals prepared by somatic cell nuclear transfer to eggs which may contribute to abnormal growth phenotypes of cloned animals (11). Understanding the mechanisms that regulate the epigenetic state may help to minimize epigenetic perturbations in manipulated embryos.
| ACKNOWLEDGMENTS |
|---|
This work was supported by grants to P.D.S. from the National Cancer Institute, the National Eye Institute, and the U.S. Army and by a Cancer Center Support Grant to Roswell Park Cancer Institute.
| FOOTNOTES |
|---|
Published ahead of print on 9 October 2006. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Birger, Y., R. Shemer, J. Perk, and A. Razin. 1999. The imprinting box of the mouse Igf2r gene. Nature 397:84-88.[CrossRef][Medline]
3. Brandeis, M., T. Kafri, M. Ariel, J. R. Chaillet, J. McCarrey, A. Razin, and H. Cedar. 1993. The ontogeny of allele-specific methylation associated with imprinted genes in the mouse. EMBO J. 12:3669-3677.[Medline]
5. Farley, F. W., P. Soriano, L. S. Steffen, and S. M. Dymecki. 2000. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 28:106-110.[CrossRef][Medline]
6. Gibbons, R. J., T. L. McDowell, S. Raman, D. M. O'Rourke, D. Garrick, H. Ayyub, and D. R. Higgs. 2000. Mutations in ATRX, encoding a SWI/SNF-like protein, cause diverse changes in the pattern of DNA methylation. Nat. Genet. 24:368-371.[CrossRef][Medline]
7. Haigh, J. J., P. I. Morelli, H. Gerhardt, K. Haigh, J. Tsien, A. Damert, L. Miquerol, U. Muhlner, R. Klein, N. Ferrara, E. F. Wagner, C. Betsholtz, and A. Nagy. 2003. Cortical and retinal defects caused by dosage-dependent reductions in VEGF-A paracrine signaling. Dev. Biol. 262:225-241.[CrossRef][Medline]
8. Hall, I. M., G. D. Shankaranarayana, K. Noma, N. Ayoub, A. Cohen, and S. I. Grewal. 2002. Establishment and maintenance of a heterochromatin domain. Science 297:2232-2237.
9. Herman, H., M. Lu, M. Anggraini, A. Sikora, Y. Chang, B. J. Yoon, and P. D. Soloway. 2003. Trans allele methylation and paramutation-like effects in mice. Nat. Genet. 34:199-202.[CrossRef][Medline]
10. Herman, J. G., J. R. Graff, S. Myohanen, B. D. Nelkin, and S. B. Baylin. 1996. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA 93:9821-9826.
11. Humpherys, D., K. Eggan, H. Akutsu, A. Friedman, K. Hochedlinger, R. Yanagimachi, E. S. Lander, T. R. Golub, and R. Jaenisch. 2002. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc. Natl. Acad. Sci. USA 99:12889-12894.
12. Johnstone, K. A., A. J. Dubose, C. R. Futtner, M. D. Elmore, C. I. Brannan, and J. L. Resnick. 2006. A human imprinting centre demonstrates conserved acquisition but diverged maintenance of imprinting in a mouse model for Angelman syndrome imprinting defects. Hum. Mol. Genet. 15:393-404.
13. Jones, B. K., J. Levorse, and S. M. Tilghman. 2002. A human H19 transgene exhibits impaired paternal-specific imprint acquisition and maintenance in mice. Hum. Mol. Genet. 11:411-418.
14. Kafri, T., M. Ariel, M. Brandeis, R. Shemer, L. Urven, J. McCarrey, H. Cedar, and A. Razin. 1992. Developmental pattern of gene-specific DNA methylation in the mouse embryo and germ line. Genes Dev. 6:705-714.
15. Kantor, B., Y. Kaufman, K. Makedonski, A. Razin, and R. Shemer. 2004. Establishing the epigenetic status of the Prader-Willi/Angelman imprinting center in the gametes and embryo. Hum. Mol. Genet. 13:2767-2779.
16. Kantor, B., K. Makedonski, Y. Green-Finberg, R. Shemer, and A. Razin. 2004. Control elements within the PWS/AS imprinting box and their function in the imprinting process. Hum. Mol. Genet. 13:751-762.
17. Kawasaki, H., and K. Taira. 2004. Induction of DNA methylation and gene silencing by short interfering RNAs in human cells. Nature 431:211-217.[CrossRef][Medline]
18. Lehnertz, B., Y. Ueda, A. A. Derijck, U. Braunschweig, L. Perez-Burgos, S. Kubicek, T. Chen, E. Li, T. Jenuwein, and A. H. Peters. 2003. Suv39h-mediated histone H3 lysine 9 methylation directs DNA methylation to major satellite repeats at pericentric heterochromatin. Curr. Biol. 13:1192-1200.[CrossRef][Medline]
19. Lewandoski, M., K. M. Wassarman, and G. R. Martin. 1997. Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. Curr. Biol. 7:148-151.[CrossRef][Medline]
21. Li, J. Y., D. J. Lees-Murdock, G. L. Xu, and C. P. Walsh. 2004. Timing of establishment of paternal methylation imprints in the mouse. Genomics 84:952-960.[CrossRef][Medline]
22. Mayer, W., A. Niveleau, J. Walter, R. Fundele, and T. Haaf. 2000. Demethylation of the zygotic paternal genome. Nature 403:501-502.[Medline]
23. Monk, M., M. Boubelik, and S. Lehnert. 1987. Temporal and regional changes in DNA methylation in the embryonic, extraembryonic and germ cell lineages during mouse embryo development. Development 99:371-382.[Abstract]
24. Morris, K. V., S. W. Chan, S. E. Jacobsen, and D. J. Looney. 2004. Small interfering RNA-induced transcriptional gene silencing in human cells. Science 305:1289-1292.
25. Oswald, J., S. Engemann, N. Lane, W. Mayer, A. Olek, R. Fundele, W. Dean, W. Reik, and J. Walter. 2000. Active demethylation of the paternal genome in the mouse zygote. Curr. Biol. 10:475-478.[CrossRef][Medline]
26. Pant, V., S. Kurukuti, E. Pugacheva, S. Shamsuddin, P. Mariano, R. Renkawitz, E. Klenova, V. Lobanenkov, and R. Ohlsson. 2004. Mutation of a single CTCF target site within the H19 imprinting control region leads to loss of Igf2 imprinting and complex patterns of de novo methylation upon maternal inheritance. Mol. Cell. Biol. 24:3497-3504.
27. Postic, C., and M. A. Magnuson. 2000. DNA excision in liver by an albumin-Cre transgene occurs progressively with age. Genesis 26:149-150.[CrossRef][Medline]
28. Santos, F., B. Hendrich, W. Reik, and W. Dean. 2002. Dynamic reprogramming of DNA methylation in the early mouse embryo. Dev. Biol. 241:172-182.[CrossRef][Medline]
29. Schoenherr, C. J., J. M. Levorse, and S. M. Tilghman. 2003. CTCF maintains differential methylation at the Igf2/H19 locus. Nat. Genet. 33:66-69.[CrossRef][Medline]
30. Shibata, H., Y. Yoda, R. Kato, T. Ueda, M. Kamiya, N. Hiraiwa, A. Yoshiki, C. Plass, R. S. Pearsall, W. A. Held, M. Muramatsu, H. Sasaki, M. Kusakabe, and Y. Hayashizaki. 1998. A methylation imprint mark in the mouse imprinted gene Grf1/Cdc25Mm locus shares a common feature with the U2afbp-rs gene: an association with a short tandem repeat and a hypermethylated region. Genomics 49:30-37.[CrossRef][Medline]
31. Srivastava, M., E. Frolova, B. Rottinghaus, S. P. Boe, A. Grinberg, E. Lee, P. E. Love, and K. Pfeifer. 2003. Imprint control element-mediated secondary methylation imprints at the Igf2/H19 locus. J. Biol. Chem. 278:5977-5983.
32. Srivastava, M., S. Hsieh, A. Grinberg, L. Williams-Simons, S. P. Huang, and K. Pfeifer. 2000. H19 and Igf2 monoallelic expression is regulated in two distinct ways by a shared cis acting regulatory region upstream of H19. Genes Dev. 14:1186-1195.
33. Stoger, R., P. Kubicka, C. G. Liu, T. Kafri, A. Razin, H. Cedar, and D. P. Barlow. 1993. Maternal-specific methylation of the imprinted mouse Igf2r locus identifies the expressed locus as carrying the imprinting signal. Cell 73:61-71.[CrossRef][Medline]
34. Tallquist, M. D., and P. Soriano. 2000. Epiblast-restricted Cre expression in MORE mice: a tool to distinguish embryonic vs. extra-embryonic gene function. Genesis 26:113-115.[CrossRef][Medline]
35. Thorvaldsen, J. L., K. L. Duran, and M. S. Bartolomei. 1998. Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev. 12:3693-3702.
36. Thorvaldsen, J. L., A. M. Fedoriw, S. Nguyen, and M. S. Bartolomei. 2006. Developmental profile of H19 differentially methylated domain (DMD) deletion alleles reveals multiple roles of the DMD in regulating allelic expression and DNA methylation at the imprinted H19/Igf2 locus. Mol. Cell. Biol. 26:1245-1258.
37. Volpe, T. A., C. Kidner, I. M. Hall, G. Teng, S. I. Grewal, and R. A. Martienssen. 2002. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297:1833-1837.
38. Wassenegger, M., S. Heimes, L. Riedel, and H. L. Sanger. 1994. RNA-directed de novo methylation of genomic sequences in plants. Cell 76:567-576.[CrossRef][Medline]
39. Yoon, B.-J., H. Herman, B. Hu, Y. J. Park, A. M. Lindroth, A. Bell, A. G. West, Y. Chang, A. Stablewski, J. C. Piel, D. I. Loukinov, V. Lobanenkov, and P. D. Soloway. 2005. Rasgrf1 imprinting is regulated by a CTCF-dependent methylation-sensitive enhancer blocker. Mol. Cell. Biol. 25:11184-11190.
40. Yoon, B. J., H. Herman, A. Sikora, L. T. Smith, C. Plass, and P. D. Soloway. 2002. Regulation of DNA methylation of Rasgrf1. Nat. Genet. 30:92-96.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|