Department of Biochemistry,1 Department of Infectious Diseases, St. Jude Children's Research Hospital, 332 N. Lauderdale, Memphis, Tennessee 38105,2 Department of Pediatric and Adolescent Medicine and Department of Biochemistry and Molecular Biology, Mayo Clinic, 200 First Street SW, Rochester, Minnesota 559053
Received 10 July 2005/ Returned for modification 8 August 2005/ Accepted 9 November 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
2,400-residue nuclear phosphoproteins that share 61% overall sequence identity (
80 to 90% in evolutionarily conserved domains). Homologs of CBP and p300 are found in Drosophila melanogaster and Caenorhabditis elegans, but there are no other closely related family members in mammals. These two coactivators typically bind to the activation domains of transcription effectors via five unique protein-binding domains (nuclear hormone receptor binding domain, CH1, KIX, CH3, and SID/IBiD) (64, 92). CBP and p300 appear to function redundantly in many instances, but they also have unique properties, particularly in vivo (92). The lack of other closely related family members or conservation of these protein-binding domains in other mammalian proteins implies that CBP and p300 are indispensable. Following recruitment by transcription factors, juxtaposition of the adaptor, acetyltransferase, and ubiquitin ligase functions of CBP and p300 at the promoter/enhancer is hypothesized to stimulate target gene transcription (92). Histones are believed to be the main acetylation targets of CBP and p300, thereby alleviating repressive chromatin and potentiating transcription, but the ability of CBP and p300 to regulate transcription factor activity by acetylation of specific lysine residues is also thought to be crucial (27, 176, 184). The importance of CBP and p300 for the transcription of endogenous genes, however, has not been widely investigated.
An astonishingly large fraction of the estimated 1,962 (human) transcriptional regulators (134), as well as other proteins, have been shown to interact physically and functionally with CBP and p300 (described interactions now total at least 312) (Fig. 1; more detailed and up to date information is available at http://www.stjude.org/brindle). This number of interactions puts CBP and p300 at the top end of known "connectivity" in the interactome, as high-throughput screens to identify Drosophila, C. elegans, and mammalian interactome networks indicate that only a very small fraction of proteins have as many as 100 to 200 interacting partners (8, 60, 118). It may even be inferred that CBP and p300 interact with the great majority of transcriptional regulators, as most have not been tested. More than half (>190) of the described CBP/p300 interactors are encoded by essential genes in mice (Fig. 1), thus the common assumption that loss of CBP or p300 will have catastrophic effects on specific cell lineages because of broad alterations in gene expression appears reasonable. Also implicit from the high level of connectivity for CBP and p300 is that cells cannot exist in the absence of both coactivators, although it has not been possible to test this rigorously because a conditional knockout allele for p300 has not been available.
|
The roles of CBP and p300 in blood cells are of considerable interest because they are thought to be vital for the function of many hematopoietic transcription factors; at least 65 factors that interact with CBP or p300 are encoded by genes that are essential for T and B cells in mice (Fig. 1). Moreover, chromosomal translocations involving CBP or p300 produce gain-of-function fusion proteins in some types of human leukemia (18) (Fig. 1). Both CBP and p300 are necessary for normal definitive hematopoiesis, including lymphopoiesis, in chimeric mice created with CBP/ or p300/ embryonic stem cells (164). CBP can also act as a tumor suppressor in hematopoietic cells, including T cells (93), tissue macrophages (histiocytes), and possibly the B-cell lineage (plasmacytomas developed in mice transplanted with CBP heterozygous cells) (109). There is less evidence for p300 acting as a tumor suppressor in hematopoietic cells, although histiocytic sarcoma has been reported in p300/ chimeric mice (164). Still, peripheral blood T-cell numbers appear to be mostly unaffected in CBP and p300 heterozygous mice (109), even though CBP and p300 have been implicated by a number of studies as being important for the activity of 56 T-cell-critical transcriptional regulators (Fig. 1). In this regard, conditional knockout of CBP in multiple cell lineages that include thymocytes leads to abnormally high levels of CD8+ single-positive (SP) thymocytes (93). In addition, mice that are homozygous for mutations in the CREB- and c-Myb-binding domain (KIX) of p300 have thymic hypoplasia in the context of multilineage hematopoietic defects (95). It is uncertain, however, if CBP and p300 function equivalently in T-cell development. To test the hypothesis that CBP and p300 are each critically limiting in specific cell lineages in vivo, we developed mice with conditional knockout alleles for each gene. We then examined the requirement for CBP and p300 in thymocyte development and their roles in T-cell and macrophage gene expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Genotyping of mice.
p300 and CBP conditional knockout mice were bred to Lck-Cre transgenic mice (69) or lysM-Cre transgenic mice (32). Recombination of the LoxP sites flanking p300 exon 9 in cells expressing Cre was determined by Southern blotting using an XbaI or EcoRI digest and a cDNA probe to the region encoding amino acids 615 to 681 or by semiquantitative PCR using primers p4 (CTCTACATCCTAAGTGCTAGG), p5 (TGGACTGGTTATCGGTTCACC), and p6 (CAGTAGATGCTAGAGAAAGCC), producing a 540-bp wild-type band, a 720-bp p300 flox band and a 1.1-kb p300
flox band (primer locations shown in Fig. 2). This semiquantitative PCR overestimates the deletion of the p300flox allele in a systematic manner that was corrected for by using a standard curve of samples of known deletion as determined by quantitative Southern blotting. Generation of CBP conditional knockout mice and PCR genotyping for the deletion of the CBPflox allele was reported by Kang-Decker et al. (93). Detection of the flox and
flox alleles of CBP by Southern blotting was performed using a HindIII digest and a 5' external probe. Thymocyte subpopulations were sorted to check deletion by flow cytometry using anti-CD4 and anti-CD8 antibodies. T cells from the spleen and lymph node were purified to check deletion by positive selection using anti-Thy1.2-conjugated magnetic beads from Miltenyi Biotech.
|
Flow cytometry and complete blood count. Antibodies for flow cytometry (fluorescence-activated cell sorting [FACS]) analysis (anti-CD3, anti-CD4, anti-CD8, anti-B220) were purchased from Becton Dickenson. FACS was performed on a FACSCalibur system using CellQuest software. Automated complete blood counts were performed using a Hemavet 3700R.
Estimation of total cell counts. Total counts for thymic subpopulations were determined by multiplying the percentage of cells in a subpopulation as measured by FACS by the total manual viable thymocyte count for that mouse. Cell counts in peripheral blood were estimated from automated complete blood count lymphocyte count per microliter multiplied by the percentages of T cells and B cells in peripheral blood as determined from anti-CD3 versus anti-B220 FACS.
Bone marrow-derived macrophages. Bone marrow-derived macrophages (BMDMs) were obtained by flushing bone cavities and isolating macrophages by differentiation in L-cell-conditioned medium as a source of macrophage colony-stimulating factor as described previously (141).
Activation of splenic T cells and qRT-PCR. Splenic T cells were sorted by FACS and cultured at 2 x 106 cells/ml in Dulbecco's modified Eagles medium plus 10% fetal bovine serum with 1 ng/ml phorbol myristate acetate (PMA) and 100 ng/ml ionomycin or dimethyl sulfoxide vehicle for 3 h at 37°C in round-bottom plates. cDNA was generated from 100 ng of total RNA in a 20-µl reaction mixture using Superscript II reverse transcriptase (RT; Invitrogen). Quantitative RT-PCR (qRT-PCR) was performed on an Opticon DNA engine (MJ Research) using 1 µl of cDNA per 25 µl PCR with SYBR green dye. qPCR primers were designed using Primer Express software (Applied Biosystems) and confirmed to yield a single product by melting curve analysis. Samples were normalized to GAPDH mRNA.
| RESULTS |
|---|
|
|
|---|
flox) was efficient, although it showed considerable variation between mice carrying the Lck-Cre transgene (Fig. 2b). This is likely due to stochastic transgene expression, a relatively common phenomenon in transgenic mice (38).
p300
flox is a null allele.
The deletion efficiency in p300flox/lflox; Lck-Cre mice could be as high as
90 to 95% and was specific for the thymus (L. H. Kasper, data not shown) (69). Mice with high deletion frequencies were deficient for full-length p300 protein as measured by Western blots using thymic nuclear extracts and antibodies specific for the N terminus of p300 (Fig. 2c). CBP protein levels were not measurably affected in the p300 null thymuses (Fig. 2c; 3a), nor were p300 protein levels altered in thymuses deficient for CBP (Fig. 3a). There was no evidence for truncated forms of p300 appearing in p300flox/lflox; Lck-Cre thymic nuclear extracts as determined by Western blots using an N-terminus-specific antibody following 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, although a small amount of material that reacted with a C-terminal p300 antibody ran at the dye front (less than 37 kDa) (P. K. Brindle, data not shown). However, indirect immunofluorescence of thymocytes from p300flox/flox; Lck-Cre and CBPflox/flox; Lck-Cre mice using antibodies specific for the C termini of p300 or CBP confirmed that many cells lacked p300 or CBP, respectively (Fig. 3b). Together, these results indicate that p300
flox is a null allele.
|
Quantitation of individual thymocyte subtypes showed that double-negative (DN) cell numbers (the least mature major subtype) were relatively unaffected in both mutants (Fig. 4c and 5c), whereas there was a five- to threefold average decrease in double-positive (DP) cell numbers for CBP (Fig. 4d) (n = 4) and p300 (Fig. 5d) (n = 5) mutant mice, respectively, compared to flox controls (n = 4 and 6, respectively). This apparent conflict with the relative increase in the percentage of DN cells seen by FACS (Fig. 4a and 5a) is explained by the decrease in thymus size for both CBP and p300 mutant mice. Since Lck-Cre transgene expression does not initiate until the DN1 stage (the least mature stage in the thymus), DN cell numbers may be normal (Fig. 4c and 5c) because loss of CBP or p300 has no effect on DN cells or, alternatively, because CBP and p300 protein and mRNA levels are not sufficiently depleted by turnover and dilution until the next stage of development (i.e., DP thymocytes).
|
|
We previously showed that CBPflox/flox; MMTV-Cre mice had an increased percentage of CD8+ SP thymocytes, although it was unclear if this defect was autonomous to the thymus because CBPflox inactivation occurred in multiple tissues (93). Since CBPflox/flox; Lck-Cre mice also had a marked increase in the percentage of CD8+ SP thymocytes compared to Lck-Cre and CBPflox/flox controls (Fig. 4a), and as the Lck-Cre transgene is expressed exclusively in thymocytes (69), the increase in CD8+ SP cells is due to loss of CBP in thymocytes. Together, these results show that CBP and p300 are required for normal thymocyte development, although they have distinct roles in CD8+ SP development.
Modest reduction in peripheral T cells in CBPflox/flox; Lck-Cre mice.
Neither CBPflox/flox; Lck-Cre nor p300flox/flox; Lck-Cre mice had obviously abnormal proportions of CD4+ and CD8+ peripheral T cells in the spleen and blood (Fig. 4a; 5a), even when deletion in the thymus was high (
80 to 90%) (Fig. 4b; 5b), but there was a modest
2-fold reduction in the number of peripheral blood CD4+ (P = 0.028, analysis of variance [ANOVA]) and CD8+ (P = 0.020) T cells in CBPflox/flox; Lck-Cre mice that was not observed in p300flox/flox; Lck-Cre mice (Fig. 6a). Peripheral blood B-cell numbers were comparable between control and mutant mice, demonstrating the lineage specificity of the mutations (P = 0.58, ANOVA) (Fig. 6b). Comparison of the deletion frequency in thymus and affinity-purified splenic T cells revealed that the fraction of cells harboring the nonrecombined alleles increased in peripheral T cells from p300flox/flox; Lck-Cre mice (Fig. 7a) and CBPflox/flox; Lck-Cre mice (Fig. 7b), indicating that late developmental stage or peripheral T cells with p300 or CBP deficiency are at a disadvantage.
|
|
|
flox but tends to overestimate the relative abundance of the p300
flox allele; M. A. Biesen, data not shown).
|
50%) of the CBPflox and p300flox alleles in the thymus revealed about a 10-fold increase in the percentage of DN thymocytes, with a concomitant decrease in DP cells; mice with a lower deletion frequency (
30%) in the thymus had an intermediate immunophenotype (Fig. 9a and b, compare quad mutants 1 and 2). The quad mutant thymuses also lacked the increase in CD8+ SP cells that occurred in the CBPflox/flox; Lck-Cre mice. The proportion of CD4+ and CD8+ T cells in the spleen and blood of the quad mutants were comparable to Lck-Cre and CBPflox/flox control mice, however (Fig. 9a).
We did not observe deletion frequencies greater than
50% in quad mutant thymuses, suggesting that thymocytes lacking both CBP and p300 are strongly selected against. We confirmed this by quantitating the number of thymocytes per subpopulation in quad mutants that showed both medium (
50%) and low (
10 to 30%) deletion frequencies. Total thymocyte counts decreased with increased deletion frequency, and as a result, DN cell numbers were unaffected in both classes of quad mutants compared to control mice (Fig. 10a), but DP cells were reduced about 10-fold in thymuses displaying medium levels of deletion (Fig. 10b). There was a deficiency of SP thymocytes in quad mutants with medium deletion, although the CD8+ SP thymocytes were more variably affected (Fig. 10c and d). In further support of these data, genomic DNA isolated from FACS-purified quad mutant thymocyte subtypes showed
30 to 40% deletion of the CBPflox and p300flox alleles in DN cells, but there was a steady drop in the frequency of both recombined alleles in DP and SP thymocytes, with an almost complete absence (
1% deletion) in peripheral T cells purified from the spleen and lymph nodes (Fig. 11a and b). These results indicate that thymocyte development requires either CBP or p300 and that T cells need CBP or p300 to populate the peripheral lymphoid organs. The numbers of T cells in the spleen and blood of quad mutants were not significantly different from those of control mice, however, indicating that there is compensation by homeostatic proliferation of peripheral T cells that did not recombine the alleles (Fig. 10e and f) (P > 0.05, ANOVA, n = 3 to 9).
|
|
50%) in their combined levels will have catastrophic consequences for cells. In contrast, results from this study suggest a model where CBP and p300 are not extremely limiting and that lesser amounts (between 0 and 50%) of the coactivators can still support many critical functions. We compared these models by determining whether one CBP or p300 wild-type allele is sufficient for thymocyte development and for T cells to populate the periphery. Both CBP+/flox; p300flox/flox; Lck-Cre and CBPflox/flox; p300+/flox; Lck-Cre mice ("triple" mutants) were generated, and semiquantitative PCR analysis of thymic and T-cell genomic DNA was performed. In this instance, we corrected the PCR data by using a standard curve made with samples of known deletion frequency as determined by quantitative Southern blotting. The corrected PCR data demonstrated that triple-mutant cells of both genotypes were selected against in the periphery, although not to the extent seen with the quad mutants (Fig. 12a and b, note that the similarity in deletion frequency for both types of alleles indicates that an individual cell either recombines all the alleles or none; the quad mutant data in Fig. 11 corroborate this). Remarkably, about 20 to 30% deletion was observed for both CBPflox and p300flox in peripheral T cells of CBP+/flox; p300flox/flox; Lck-Cre mice, suggesting that T cells with one wild-type CBP allele may be able to develop and populate the lymphoid organs to some degree (Fig. 12b). The extent of deletion in peripheral T cells does not depend strongly on the level of deletion in the thymus (compare Fig. 12a and c). All told, these results demonstrate that there is a graded effect of the combined dosage of functional CBP and p300 alleles on T-cell development and their ability to populate the periphery. The inactivation of both CBP alleles (along with one p300 allele) was more detrimental to peripheral T cells than the other triple mutation combination (compare Fig. 12a and c with 12b), which is consistent with our observation that CBP is more important for T cells than p300.
|
), whose expression in response to TCR signaling is critical for T-cell function and has been reported to involve p300 and CBP (47, 228). IL-2 mRNA expression was reduced less than twofold in CBPflox/flox; Lck-Cre cells and was unaffected in p300flox/flox; Lck-Cre splenic T cells in response to treatment with PMA and calcium ionophore. The decrease in IL-2 may be due to the increased fraction of CD8+ T cells relative to CD4+ cells in the spleen (Fig. 4a), as not all CD8+-T-cell subtypes express IL-2 efficiently (212). TNF-
mRNA expression, however, was decreased more than twofold in p300flox/flox; Lck-Cre and more than fourfold in CBPflox/flox; Lck-Cre in activated splenic T cells (Fig. 13a and b). This deficit in TNF-
expression is in agreement with a previous report by Falvo et al. demonstrating that CBP null heterozygous T cells are defective in TNF-
expression in response to TCR activation with anti-CD3 and suggests that p300 is also important (47).
|
, arginase (Arg1), inducible nitric oxide synthase (iNOS), and interferon regulatory factor 1 (IRF-1), are regulated by gene-specific combinations of the CBP/p300-interacting transcription factors ATF-2, c-Jun, SP1, Ets, Egr-1, NF-
B, AP-1, STAT1, PU.1, STAT6, and C/EBPß (Fig. 1) (9, 117, 152). CBPflox/flox; lysMcre mice that express Cre in macrophages yielded cells with an
80 to 90% reduction in CBP protein when measured by Western blotting of nuclear extracts (Fig. 14a) (32). Northern blot analysis revealed that TNF-
mRNA was robustly induced in response to lipopolysaccharide (LPS) stimulation in CBPflox/flox; lysMcre macrophages, although not quite as well as in control CBPflox/flox cells (Fig. 14b) (rRNA served as a loading control). Arginase (Arg1) induction in response to the cytokine IL-4 was measured by Western blotting and was comparable between CBPflox/flox; lysMcre and CBPflox/flox macrophages (Fig. 14c) (the nonspecific band serves as a loading control).
|
mRNA was induced comparably by LPS in p300flox/flox and p300flox/flox; lysMcre macrophages (Fig. 14d, rRNA loading control in bottom panel). Arg1 induction after IL-4 stimulation was also comparable between p300flox/flox and p300flox/flox; lysMcre macrophages (Fig. 14e), although treatment with both gamma interferon (IFN-
) and LPS revealed a modest deficit in the kinetics of iNOS expression but not IRF-1 (Fig. 14f, nonspecific band acts as a loading control). IRF-1 and iNOS expression in response to the same stimuli in CBPflox/flox; lysMcre macrophages was in the normal range (P. J. Murray, data not shown). Together, these results indicate that CBP or p300 individually is not highly limiting for TNF-
and Arg1 expression in macrophages in response to LPS and IL-4. Interestingly, iNOS, but not IRF-1, induction in response to IFN-
plus LPS appears to be partially sensitive to p300 deficiency, consistent with a proposed model that CBP and p300 are limiting for iNOS transcription (117). Induction of high-level iNOS expression requires IRF-1 and NF-
B activity, so it appears that p300 levels are important for this process but expression levels can be compensated for by CBP or other factors. We did not observe a noticeable defect in TNF-
induction in macrophages even though both CBP and p300 null T cells showed a clear deficit (Fig. 13b) and B cells deficient for p300 or CBP showed a 30 to 60% decrease in TNF-
expression in response to B-cell receptor signaling (P. K. Brindle, submitted for publication). This may reflect different transcriptional regulator usage in the three cell types. It is worth noting that the macrophages tested here had less than 100% inactivation of CBPflox or p300flox, so it is possible that contributions to gene expression by CBP or p300 were underestimated in this analysis. | DISCUSSION |
|---|
|
|
|---|
Homeostatic proliferative mechanisms largely compensated for any reduction in the number of naive peripheral T cells caused by the mutations by allowing cells that did not recombine the conditional alleles (likely due to stochastic expression of the Lck-Cre transgene) to expand and fill the niche (84). It is somewhat counterintuitive that loss of both CBP and p300 did not cause a significant decrease in peripheral T cells, even though loss of CBP alone caused a modest
2-fold deficit. There are several possible explanations for this observation. First, T cells lacking CBP alone may function in a non-cell-autonomous manner to suppress homeostatic proliferation of peripheral T cells. For example, it is possible that less IL-7, an essential cytokine for homeostatic proliferation, is available in CBPflox/flox; Lck-Cre mice (84). Since T cells lacking both CBP and p300 are very rare or nonexistent outside the thymus, homeostatic proliferation would function normally in CBPflox/flox; p300flox/flox; Lck-Cre mice in this scenario. Second, homeostatic "cell counting" or "empty space detection" mechanisms may respond more efficiently to a strong deficit in early thymocyte development (as seen in CBPflox/flox; p300flox/flox; Lck-Cre mice) than if cells are less severely affected in the thymus, as with CBPflox/flox; Lck-Cre mice. Third, recombination of the floxed alleles may be more efficient in CBPflox/flox; Lck-Cre mice than in CBPflox/flox; p300flox/flox; Lck-Cre mice, thus homeostatic proliferation may be unable to completely fill the larger empty niche in the former.
It was surprising that loss of either CBP or p300 alone did not result in a more drastic T-cell phenotype given that the two coactivators have been shown to interact in vitro with over 190 proteins encoded by essential genes in mice, of which at least 56 are crucial for T cells (Mouse Genome Informatics) (Fig. 1). It is possible that these two coactivators are not generally limiting in cells to the extent previously believed (64, 115, 203). Indeed, CBP/ and p300/ mice are viable through the first half of development (dying at E9 to E11.5), suggestive of three possibilities with regard to the in vivo roles of CBP and p300. (i) In vitro interactions with CBP and p300 may not be biologically relevant. Our findings, however, argue that CBP and p300 interactions based upon in vitro evidence cannot be dismissed out of hand. Although HDM2 appears to aggregate nonspecifically with the unfolded TAZ1 domain of p300 in the presence of EDTA (131), we have found that three essential transcription factors (CREB, c-Myb, and HIF-1
) with well-characterized in vitro interactions with CBP and p300 show partial loss of activity when CBP and p300 functionality is attenuated by mutation in primary cells or mice (95; Kasper et al., in press). (ii) CBP and p300 may function redundantly in most instances and be generally nonlimiting in many cell types. Support for the second point is self-evident, since many T cells can develop and survive and mice can go through a substantial portion of development with either CBP or p300 alone. In addition, we have not observed increased expression of remaining wild-type alleles as a possible compensatory mechanism in mutant cells, so it appears that CBP and p300 levels are not highly limiting for some of their functions. Nevertheless, there are differences in the phenotypes of the various CBP and p300 mutant mice created to date, making it clear that there are either unique biochemical properties for each coactivator or that some cell types have a skewed ratio of CBP to p300 that makes one of them limiting upon mutation. (iii) Other transcriptional cofactors that are not highly related to CBP and p300 may supply redundant functions (e.g., other proteins that have histone acetyltransferase activity and bromodomains such as Gcn5, P/CAF, and TAF1). This point raises the prospect that coactivator networks are more broadly interconnected and robust than typically understood. But there are obviously limits to this proposition, as our studies show that either CBP or p300 is absolutely essential because T cells lacking both are not viable. So other cofactors may only be able to compensate under a limited number of situations. The identities of such factors are unknown, although recent genetic studies demonstrate that the combined dosage of various histone acetyltransferase proteins harboring bromodomains (p300 and Gcn5, and p300 and P/CAF) are not generally limiting for mouse development (158).
The creation of CBPflox and p300flox mice will now permit researchers to rigorously test whether either member of this small coactivator family is critical in specific cell lineages in vivo and to test their roles in endogenous gene expression ex vivo. Such analyses would be facilitated by the use of a Cre recombination-dependent GFP indicator allele to enable the FACS purification of cells with high frequencies (>90%) of floxed gene inactivation for functional and transcriptional studies ex vivo (143).
| ACKNOWLEDGMENTS |
|---|
This work was supported by NCI grant RO1 CA076385 (to P.K.B.), the Cancer Center (CORE) support grant P30 CA021765, and by the American Lebanese Syrian Associated Charities of St. Jude Children's Research Hospital.
| FOOTNOTES |
|---|
| REFERENCES |
|---|
|
|
|---|
2. Bachurski, C. J., G. H. Yang, T. A. Currier, R. M. Gronostajski, and D. Hong. 2003. Nuclear factor I/thyroid transcription factor 1 interactions modulate surfactant protein C transcription. Mol. Cell. Biol. 23:9014-9024.
3. Bai, L., and J. L. Merchant. 2000. Transcription factor ZBP-89 cooperates with histone acetyltransferase p300 during butyrate activation of p21waf1 transcription in human cells. J. Biol. Chem. 275:30725-30733.
4. Bai, R. Y., C. Koester, T. Ouyang, S. A. Hahn, M. Hammerschmidt, C. Peschel, and J. Duyster. 2002. SMIF, a Smad4-interacting protein that functions as a co-activator in TGFbeta signalling. Nat. Cell Biol. 4:181-190.[CrossRef][Medline]
5. Bailey, P., V. Sartorelli, Y. Hamamori, and G. E. Muscat. 1998. The orphan nuclear receptor, COUP-TF II, inhibits myogenesis by post-transcriptional regulation of MyoD function: COUP-TF II directly interacts with p300 and myoD. Nucleic Acids Res. 26:5501-5510.
6. Bannert, N., A. Avots, M. Baier, E. Serfling, and R. Kurth. 1999. GA-binding protein factors, in concert with the coactivator CREB binding protein/p300, control the induction of the interleukin 16 promoter in T lymphocytes. Proc. Natl. Acad. Sci. USA 96:1541-1546.
7. Barbacci, E., A. Chalkiadaki, C. Masdeu, C. Haumaitre, L. Lokmane, C. Loirat, S. Cloarec, I. Talianidis, C. Bellanne-Chantelot, and S. Cereghini. 2004. HNF1ß/TCF2 mutations impair transactivation potential through altered co-regulator recruitment. Hum. Mol. Genet. 13:3139-3149.
8. Barrios-Rodiles, M., K. R. Brown, B. Ozdamar, R. Bose, Z. Liu, R. S. Donovan, F. Shinjo, Y. Liu, J. Dembowy, I. W. Taylor, V. Luga, N. Przulj, M. Robinson, H. Suzuki, Y. Hayashizaki, I. Jurisica, and J. L. Wrana. 2005. High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307:1621-1625.
9. Barthel, R., A. V. Tsytsykova, A. K. Barczak, E. Y. Tsai, C. C. Dascher, M. B. Brenner, and A. E. Goldfeld. 2003. Regulation of tumor necrosis factor alpha gene expression by mycobacteria involves the assembly of a unique enhanceosome dependent on the coactivator proteins CBP/p300. Mol. Cell. Biol. 23:526-533.
10. Bavner, A., J. Matthews, S. Sanyal, J. A. Gustafsson, and E. Treuter. 2005. EID3 is a novel EID family member and an inhibitor of CBP-dependent co-activation. Nucleic Acids Res. 33:3561-3569.
11. Bereshchenko, O. R., W. Gu, and R. Dalla-Favera. 2002. Acetylation inactivates the transcriptional repressor BCL6. Nat. Genet. 32:606-613.[CrossRef][Medline]
12. Bernat, A., N. Avvakumov, J. S. Mymryk, and L. Banks. 2003. Interaction between the HPV E7 oncoprotein and the transcriptional coactivator p300. Oncogene 22:7871-7881.[CrossRef][Medline]
13. Bessa, M., M. K. Saville, and R. J. Watson. 2001. Inhibition of cyclin A/Cdk2 phosphorylation impairs B-Myb transactivation function without affecting interactions with DNA or the CBP coactivator. Oncogene 20:3376-3386.[CrossRef][Medline]
14. Bhakat, K. K., T. Izumi, S. H. Yang, T. K. Hazra, and S. Mitra. 2003. Role of acetylated human AP-endonuclease (APE1/Ref-1) in regulation of the parathyroid hormone gene. EMBO J. 22:6299-6309.[CrossRef][Medline]
15. Bhattacharya, S., C. L. Michels, M. K. Leung, Z. P. Arany, A. L. Kung, and D. M. Livingston. 1999. Functional role of p35srj, a novel p300/CBP binding protein, during transactivation by HIF-1. Genes Dev. 13:64-75.
16. Biery, M. C., F. J. Stewart, A. E. Stellwagen, E. A. Raleigh, and N. L. Craig. 2000. A simple in vitro Tn7-based transposition system with low target site selectivity for genome and gene analysis. Nucleic Acids Res. 28:1067-1077.
17. Billon, N., D. Carlisi, M. B. Datto, L. A. van Grunsven, A. Watt, X. F. Wang, and B. B. Rudkin. 1999. Cooperation of Sp1 and p300 in the induction of the CDK inhibitor p21WAF1/CIP1 during NGF-mediated neuronal differentiation. Oncogene 18:2872-2882.[CrossRef][Medline]
18. Blobel, G. A. 2002. CBP and p300: versatile coregulators with important roles in hematopoietic gene expression. J. Leukoc. Biol. 71:545-556.
19. Bouras, T., M. Fu, A. A. Sauve, F. Wang, A. A. Quong, N. D. Perkins, R. T. Hay, W. Gu, and R. G. Pestell. 2005. SIRT1 deacetylation and repression of p300 involves lysine residues 1020/1024 within the cell cycle regulatory domain 1. J. Biol. Chem. 280:10264-10276.
20. Bowen, H., A. Lapham, E. Phillips, I. Yeung, M. Alter-Koltunoff, B. Z. Levi, V. H. Perry, D. A. Mann, and C. H. Barton. 2003. Characterization of the murine Nramp1 promoter: requirements for transactivation by Miz-1. J. Biol. Chem. 278:36017-36026.
21. Braganca, J., J. J. Eloranta, S. D. Bamforth, J. C. Ibbitt, H. C. Hurst, and S. Bhattacharya. 2003. Physical and functional interactions among AP-2 transcription factors, p300/CREB-binding protein, and CITED2. J. Biol. Chem. 278:16021-16029.
22. Braganca, J., T. Swingler, F. I. Marques, T. Jones, J. J. Eloranta, H. C. Hurst, T. Shioda, and S. Bhattacharya. 2002. Human CREB-binding protein/p300-interacting transactivator with ED-rich tail (CITED) 4, a new member of the CITED family, functions as a co-activator for transcription factor AP-2. J. Biol. Chem. 277:8559-8565.
23. Burysek, L., W. S. Yeow, B. Lubyova, M. Kellum, S. L. Schafer, Y. Q. Huang, and P. M. Pitha. 1999. Functional analysis of human herpesvirus 8-encoded viral interferon regulatory factor 1 and its association with cellular interferon regulatory factors and p300. J. Virol. 73:7334-7342.
24. Castillo, A. I., A. M. Jimenez-Lara, R. M. Tolon, and A. Aranda. 1999. Synergistic activation of the prolactin promoter by vitamin D receptor and GHF-1: role of the coactivators, CREB-binding protein and steroid hormone receptor coactivator-1 (SRC-1). Mol. Endocrinol. 13:1141-1154.
25. Chakraborty, S., V. Senyuk, S. Sitailo, Y. Chi, and G. Nucifora. 2001. Interaction of EVI1 with cAMP-responsive element-binding protein-binding protein (CBP) and p300/CBP-associated factor (P/CAF) results in reversible acetylation of EVI1 and in co-localization in nuclear speckles. J. Biol. Chem. 276:44936-44943.
26. Chan, H. M., M. Krstic-Demonacos, L. Smith, C. Demonacos, and N. B. La Thangue. 2001. Acetylation control of the retinoblastoma tumour-suppressor protein. Nat. Cell Biol. 3:667-674.[CrossRef][Medline]
27. Chan, H. M., and N. B. La Thangue. 2001. p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J. Cell Sci. 114:2363-2373.
28. Chang, C. W., H. C. Chuang, C. Yu, T. P. Yao, and H. Chen. 2005. Stimulation of GCMa transcriptional activity by cyclic AMP/protein kinase A signaling is attributed to CBP-mediated acetylation of GCMa. Mol. Cell. Biol. 25:8401-8414.
29. Chen, J., S. S. Halappanavar, J. R. St-Germain, B. K. Tsang, and Q. Li. 2004. Role of Akt/protein kinase B in the activity of transcriptional coactivator p300. Cell. Mol. Life Sci. 61:1675-1683.[Medline]
30. Chen, J., J. R. St-Germain, and Q. Li. 2005. B56 Regulatory subunit of protein phosphatase 2A mediates valproic acid-induced p300 degradation. Mol. Cell. Biol. 25:525-532.
31. Chen, Q., D. H. Dowhan, D. Liang, D. D. Moore, and P. A. Overbeek. 2002. CREB-binding protein/p300 co-activation of crystallin gene expression. J. Biol. Chem. 277:24081-24089.
32. Clausen, B. E., C. Burkhardt, W. Reith, R. Renkawitz, and I. Forster. 1999. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 8:265-277.[CrossRef][Medline]
33. Cotter, M. A., II, and E. S. Robertson. 2000. Modulation of histone acetyltransferase activity through interaction of Epstein-Barr nuclear antigen 3C with prothymosin alpha. Mol. Cell. Biol 20:5722-5735.
34. Dai, P., H. Akimaru, Y. Tanaka, T. Maekawa, M. Nakafuku, and S. Ishii. 1999. Sonic Hedgehog-induced activation of the Gli1 promoter is mediated by GLI3. J. Biol. Chem. 274:8143-8152.
35. Dai, Y. S., P. Cserjesi, B. E. Markham, and J. D. Molkentin. 2002. The transcription factors GATA4 and dHAND physically interact to synergistically activate cardiac gene expression through a p300-dependent mechanism. J. Biol. Chem. 277:24390-24398.
36. Dai, Y. S., and B. E. Markham. 2001. p300 Functions as a coactivator of transcription factor GATA-4. J. Biol. Chem. 276:37178-37185.
37. De Leo, R., S. Miccadei, E. Zammarchi, and D. Civitareale. 2000. Role for p300 in Pax 8 induction of thyroperoxidase gene expression. J. Biol. Chem. 275:34100-34105.
38. Dietrich, P., I. Dragatsis, S. Xuan, S. Zeitlin, and A. Efstratiadis. 2000. Conditional mutagenesis in mice with heat shock promoter-driven cre transgenes. Mamm. Genome 11:196-205.[CrossRef][Medline]
39. Doucas, V., M. Tini, D. A. Egan, and R. M. Evans. 1999. Modulation of CREB binding protein function by the promyelocytic (PML) oncoprotein suggests a role for nuclear bodies in hormone signaling. Proc. Natl. Acad. Sci. USA 96:2627-2632.
40. Dowell, P., J. E. Ishmael, D. Avram, V. J. Peterson, D. J. Nevrivy, and M. Leid. 1997. p300 functions as a coactivator for the peroxisome proliferator-activated receptor alpha. J. Biol. Chem. 272:33435-33443.
41. Eckner, R., T. P. Yao, E. Oldread, and D. M. Livingston. 1996. Interaction and functional collaboration of p300/CBP and bHLH proteins in muscle and B-cell differentiation. Genes Dev. 10:2478-2490.
42. Ema, M., K. Hirota, J. Mimura, H. Abe, J. Yodoi, K. Sogawa, L. Poellinger, and Y. Fujii-Kuriyama. 1999. Molecular mechanisms of transcription activation by HLF and HIF1alpha in response to hypoxia: their stabilization and redox signal-induced interaction with CBP/p300. EMBO J. 18:1905-1914.[CrossRef][Medline]
43. Emelyanov, A. V., C. R. Kovac, M. A. Sepulveda, and B. K. Birshtein. 2002. The interaction of Pax5 (BSAP) with Daxx can result in transcriptional activation in B cells. J. Biol. Chem. 277:11156-11164.
44. Erickson, R. L., N. Hemati, S. E. Ross, and O. A. MacDougald. 2001. p300 coactivates the adipogenic transcription factor CCAAT/enhancer-binding protein alpha. J. Biol. Chem. 276:16348-16355.
45. Ernst, P., J. Wang, M. Huang, R. H. Goodman, and S. J. Korsmeyer. 2001. MLL and CREB bind cooperatively to the nuclear coactivator CREB-binding protein. Mol. Cell. Biol. 21:2249-2258.