MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, J.-H.
Right arrow Articles by Bai, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, J.-H.
Right arrow Articles by Bai, Y.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, February 2006, p. 1077-1086, Vol. 26, No. 3
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.3.1077-1086.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Nuclear Suppression of Mitochondrial Defects in Cells without the ND6 Subunit

Jian-Hong Deng, Youfen Li, Jeong Soon Park, Jun Wu, Peiqing Hu, James Lechleiter, and Yidong Bai*

Department of Cellular and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229

Received 27 January 2005/ Returned for modification 23 June 2005/ Accepted 1 November 2005


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previously, we characterized a mouse cell line, 4A, carrying a mitochondrial DNA mutation in the subunit for respiratory complex I, NADH dehydrogenase, in the ND6 gene. This mutation abolished the complex I assembly and disrupted the respiratory function of complex I. We now report here that a galactose-resistant clone, 4AR, was isolated from the cells carrying the ND6 mutation. 4AR still contained the homoplasmic mutation, and apparently there was no ND6 protein synthesis, whereas the assembly of other complex I subunits into complex I was recovered. Furthermore, the respiratory activity and mitochondrial membrane potential were fully recovered. To investigate the genetic origin of this compensation, the mitochondrial DNA (mtDNA) from 4AR was transferred to a new nuclear background. The transmitochondrial lines failed to grow in galactose medium. We further transferred mtDNA with a nonsense mutation at the ND5 gene to the 4AR nuclear background, and a suppression for mitochondrial deficiency was observed. Our results suggest that change(s) in the expression of a certain nucleus-encoded factor(s) can compensate for the absence of the ND6 or ND5 subunit.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The mammalian respiratory NADH-ubiquinone oxidoreductase (complex I) is the largest and least understood component of the mitochondrial oxidative phosphorylation system (35, 50). Located in the inner mitochondrial membrane, complex I is the major entry point for electrons to get into the respiratory chain. It couples electron transfer with the translocation of protons across the membrane, generating a proton gradient that is essential for ATP synthesis. Mammalian complex I consists of about 46 subunits, and seven of them—designated ND1, -2, -3, -4, -4L, -5, and -6—are encoded by mitochondrial DNA (mtDNA) (12, 23). A series of biochemical, electron microscopic, and functional investigations have led to a model of the structure of complex I in Neurospora crassa, which contains 32 subunits (17, 20, 26, 53). It is suggested to have an L-shaped structure consisting two complementary moieties: one membrane domain and a peripheral arm protruding to the matrix space. Since mammalian complex I has a subunit composition similar to that of the Neurospora enzyme, the L-shaped structure is considered to approximate the mammalian complex I structure as well (18, 19). All of the mtDNA-encoded hydrophobic subunits are located in membrane arm, whereas the catalytic center is on the matrix arm.

Over the last 17 years, large numbers of mtDNA mutations have been associated with various human diseases (14, 51). In particular, mutations in the ND1, ND4 and ND6 genes, encoding subunits of complex I, with resulting complex I deficiency, have been reported to play a causative role in the development of Leber's hereditary optic neuropathy (LHON) (28, 30, 52) or LHON and dystonia (31). As the most frequently observed respiratory enzyme defect, complex I deficiency has been also associated with Leigh syndrome, fatal infantile lactic acidosis, macrocephaly with progressive leukodystrophy, encephalomyopathy, and neurodegenerative diseases such as Parkinson's disease (35, 43, 50, 55).

Based on the selection on resistant cell lines to a complex I respiration inhibitor, rotenone, we previously isolated a mouse A9 cell derivative, 4A, defective in NADH dehydrogenase activity (2). This cell carries a near-homoplasmic frameshift mutation in the mtDNA gene for the ND6 subunit resulting in the absence of this protein. The cotransfer of the mtDNA from the 4A cells with the mitochondrial defects pointed to the pure mitochondrial genetic origin for the dysfunction. Further characterization revealed a loss of assembly of the mtDNA-encoded subunits of the enzyme. As an indication of serious impairment in oxidative phosphorylation, in contrast to the A9 cell, the 4A cell failed to grow in a medium containing galactose instead of glucose.

We isolated here a spontaneous revertant of the 4A cell containing homoplasmic levels of the mtDNA mutation that had regained apparently normal mitochondrial function. The assembly of other subunits into complex I, as revealed by pulse-chase experiment and blue native gel analysis, was restored in the revertant cells in the absence of ND6 protein synthesis, and mitochondrial membrane potential, which is essential for functional mitochondria, was also recovered. This restoration in mitochondrial function was further shown to associate with a change (changes) in the nuclear background which could also suppress the defects caused by an ND5 mutation.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines and media. All of the cell lines used in the present study were grown in monolayer culture. The cell line A9 (ATCC CCL-1.4) is a derivative of the L mouse fibroblast cell line. It was grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS). The rotenone-resistant clone 4A carrying the ND6 mutation was derived from A9 (2). It was grown in the above medium supplemented with 1.2 µM rotenone. The mtDNA-less [rho0] LL/2-m21 cell line, a derivative of mouse cell line LL/2 (5) (ATCC CRL-1642), was grown in DMEM supplemented with 10% FCS and 50 µg of uridine per ml. 3A20-4 is a cell line containing an ND5 mutation (5).

DNA analysis. For mtDNA sequencing, total DNA samples were isolated from cells with a QIAamp DNA Minikit (QIAGEN, Inc.) and then subjected to PCR amplification of the ND6 gene using the primers ND6-5'-1 and ND6-3'-1 (see below). DNA sequencing of the purified product was carried out using the primers ND6-5'-2 and ND6-3'-2 (see below).

Quantification of the ND6 frameshifting mutation (a C insertion in a row of six C residues at positions 13886 to 13891) was carried out by allele-specific termination of primer extension (24). For this purpose, the PCR-amplified fragments were used as templates, and the 5'-end 32P-labeled ND6PE oligodeoxynucleotide (see below) was used as a primer in a 1:1 molar ratio. Nucleoside triphosphate concentrations were 100 µM for dCTP and 300 µM for ddTTP. The mixtures were heated to 95°C for 3 min and then cooled to 45°C for 5 min, to 37°C for 10 min, and finally chilled on ice. After addition of 1 µl of 1:8 diluted Sequenase (USB Corp.), the mixtures were incubated at 45°C for 5 min. The reaction products were denatured and separated on a 50-cm-long 20% polyacrylamide-6 M urea gel. Quantification of the intensity of the bands was done by using a PhosphorImager (Molecular Dynamics) and the ImageQuant program.

Quantification of the ND5 mutation (a C-to-A point mutation, which destroys a ClaI site) was carried out by analysis of the products of a restriction digestion reaction. For this purpose, a 464-bp fragment of the ND5 gene was amplified by PCR with the primers ND5-5'-2 and ND5-3'-4 in a 50-µl volume. A 5-µl sample of the final PCR mixture was then subjected to ClaI digestion (5 U) in a 20-µl reaction volume at 37°C overnight. Under these conditions, the wild-type ND5 fragment was cut into two small fragments of 296 and 168 bp, whereas the mutant ND5 fragment remained intact. A 5-µl sample of the above-described reaction mixture was subsequently electrophoresed on a 3% agarose gel.

The sequences of the primers used in the present study were as follows: ND6-5'-1 (positions 13452 to 13473; CACACAAACATAACCACTTTAACA), ND6-3'-1 (positions 14209 to 14188; GTAGGTCAATGAATGAGTGGTT), ND6-5'-2 (positions 13503 to 13527; CTTTATATCATTCCTAATTAACATC), ND6-3'-2 (positions 14172 to 14150; TGGGTGTGTTTTTCGTATGTTTG), ND6PE (positions 13862 to 13885; CGTATATCCAAACACAACCAACAT), ND5-5'-2 (positions 11792 to 11809; CCCCAATCCTAATTTCAA), and ND5-3'-4 (positions 12255 to 12238; TGCTTGTAGGGCTGCAGT).

Mitochondrial protein synthesis. To measure the rate of mitochondrial protein synthesis, pulse-labeling experiments with [35S]methionine were performed according to a protocol described previously (11). Samples of 2 x 106 cells of the desired type were plated on 10-cm dishes, incubated overnight, washed with methionine-free DMEM, and then incubated for 7 min at 37°C in 4 ml of the same medium containing 100 µg of the cytoplasmic translational inhibitor emetine/ml. Thereafter, [35S]methionine (0.2 mCi [1,175 Ci/mmol]) was added, and the cells were incubated for 30 to 60 min. To test the stability of the mitochondrial translation products, pulse-chase labeling experiments were performed (11). Samples of 2 x 106 cells were plated on 10-cm dishes and grown for overnight. Labeling was carried out as described above, except that emetine was replaced with cycloheximide, and the incubation time with [35S]methionine was extended to 2 h; thereafter, the cells were washed and subjected to a 19-h chase in complete unlabeled medium in the absence of cycloheximide to allow incorporation of the labeled mtDNA-encoded subunits into the complexes. The labeled cells were treated with trypsin, washed and lysed in 1% sodium dodecyl sulfate (SDS). Samples containing 30 to 50 µg of protein were electrophoresed through an SDS-polyacrylamide gel (15 to 20% exponential gradient).

Blue native gel electrophoresis. Complex I assembly analysis was carried out by blue native gel electrophoresis. Mitochondria were isolated according to procedures described previously (11). After three washes in 130 mM NaCl, 5 mM KCl, and 1 mM MgCl2, the cells were incubated for 3 min in 10 mM Tris-HCl (pH 6.7), 10 mM KCl, and 1.5 x 10–4 M MgCl2 and processed in a Potter-Elvehjem homogenizer with a rotating pestle until ~80% of the cells were broken. The homogenate was then brought to 0.25 M sucrose and centrifuged for 5 min at 1,200 x g to remove large debris and nuclei. The mitochondria were collected by centrifugation for 10 min at 8,000 x g and washed in 0.25 M sucrose, 10 mM Tris-HCl (pH 6.7), and 1.5 x 10–4 M MgCl2. The mitochondrion protein concentration was measured by the Bradford method. The gels were run for 30 min at 40 V and then at 80 V until the dye reached the end of the gel. For the in-gel staining assay, 0.1 mg of NADH and 2.5 mg of NTB (nitrotetrazolium blue)/ml in 2 mM Tris-HCl was used to incubate the gel for 3 h. For Western blotting and immunodetection, antibodies to GRIM-19, MS103 (Mitosciences) for complex I, and MS502 (Mitosciences) for complex V were utilized. The Western blot was carried out according to the protocol provided by Mitoscience.

O2 consumption measurements. The fresh medium was replaced the day before the measurements. Determination of the O2 consumption rate in intact cells was carried out on ~5 x 106 cells in Tris-based, Mg2+/Ca2+-deficient (TD) buffer (0.137 M NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 25 mM Tris-HCl [pH 7.4] at 25°C) as previously described (2). For measurements of complex-dependent O2 consumption rate in digitonin-permeabilized cells (25), about 5 x 106 cells were resuspended in 1 ml of buffer (20 mM HEPES [pH 7.1], 10 mM MgCl2, 250 mM sucrose), and then 100 µg of digitonin (1 µl of a 10% solution in dimethyl sulfoxide) in 1 ml of buffer was added. After incubation for 1 min at room temperature, the cell suspension was diluted with 8 ml of buffer. The cells were rapidly pelleted and resuspended in respiration buffer (20 mm HEPES [pH 7.1], 250 mM sucrose, 2 mM KH2PO4, 10 mM MgCl2, and 1.0 mM ADP). The measurements were carried out in two chambers of an YSI model 5300 Biological Oxygen Monitor. The substrates (adjusted to ~pH 7.0 with NaOH), and inhibitors were added with Hamilton syringes. The final concentrations were as follows: malate, 5 mM; glutamate, 5 mM; succinate, 5 mM; glycerol-3-phosphate, 5 mM; ascorbate, 10 mM; N,N,N',N'-tetramethyl-p-phenylenediamine (TMPD), 0.2 mM; NADH, 0.5 mM; rotenone, 100 nM; flavone, 0.5 mM; antimycin A, 20 nM; and KCN, 1 mM.

P/O ratio assay. The P/O ratio measurement was carried out in digitonin-permeabilized cells (48). Approximately 5 x 106 cells were permeabilized with 0.006% digitonin in assay buffer consisting of 75 mM sucrose, 5 mM KH2PO4, 40 mM KCl, 0.5 mM EDTA, 3 mM MgCl2, 30 mM Tris-HCl (pH 7.4), 0.3 mM P1,P5-di(adenosine-5') pentaphosphate (Sigma), and 0.32% (wt/vol) bovine serum albumin. Malate (5 mM) and glutamate (5 mM) were used as respiratory substrates. A total of 120 nmol of ADP was added.

Enzymatic assay. The activity of NADH:ubiquinone oxydoreductase (complex I) was assayed according to the protocol of Birch-Machin and Turnbull (6). We used 0.13 mM NADH and 65 µM ubiquinone in the presence of 2 mM KCN and 2 µg of antimycin A/ml as inhibitors for complexes IV and III. The complex I activity was measured by monitoring the decrease in absorbance due to the oxidation of NADH at 340 nm ({varepsilon} = 6.22 x 103 M–1 cm–1) in assay buffer by using a DU-640 spectrophotometer (Beckman Instruments). Similarly, complex III activity was measured by determining the reduction of cytochrome c(III) at 550 nm ({varepsilon} = 21 mM–1 cm–1) using D-ubiquinol-2 as an electron donor.

Growth measurements. Multiple identical samples of 2 x 104 to 2 x 105 cells (in different experiments) were grown for 7 days on 10-cm dishes in the appropriate medium (DMEM that contained 4.5 mg of glucose and 0.11 mg of pyruvate/ml or DMEM lacking glucose and containing 0.9 mg of galactose and 0.5 mg of pyruvate/ml [22], both supplemented with 10% dialyzed FCS) and counted on a daily basis. The resistance to rotenone was tested in the glucose medium supplemented with 1.2 µM rotenone. Both floating and attached cells were counted.

Mitochondrial membrane potential and proliferation analysis. Mitochondrial membrane potential was estimated as described previously (36). Images were acquired with a 1.45 x60-numerical-aperture, objective lens on the Nikon PCM2000 custom adapted for two-photon imaging. Tetramethyl rhodamine ethyl ester (TMRE) was excited at 800 nm by using a Ti-sapphire Coherent Mira 900 Laser pumped with a 5-W Verdi laser (Coherent, Inc., Santa Clara, CA). Images were analyzed with Image J (http://rsb.info.nih.gov/ij/).

Mitochondrion-mediated transformation. The mtDNA-less [rho0] LL/2-m21 cell line was isolated as described previously (5). 4AR [rho0] cells were obtained as described in the text. [rho0] cell transformation by cytoplast fusion was carried out as described previously (32) by fusing 4AR and 3A20-4 cells, which had been enucleated by centrifugation in the presence of cytochalasin B, with [rho0] LL/2-m21 and 4AR [rho0] cells, respectively, in the presence of 40% polyethylene glycol 1500 (BDH). Mitochondrial transformants of 4AR/LL/2 cells were isolated in DMEM supplemented with hypoxanthine-aminopterin-thymidine components and 10% dialyzed fetal bovine serum (FBS), and transformants of 3A20/4/4AR cells were isolated in DMEM supplemented with 10% FBS.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation and mtDNA sequencing confirmation of a cell line carrying a frameshift mutation at the ND6 gene with normal respiratory activity. In a medium where glucose was replaced by galactose as the carbon source, mammalian cells exclusively rely on mitochondrial oxidative phosphorylation for ATP production (4, 22, 39). We previously showed that 4A cells that carried a ND6 frameshift mutation failed to grow in galactose medium due to the severe impairment in mitochondrial function (2). As one of a series of efforts to restore mitochondrial function in cells with complex I deficiency, half of a million 4A cells were plated in a 10-cm dish and maintained in the galactose medium for 14 days. We found that five independent clones emerged, and we picked one, 4AR, for further analysis.

To exclude the possibility that 4AR was from segregation and repopulation of the residue wild-type mtDNA, sequencing analysis was carried out in the original A9 cells, 4A cells carrying the frameshift mutation and the revertant 4AR cells. As shown in Fig. 1A, 4AR keeps the same mutation as found in 4A cells. A more sensitive experiment, involving allele-specific termination of primer extension (24), was carried out to detect the potential low extent of wild-type mtDNA. As can be seen in Fig. 1B, there is no detectable mutant mtDNA in A9 cells. Like what was found in 4A cells, the mutation in 4AR cells appears to be homoplasmic. The complete ND6 gene was sequenced in 4AR cell, and no secondary mutation was found to restore the functional ND6.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. mtDNA analysis. (A) Partial sequence of the ND6 genes from A9, 4A, and 4AR cells, showing the insertion of a C residue in the six-C stretch in both 4A and 4AR cells. (B) Quantification of C insertions in the ND6 gene of 4A and 4AR cells by allele-specific termination of primer extension. The wild-type (WT) and mutant (MT) products were separated by electrophoresis.

 
ND6 protein synthesis and complex I assembly. The C insertion in both 4A and 4AR cells introduces a frameshift at 63rd amino acid in ND6 and creates a stop codon 51 to 53 bp downstream of the C stretch, resulting in a 79-amino-acid truncated polypeptide. The truncated product was shown to be unstable (2).

In order to determine whether, in the revertant 4AR cells, the ND6 protein synthesis was recovered, the mitochondrial proteins were labeled with [35S]methionine for 30 min in the presence of emetine to inhibit cytoplasmic protein synthesis. As can be seen in Fig. 2A, as observed with 4A cells, apparently no ND6 gene product that we identified in a previous study (2) was detected in 4AR cells. Obviously, the correction did not happen at the ND6 translation level.


Figure 2
View larger version (68K):
[in this window]
[in a new window]
 
FIG. 2. Mitochondrial protein synthesis and complex I assembly analysis. (A) Electrophoretic patterns of newly synthesized translational products of A9, 4A, and 4AR cells. The cells were exposed to [35S]methionine in the presence of a cytosolic translation inhibitor, emetine. ND1, -2, -3, -4, -4L, -5, and -6, subunits of NADH dehydrogenase 1, 2, 3, 4, 4L, 5, and 6, respectively; CYTb, apocytochrome b; COI, -II, and -III, subunits I, II, and III, respectively; A6 and A8, subunits 6 and 8, respectively, of the H+-ATPase. (B) Electrophoretic patterns of the pulse-chased A9, 4A, and 4AR cells. Mitochondria were extracted, and protein complexes were separated on a 5 to 13% blue native polyacrylamide gel. (C and D) Complex I was stained by in-gel activity assay (C) and by Western blotting with antibodies specific for the GRIM-19 subunit of complex I and subunit {alpha} of complex V (D). Complexes I and V are indicated.

 
One of the direct consequences of the lack of the ND6 subunit in 4A cells was the considerably lower stability of other mtDNA-encoded complex I subunits resulting from the defective assembly (2). In order to investigate whether, in the revertant 4AR cells, complex I assembly was modulated, we first grew the A9, 4A, and 4AR cells in the presence of a mitochondrial protein synthesis inhibitor, chloramphenicol, to enrich the nuclear-DNA-encoded complex I subunits. Cells were subsequently labeled for 2 h with [35S]methionine in the presence of a reversible cytoplasmic protein synthesis inhibitor, cycloheximide. Cells were then chased for 19 h in complete unlabeled medium without the inhibitor in order to allow the labeled mtDNA-encoded subunits to incorporate into the complex. Figure 2B shows the electrophoretic patterns of samples of SDS mitochondrial lysates from pulse-chased A9, 4A, and 4AR cells. Compared to the short-pulse-protein synthesis shown in Fig. 2A, the extra bands in pulse-chase-labeled products represent cytoplasmic proteins labeled during the chase (11). In particular, since there are additional bands in the area for ND6 product, apparently because of cytosolic translation during chase, we cannot identify the ND6 subunit in the electrophoretic pattern of pulse-chase products as shown in Fig. 2B. Levels of the recognizable complex I subunits ND1, ND2, ND3, ND4, and ND4L in 4A cells, as reported in a previous study (2), were decreased; noticeably in 4AR cells, the protein levels of these subunits were restored to about the same amounts as in the wild-type A9 cells. This result pointed to a recovered stability of mtDNA-encoded complex I subunits in the 4AR cells, possibly due to the restored complex assembly.

More direct evidence on complex I assembly came from the blue native electrophoresis analysis. The blue native polyacrylamide gel electrophoresis is a method to isolate intact membrane-bound protein complexes and is particularly utilized to investigate the integrity of mitochondrial respiration complexes (40). Mitochondria isolated from A9, 4A, and 4AR cells were run under native conditions in a blue native polyacrylamide gel electrophoresis system and were then subjected to a complex I in-gel activity assay (Fig. 2C) and to immunoblot analysis for complexes I and V (Fig. 2D). As expected, disrupted complex I assembly was confirmed in 4A cells, whereas the assembly of other subunits of complex I in the absence of ND6 was restored in 4AR cells. It is interesting that in 4AR cells there were two bands for complex I, which could be an indication that there are two alternative conformations of complex I in the absence of the ND6 subunit.

Mitochondrial function analysis. An analysis of the respiratory capacity of A9, 4A, and 4AR cells was carried out. As shown in Fig. 3, 4A cells exhibited a significant decrease in overall oxygen consumption (Fig. 3A), caused by a severe defect in malate/glutamate-dependent oxygen consumption rate, which usually reflects the rate-limiting activity of complex I (Fig. 3B). As controls, the succinate/glycerol-3-phosphate-driven respiration, which usually reflects the activity of complex III, and the TMPD/ascorbate-driven respiration, which reflects the activity of complex IV, were also analyzed (Fig. 3B). Although, generally speaking, all of the respiratory enzyme activities were increased in the revertant 4AR cells compared to the parent 4A cells (complex III by 56%, complex IV by 27%), the most striking difference was in the activity of complex I: 4AR exhibited a 3.5-fold increase in its complex I-dependent oxygen consumption rate. The overall respiration rate was also increased by 283%.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Oxygen consumption and enzyme activity measurement. (A and B) Total respiration rate (A) and activities of the enzymes of the mitochondrial respiratory chain dependent on malate/glutamate ({blacksquare}), succinate/glycerol-3-phosphate ({square}), and TMPD/ascorbate (Figure 3) (B) in wild-type A9, ND6 mutant 4A, and revertant 4AR cells. (C) Complex I and III activities were also determined by enzymatic assay in the isolated mitochondrial membrane. The activities were determined with ~5 x 106 cells. Three determinations were made, and the error bars indicate two times the standard errors of the mean.

 

Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Growth capacity measurement. Growth curves of A9 (A), 4A (B), and 4AR (C) in glucose and galactose media. Cells were plated on multiple 10-cm plates at 105 per plate and were counted on a daily basis for 7 days.

 
To complement the respiratory measurement, biochemical assays on the activities of complex I and III were also carried out. Mitochondrial membranes were partially purified from isolated mitochondria (4). Complex I (NADH-ubiquinone oxidoreductase) activity was determined by monitoring the oxidation of NADH with ubiquinone as the electron acceptor (6). Complex III (ubiquinone-cytochrome c oxidoreductase) activity was measured by determining the reduction of cytochrome c(III) using D-ubiquinol-2 as the electron donor. As shown in Fig. 3C, complex I activity was increased by 7.92-fold in 4AR cells compared to 4A cells, and a 10.24-fold increase was recorded when complex I activity was normalized by complex III activity.

To determine whether in 4AR cells the oxidative phosphorylation efficiency was restored, we measured the coupling of mitochondrial respiration to ATP production of complex I by determining the P/O ratio, defined as nanomoles of ATP produced per nanoatoms of oxygen consumed during ADP-stimulated respiration (8). The P/O ratio coupled to NADH oxidation in A9 cells was 2.27 ± 0.06, whereas the P/O ratio in 4AR cells was 1.69 ± 0.27 in 4AR cells. These experiments showed that whereas the respiratory capacity was fully recovered in 4AR cells, NADH oxidation coupled with ATP production was not completely restored.

Mammalian cells rely on both mitochondrial oxidative phosphorylation and glycolysis for ATP production. However, galactose is not an efficient substrate in the glycolytic pathway. As a result, in medium containing galactose instead of glucose as the carbon source, cells are forced to depend predominantly on oxidative phosphorylation as a source for ATP. Growth capacity in both glucose and galactose media was measured in A9, 4A, and 4AR cells (Fig. 4). The wild-type A9 cells grow well in both glucose and galactose media (4A), whereas the complex I-defective 4A cells grew well in glucose medium but not in galactose medium (Fig. 4B). The revertant 4AR cells, as expected, grew well in both media (Fig. 4B). 4A cells were isolated for their resistance to the respiratory inhibitor, rotenone, and we showed that the resistance was due to a mutation in the nuclear genome (2). Like 4A cells, 4AR cells are still resistant to rotenone (data not shown).

MMP determination. Concomitant with electron transfer along the respiratory chain, protons are pumped out of the inner membrane of mitochondria at complexes I, III, and IV, generating the mitochondrial membrane potential (MMP) (9). Preservation of a proper MMP is not only important in ATP generation, but also essential in mitochondrial calcium uptake and regulation of production of reactive oxygen species, an important cell signal (38). Depolarization of MMP has been implicated in various human diseases (37). Cells were labeled with an MMP indicator, TMRE (50 nM), in a culture incubator for 5 min. The glass coverslip was then sealed in a closed perfusion chamber, and the cells were subsequently imaged on a two-photon confocal microscope. Two-photon imaging was used to excite TMRE as shown in Fig. 5A, and the quantitative results are shown in Fig. 5B. The MMP was compromised in 4A cell by 44% compared to the wild-type A9 cells, and it was fully restored in the 4AR cells.


Figure 5
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 5. Mitochondrial membrane potential determination. (A) Two photon-excitation images of cultured cells stained with TMRE (100 nM for 15 min). (B) Histogram plot of the average log(Fmito/Fcyto) for the 40 brightest individual mitochondria in the image. Figure 5Figure 5, P < 0.01.

 
Genetic origin for the compensation. Complex I is under dual genetic control, nuclear and mitochondrial; alteration in either genome could be responsible for the suppression of mitochondrial dysfunction caused by the ND6 mutation. In order to investigate the genetic origin of the suppression, we separated the two genomes by the approach of mtDNA-less ([rho0]) cell repopulation (32). The [rho0] LL/2-m21 cell line was previously isolated from the long-term treatment of mouse lung carcinoma LL/2 cells (ATCC CRL-1642) by the mtDNA-specific replication inhibitor ethidium bromide (5). Mitochondria from 4AR cells were transferred into [rho0] LL/2-m21 cells by fusion of the [rho0] cells with a population of enucleated cells (cytoplasts) derived from 4AR cells. Three transmitochondrial lines—4AR/LL/2-1, 4AR/LL/2-2, and 4AR/LL/2-3—were isolated in DMEM supplemented with dialyzed fetal bovine serum to make sure there was no trace of uridine, a condition in which [rho0] cells cannot survive (32). To test whether the mtDNA from the 4AR cells exhibited recovered oxidative phosphorylation capacity, we determined the growth curves of 4AR/LL/2-1, 4AR/LL/2-2, 4AR/LL/2-3, together with 4AT1, with 4A mtDNA in an LL/2 nuclear background, and A9/LL/2, with A9 mtDNA in an LL/2 nuclear background (2). As shown in Fig. 6, although A9/LL/2 cells grew well in the galactose medium, all of the transmitochondrial lines with 4AR mtDNA in a new nuclear background failed to grow, a situation similar to that of 4AT1 cells which carried the 4A mutant mtDNA in the same nuclear background.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
 
FIG. 6. Growth capacity of cells with 4ARmtDNA in LL/2 nuclear background in galactose medium. 4AR/LL/2-1, 4AR/LL/2-2, 4AR/LL/2-3, 4AT1, and A9/LL/2 cells were grown in galactose-containing medium. After 3 to 4 days 4AR/LL/2-1 4AR/LL/2-2, and 4AR/LL/2-3cells, like 4AT1, were all floating.

 
Is the suppression of ND6 specific? Our results suggested that the nuclear background was important in the restoration of mitochondrial function in cells carrying an ND6 mutation. Like ND6, the ND5 subunit has been shown to affect complex I assembly, though to a lower extent (5, 7, 24, 33). In Chlamydomonas, the absence of ND6 prevents the assembly of the whole complex, whereas the loss of ND5 leads to a partially assembly complex (7).

An mtDNA-less [rho0] 4AR cell line was isolated according to a previously published protocol (5) which involved long-term treatment of 4AR cells with a high concentration of ethidium bromide. In particular, 4AR cells were exposed to 5 µg of ethidium bromide per ml for 2 months in medium supplemented with 50 µg of uridine per ml, and five clones were isolated. The test of absence of mtDNA was first carried out by a PCR targeting the mtDNA fragment covering the region from positions 15378 to 15372. All five clones showed complete loss of mtDNA (data not shown). The successful isolation of 4AR [rho0] cells was confirmed by the fact that all of these clones failed to survive in a DMEM medium without the supplementation of uridine (32). One of these clones, named 4AR [rho0], was utilized in the following experiments. To determine whether the changes in the nuclear background of 4AR also suppress the defects caused by a mutation in other complex I subunits, we transferred the mtDNA from a cell line, 3A20-4, carrying a ND5 nonsense mutation (5) to the revertant 4AR nuclear background. This was achieved by fusing of enucleated 3A20-4 cells to 4AR [rho0] cells. Two transmitochondrial lines, 3A20-4/4AR-1 and 3A20-4/4AR-2, were isolated. The ND5 mutation in 3A20-4 cells is a C-to-A transversion that changed the arginine codon CGA to the mitochondrial stop codon AGA. Consequently, the 607-amino-acid peptide ND5 was truncated to a 115-amino-acid unstable product (5). This mutation also destroyed a ClaI restriction site (ATCGAT). To confirm that the transmitochondrial lines did carry the ND5 mutation, a ClaI digestion was carried out with a PCR-amplified ND5 fragment from 3A20-4/4AR-1, 3A20-4/4AR-2, 3A20-4, and 4AR cells. As shown in Fig. 7A, both 3A20-4/4AR-1 and 3A20-4/4AR-2, like 3A20-4, carry predominantly mutant ND5 mtDNA. The growth capacity in galactose medium was then determined with the transmitochondrial lines and the 3A20-4 and 4AR cells. In contrast to 3A20-4 cells, both 3A20-4/4AR-1and 3A20-4/4AR-2 cells grew well in the galactose medium (Fig. 7B), indicating a recovered oxidative phosphorylation function. We then measured the total respiration rates of the transmitochondrial lines. As shown in Fig. 7C, the respiration rates in transmitochondrial lines with the revertant 4AR nuclear background increased by ~2-fold compared to cells with the same mtDNA with an ND5 mutation in the LL/2 nuclear background.


Figure 7
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 7. Mitochondrial function in the cells with 3A20-4 mtDNA in the 4AR nuclear background. (A) Detection of ND5 mutation by ClaI digestion of a PCR-amplified fragment. (B) Growth curves of 3A20-4, 3A20-4/4AR-1, 3A20-4/4AR-2, and 4AR in galactose medium. (C) Total respiration rates were measured in transmitochondrial lines and 3A20-4 cells. Three measurements were carried out, and the error bars indicate two times of the standard errors of the mean.

 
However, we did not detect an increase in complex I assembly in 3A20-4/4AR-1 and 3A20-4/4AR-2 cells compared to 3A20-4 cells with BNG analysis (data not shown). It is likely that in 3A20-4 cells the assembly of complex I in the absence of ND5 was in an inactive conformation, which led to a defective complex I activity despite a significant "assembly" of complex I, whereas in 3A20-4/4AR-1 and 3A20-4/4AR-2 cells complex I was assembled in a way more close to the active conformation.

CIA30 is a protein that has been found to be involved in the assembly of complex I in Neurospora crassa (34); a mammalian CIA was also isolated and was proposed as a candidate for human complex I deficiency (29). The expression level of CIA 30 was analyzed by the quantitative reverse transcription-PCR method (47) in A9, 4A, and 4AR cells. No significant difference was detected (data not shown).


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present work, the defective mitochondrial phenotypes caused by a frameshift mutation in ND6 gene were reverted. We explored the presence of wild-type mtDNA in the revertant by sequence analysis and more sensitive allele-specific termination of primer extension, and the results indicated no trace of wild-type mtDNA at the original site. To investigate whether an intragenic suppressor was responsible for the revertant phenotypes, as has been reported in the case of a suppression of a mouse mtDNA missense mutation on the cytochrome c oxidase (complex III) subunit 1 (COXI) gene (1), we transferred the mitochondria from the revertant 4AR to a new nuclear background. However, in such a situation, the suppression was lost, indicating a nuclear involvement.

Suppression of mitochondrial translational deficiency has been reported in various situations. A mutation in the tRNALeu(CUN) gene was shown to suppress a mitochondrial protein synthesis defect caused by mitochondrial tRNALeu(UUR) A3243G mutation (15) with a proposed mechanism of recognition of the UUR codon by the modified tRNALeu(UUR). Nuclear changes were suggested to play a role in the suppression of a pathogenic tRNAAsn mutation (21) and an initiation codon mutation in the yeast COXIII gene (16). However, in this case the ND6 protein synthesis was still missing, indicating that the suppression was not at the translation level.

Nevertheless, compared to the original mutant 4A cells, with the absence of ND6 the stability of other mtDNA-encoded subunits of complex I in 4AR cells increased significantly, as revealed by pulse-chase experiments, suggesting a restored complex I assembly. In the blue native gel analysis, the amount of assembled complex I without ND6 in 4AR cells was found to recover to the level of complex I in the control A9 cells.

It is interesting that both the complex I-dependent respiratory and enzyme activity in 4AR cells are even higher than in the wild-type A9 cells. This compensatory effect might be due to the fact that the restored complex I could not pump the protons as efficiently as in the wild-type cells, which is similar to a previously reported situation where a yeast alternative dehydrogenase NDI1 was introduced to human cells (3, 41).

It has been reported that the ND6 gene is the hot spot for mutations that cause LHON (10). Besides the primary mutation at position 14484, six more mutations have been identified as causes for the disease (13, 27, 31, 54). A missense mutation in the ND6 gene have also been associated with bilateral striatal necrosis (42) and Leigh syndrome (45). Consistent with the clinical reports, the essential role of ND6 in the assembly and function of complex I has been indicated in studies with the green alga Chlamydomonas (7), a mouse cell line (2), and a patient's fibroblasts (45). Our studies on 4AR cells, however, suggested that under certain conditions, other complex I subunits can still be assembled into the complex and make it respiratorily and enzymatically active in the absence of the ND6 subunit. The relatively high frequency of the reversion (105) suggested that an alteration in the expression pattern, instead of a second site mutation, is responsible for the recovery. It is known that ND5 and ND6 subunits localize in different subcomplexes and possibly integrate into the complex at distinctive steps (7, 44, 46, 49). Thus, it is also interesting that this modulation also suppresses the ND5 mutation to some extent, suggesting the existence of a general assembly factor that could be involved at multiple steps of complex I assembly. Although further studies are needed to pinpoint the exact cause for the assembly of complex I in the absence of the ND6 subunit, the results presented here shed a light on a potential new approach for the correction of mitochondrial deficiency in patients.


    ACKNOWLEDGMENTS
 
This study was supported by a grant from the American Heart Association (0430303-AHA). Y.B. is a New Scholar in Aging of the Ellison Medical Foundation, and J.-H.D. was a fellow under an NIH Training Grant in Aging (T32 AG021890) and is also supported by NIH grant AG19316 (to Brian Herman).


    FOOTNOTES
 
* Corresponding author. Mailing address: Department of Cellular and Structural Biology, University of Texas Health Sciences Center at San Antonio, San Antonio, TX 78229. Phone: (210) 567-0561. Fax: (210) 567-3803. E-mail: baiy{at}uthscsa.edu. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Acin-Perez, R., M. P. Bayona-Bafaluy, M. Bueno, C. Machicado, P. Fernandez-Silva, A. Perez-Martos, J. Montoya, M. J. Lopez-Perez, J. Sancho, and J. A. Enriquez. 2003. An intragenic suppressor in the cytochrome c oxidase I gene of mouse mitochondrial DNA. Hum. Mol. Genet. 12:329-339.[Abstract/Free Full Text]

2. Bai, Y., and G. Attardi. 1998. The mtDNA-encoded ND6 subunit of mitochondrial NADH dehydrogenase is essential for the assembly of the membrane arm and the respiratory function of the enzyme. EMBO J. 17:4848-4858.[CrossRef][Medline]

3. Bai, Y., P. Hajek, A. Chomyn, E. Chan, B. B. Seo, A. Matsuno-Yagi, T. Yagi, and G. Attardi. 2001. Lack of complex I activity in human cells carrying a mutation in mtDNA-encoded ND4 subunit is corrected by the Saccharomyces cerevisiae NADH-quinone oxidoreductase (NDI1) gene. J. Biol. Chem. 276:38808-38813.[Abstract/Free Full Text]

4. Bai, Y., P. Hu, J. S. Park, J. H. Deng, X. Song, A. Chomyn, T. Yagi, and G. Attardi. 2004. Genetic and functional analysis of mitochondrial DNA-encoded complex I genes. Ann. N. Y. Acad. Sci. 1011:272-283.[Abstract/Free Full Text]

5. Bai, Y., R. M. Shakeley, and G. Attardi. 2000. Tight control of respiration by NADH dehydrogenase ND5 subunit gene expression in mouse mitochondria. Mol. Cell. Biol. 20:805-815.[Abstract/Free Full Text]

6. Birch-Machin, M. A., and D. M. Turnbull. 2001. Assaying mitochondrial respiratory complex activity in mitochondria isolated from human cells and tissues. Methods Cell Biol. 65:97-117.[Medline]

7. Cardol, P., R. F. Matagne, and C. Remacle. 2002. Impact of mutations affecting ND mitochondria-encoded subunits on the activity and assembly of complex I in Chlamydomonas: implication for the structural organization of the enzyme. J. Mol. Biol. 319:1211-1221.[CrossRef][Medline]

8. Chance, B., and G. R. Williams. 1955. Respiratory enzymes in oxidative phosphorylation. I. Kinetics of oxygen utilization. J. Biol. Chem. 217:383-393.[Free Full Text]

9. Chen, L. B. 1988. Mitochondrial membrane potential in living cells. Annu. Rev. Cell Biol. 4:155-181.[CrossRef][Medline]

10. Chinnery, P. F., D. T. Brown, R. M. Andrews, R. Singh-Kler, P. Riordan-Eva, J. Lindley, D. A. Applegarth, D. M. Turnbull, and N. Howell. 2001. The mitochondrial ND6 gene is a hot spot for mutations that cause Leber's hereditary optic neuropathy. Brain 124:209-218.[Abstract/Free Full Text]

11. Chomyn, A. 1996. In vivo labeling and analysis of human mitochondrial translation products. Methods Enzymol. 264:197-211.[Medline]

12. Chomyn, A., M. W. Cleeter, C. I. Ragan, M. Riley, R. F. Doolittle, and G. Attardi. 1986. URF6, last unidentified reading frame of human mtDNA, codes for an NADH dehydrogenase subunit. Science 234:614-618.[Abstract/Free Full Text]

13. De Vries, D. D., L. N. Went, G. W. Bruyn, H. R. Scholte, R. M. Hofstra, P. A. Bolhuis, and B. A. van Oost. 1996. Genetic and biochemical impairment of mitochondrial complex I activity in a family with Leber hereditary optic neuropathy and hereditary spastic dystonia. Am. J. Hum. Genet. 58:703-711.[Medline]

14. DiMauro, S., and E. A. Schon. 2001. Mitochondrial DNA mutations in human disease. Am. J. Med. Genet. 106:18-26.[CrossRef][Medline]

15. El Meziane, A., S. K. Lehtinen, N. Hance, L. G. Nijtmans, D. Dunbar, I. J. Holt, and H. T. Jacobs. 1998. A tRNA suppressor mutation in human mitochondria. Nat. Genet. 18:350-353.[CrossRef][Medline]

16. Folley, L. S., and T. D. Fox. 1994. Reduced dosage of genes encoding ribosomal protein S18 suppresses a mitochondrial initiation codon mutation in Saccharomyces cerevisiae. Genetics 137:369-379.[Abstract]

17. Friedrich, T., U. Weidner, U. Nehls, W. Fecke, R. Schneider, and H. Weiss. 1993. Attempts to define distinct parts of NADH:ubiquinone oxidoreductase (complex I). J. Bioenerg. Biomembr. 25:331-337.[CrossRef][Medline]

18. Grigorieff, N. 1999. Structure of the respiratory NADH:ubiquinone oxidoreductase (complex I). Curr. Opin. Struct. Biol. 9:476-483.[CrossRef][Medline]

19. Grigorieff, N. 1998. Three-dimensional structure of bovine NADH:ubiquinone oxidoreductase (complex I) at 22 A in ice. J. Mol. Biol. 277:1033-1046.[CrossRef][Medline]

20. Guenebaut, V., R. Vincentelli, D. Mills, H. Weiss, and K. R. Leonard. 1997. Three-dimensional structure of NADH-dehydrogenase from Neurospora crassa by electron microscopy and conical tilt reconstruction. J. Mol. Biol. 265:409-418.[CrossRef][Medline]

21. Hao, H., L. E. Morrison, and C. T. Moraes. 1999. Suppression of a mitochondrial tRNA gene mutation phenotype associated with changes in the nuclear background. Hum. Mol. Genet. 8:1117-1124.[Abstract/Free Full Text]

22. Hayashi, J., S. Ohta, A. Kikuchi, M. Takemitsu, Y. Goto, and I. Nonaka. 1991. Introduction of disease-related mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA results in mitochondrial dysfunction. Proc. Natl. Acad. Sci. USA 88:10614-10618.[Abstract/Free Full Text]

23. Hirst, J., J. Carroll, I. M. Fearnley, R. J. Shannon, and J. E. Walker. 2003. The nuclear encoded subunits of complex I from bovine heart mitochondria. Biochim. Biophys. Acta 1604:135-150.[Medline]

24. Hofhaus, G., and G. Attardi. 1995. Efficient selection and characterization of mutants of a human cell line which are defective in mitochondrial DNA-encoded subunits of respiratory NADH dehydrogenase. Mol. Cell. Biol. 15:964-974.[Abstract]

25. Hofhaus, G., R. M. Shakeley, and G. Attardi. 1996. Use of polarography to detect respiration defects in cell cultures. Methods Enzymol. 264:476-483.[Medline]

26. Hofhaus, G., H. Weiss, and K. Leonard. 1991. Electron microscopic analysis of the peripheral and membrane parts of mitochondrial NADH dehydrogenase (complex I). J. Mol. Biol. 221:1027-1043.[CrossRef][Medline]

27. Howell, N., C. Bogolin, R. Jamieson, D. R. Marenda, and D. A. Mackey. 1998. mtDNA mutations that cause optic neuropathy: how do we know? Am. J. Hum. Genet. 62:196-202.[CrossRef][Medline]

28. Howell, N., I. Kubacka, M. Xu, and D. A. McCullough. 1991. Leber hereditary optic neuropathy: involvement of the mitochondrial ND1 gene and evidence for an intragenic suppressor mutation. Am. J. Hum. Genet. 48:935-942.[Medline]

29. Janssen, R., J. Smeitink, R. Smeets, and L. van Den Heuvel. 2002. CIA30 complex I assembly factor: a candidate for human complex I deficiency? Hum. Genet. 110:264-270.[CrossRef][Medline]

30. Johns, D. R., M. J. Neufeld, and R. D. Park. 1992. An ND-6 mitochondrial DNA mutation associated with Leber hereditary optic neuropathy. Biochem. Biophys. Res. Commun. 187:1551-1557.[CrossRef][Medline]

31. Jun, A. S., M. D. Brown, and D. C. Wallace. 1994. A mitochondrial DNA mutation at nucleotide pair 14459 of the NADH dehydrogenase subunit 6 gene associated with maternally inherited Leber hereditary optic neuropathy and dystonia. Proc. Natl. Acad. Sci. USA 91:6206-6210.[Abstract/Free Full Text]

32. King, M. P., and G. Attardi. 1989. Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation. Science 246:500-503.[Abstract/Free Full Text]

33. Kirby, D. M., A. Boneh, C. W. Chow, A. Ohtake, M. T. Ryan, D. Thyagarajan, and D. R. Thorburn. 2003. Low mutant load of mitochondrial DNA G13513A mutation can cause Leigh's disease. Ann. Neurol. 54:473-478.[CrossRef][Medline]

34. Kuffner, R., A. Rohr, A. Schmiede, C. Krull, and U. Schulte. 1998. Involvement of two novel chaperones in the assembly of mitochondrial NADH:ubiquinone oxidoreductase (complex I). J. Mol. Biol. 283:409-417.[CrossRef][Medline]

35. Lenaz, G., R. Fato, A. Baracca, and M. L. Genova. 2004. Mitochondrial quinone reductases: complex I. Methods Enzymol. 382:3-20.[Medline]

36. Lin, D. T., and J. D. Lechleiter. 2002. Mitochondrial targeted cyclophilin D protects cells from cell death by peptidyl prolyl isomerization. J. Biol. Chem. 277:31134-31141.[Abstract/Free Full Text]

37. Nicholls, D. G. 2002. Mitochondrial function and dysfunction in the cell: its relevance to aging and aging-related disease. Int. J. Biochem. Cell. Biol. 34:1372-1381.[CrossRef][Medline]

38. Nicholls, D. G. 2004. Mitochondrial membrane potential and aging. Aging Cell 3:35-40.[CrossRef][Medline]

39. Robinson, B. H., R. Petrova-Benedict, J. R. Buncic, and D. C. Wallace. 1992. Nonviability of cells with oxidative defects in galactose medium: a screening test for affected patient fibroblasts. Biochem. Med. Metab. Biol. 48:122-126.[CrossRef][Medline]

40. Schagger, H. 1995. Native electrophoresis for isolation of mitochondrial oxidative phosphorylation protein complexes. Methods Enzymol. 260:190-202.[Medline]

41. Seo, B. B., A. Matsuno-Yagi, and T. Yagi. 1999. Modulation of oxidative phosphorylation of human kidney 293 cells by transfection with the internal rotenone-insensitive NADH-quinone oxidoreductase (NDI1) gene of Saccharomyces cerevisiae. Biochim. Biophys. Acta 1412:56-65.[Medline]

42. Solano, A., M. Roig, C. Vives-Bauza, J. Hernandez-Pena, E. Garcia-Arumi, A. Playan, M. J. Lopez-Perez, A. L. Andreu, and J. Montoya. 2003. Bilateral striatal necrosis associated with a novel mutation in the mitochondrial ND6 gene. Ann. Neurol. 54:527-530.[CrossRef][Medline]

43. Triepels, R. H., L. P. Van Den Heuvel, J. M. Trijbels, and J. A. Smeitink. 2001. Respiratory chain complex I deficiency. Am. J. Med. Genet. 106:37-45.[CrossRef][Medline]

44. Ugalde, C., R. J. Janssen, L. P. van den Heuvel, J. A. Smeitink, and L. G. Nijtmans. 2004. Differences in assembly or stability of complex I and other mitochondrial OXPHOS complexes in inherited complex I deficiency. Hum. Mol. Genet. 13:659-667.[Abstract/Free Full Text]

45. Ugalde, C., R. H. Triepels, M. J. Coenen, L. P. van den Heuvel, R. Smeets, J. Uusimaa, P. Briones, J. Campistol, K. Majamaa, J. A. Smeitink, and L. G. Nijtmans. 2003. Impaired complex I assembly in a Leigh syndrome patient with a novel missense mutation in the ND6 gene. Ann. Neurol. 54:665-669.[CrossRef][Medline]

46. Ugalde, C., R. Vogel, R. Huijbens, B. Van Den Heuvel, J. Smeitink, and L. Nijtmans. 2004. Human mitochondrial complex I assembles through the combination of evolutionary conserved modules: a framework to interpret complex I deficiencies. Hum. Mol. Genet. 13:2461-2472.[Abstract/Free Full Text]

47. Vanden Heuvel, J. P., G. C. Clark, M. C. Kohn, A. M. Tritscher, W. F. Greenlee, G. W. Lucier, and D. A. Bell. 1994. Dioxin-responsive genes: examination of dose-response relationships using quantitative reverse transcriptase-polymerase chain reaction. Cancer Res. 54:62-68.[Abstract/Free Full Text]

48. Villani, G., and G. Attardi. 2001. In vivo measurements of respiration control by cytochrome c oxidase and in situ analysis of oxidative phosphorylation. Methods Cell Biol. 65:119-131.[Medline]

49. Vogel, R., L. Nijtmans, C. Ugalde, L. van den Heuvel, and J. Smeitink. 2004. Complex I assembly: a puzzling problem. Curr. Opin. Neurol. 17:179-186.[CrossRef][Medline]

50. Walker, J. E. 1992. The NADH:ubiquinone oxidoreductase (complex I) of respiratory chains. Q. Rev. Biophys. 25:253-324.[Medline]

51. Wallace, D. C. 1997. Mitochondrial DNA in aging and disease. Sci. Am. 277:40-47.[Medline]

52. Wallace, D. C., G. Singh, M. T. Lott, J. A. Hodge, T. G. Schurr, A. M. Lezza, L. J. Elsas II, and E. K. Nikoskelainen. 1988. Mitochondrial DNA mutation associated with Leber's hereditary optic neuropathy. Science 242:1427-1430.[Abstract/Free Full Text]

53. Weiss, H., T. Friedrich, G. Hofhaus, and D. Preis. 1991. The respiratory-chain NADH dehydrogenase (complex I) of mitochondria. Eur. J. Biochem. 197:563-576.[Medline]

54. Wissinger, B., D. Besch, B. Baumann, S. Fauser, M. Christ-Adler, B. Jurklies, E. Zrenner, and B. Leo-Kottler. 1997. Mutation analysis of the ND6 gene in patients with Lebers hereditary optic neuropathy. Biochem. Biophys. Res. Commun. 234:511-515.[CrossRef][Medline]

55. Yagi, T., B. B. Seo, S. Di Bernardo, E. Nakamaru-Ogiso, M. C. Kao, and A. Matsuno-Yagi. 2001. NADH dehydrogenases: from basic science to biomedicine. J. Bioenerg Biomembr. 33:233-242.[CrossRef][Medline]


Molecular and Cellular Biology, February 2006, p. 1077-1086, Vol. 26, No. 3
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.3.1077-1086.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, J.-H.
Right arrow Articles by Bai, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, J.-H.
Right arrow Articles by Bai, Y.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. J. Virol. Eukaryot. Cell
Microbiol. Mol. Biol. Rev. Clin. Vaccine Immunol. All ASM Journals