Yanjie Chang,1,
Brett Schweers,2
Michael A. Dyer,2
Xiaojing Zhang,1
Simon W. Hayward,3 and
David W. Goodrich1*
Department of Pharmacology & Therapeutics, Roswell Park Cancer Institute, Buffalo, New York 14263,1 Department of Developmental Neurobiology, St. Jude Children's Research Hospital, Memphis, Tennessee 38105,2 Departments of Urologic Surgery and Cancer Biology, Vanderbilt University Medical Center, Nashville, Tennessee 372353
Received 31 August 2005/ Returned for modification 8 October 2005/ Accepted 4 December 2005
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Rb1 loss also compromises cell-type-specific fate determination and differentiation (8). The ability of pRb to bind and modulate the activity of tissue-specific transcription factors has been proposed to be the mechanism responsible for these effects on differentiation (21, 32, 47). Since differentiation is tightly coupled to cell cycle exit, however, it is also possible that pRb facilitates differentiation indirectly by restraining the cell cycle. Hence, a major challenge is determining whether pRb's effects on differentiation reflect direct, cell-type-specific mechanisms or whether they are an indirect consequence of pRb-mediated cell cycle regulation. Evidence from Rb1 null mouse retinae indicates there is only mild deregulation of retinal progenitor cell proliferation but a dramatic reduction in mature rod photoreceptors (12, 13, 30, 41, 43, 53). Lineage and gene expression analysis suggests that the role of pRb in rod photoreceptor differentiation is distinct from its role in retinal progenitor cell proliferation (53). The differentiation of fetal liver macrophages (FLM) and myoblasts also defective in the absence of Rb1. These defects may be distinct from pRb/E2F-mediated cell cycle control, as they are partially rescued by the compound loss of Id2 or N-ras, respectively (21, 46). Although such genetic studies support a direct role for Rb1 in cellular differentiation, they cannot exclude possible influences of pRb-mediated cell cycle regulation on differentiation since they utilize null Rb1 alleles.
To address this issue, we have generated a mutant Rb1 allele in the mouse that encodes a protein with an arginine-to-tryptophan substitution at codon 654 (R654W). This mutation is analogous to the naturally occurring human R661W Rb1 mutation associated with partially penetrant, hereditary retinoblastoma (28, 36). The R661W mutation belongs to a class of partially penetrant mutations that introduce changes in the primary amino acid sequence without affecting mRNA or protein expression (18). R661W pRb is unable to physically or functionally interact with E2F (37, 38, 44, 49). In vitro assays indicate R661W is defective for cell cycle control and yet retains some activity to promote cellular differentiation (44). Presumably, such residual functions account for the decreased penetrance and expressivity observed in hereditary retinoblastoma families carrying the allele. Phenotypic analysis of mice carrying the analogous R654W allele should allow the identification of cell-type-specific, pRb-dependent in vivo functions that are genetically separable from pRb/E2F-mediated cell cycle control.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Germ line-transmitting chimeras were generated from two targeted ES cell clones. Chimeras were mated to Zp3-cre mice to remove the floxed neo selection cassette, and agouti offspring were genotyped by Southern blotting of tail DNA using the 5'-flanking probe. Routine genotyping was performed by PCR amplification of tail DNA by using the primers 5'GGTCACTTGAATGTGATATATAGC3', 5'GCTATACGAAGTTATATCG3', and 5'TATGGAATGCTGCTAATAC3'.
Reporter gene assay.
The murine wild-type Rb1 expression plasmid is pECE-
B/X-HA, which was kindly provided by Brenda Gallie (University of Toronto). The substitution mutants were constructed by site-directed mutagenesis of the parent plasmid using the QuikChange method. The coding region of the expression plasmids was verified by DNA sequencing. C33A cells were obtained from ATCC and cultured in Dulbecco's modified Eagle's medium (BioWhittaker, Maryland) supplemented with 10% fetal bovine serum and antibiotics. The reporter gene assay was performed using an E2F1 promoter luciferase reporter plasmid and the E2F1 expression plasmid (34). A Renilla luciferase-expressing plasmid was used to normalize for transfection efficiency. These plasmids were transfected along with the Rb1-expressing plasmids into C33A cells by use of Lipofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer's recommendation. Two days after transfection, cells were assayed for firefly and Renilla luciferase activity by use of a dual luciferase reporter assay system (Promega, Madison, WI).
Fatty acid analysis. Tissues were homogenized in chloroform-methanol (2:1, vol/vol), and lipids were extracted as described previously (16). Individual lipid classes were separated by thin-layer chromatography using silica gel 60-Å plates developed in petroleum ether, ethyl ether, acetic acid (80:20:1) and visualized by use of rhodamine 6G. Phospholipids and triglycerides were scraped from the plates and methylated using BF3-methanol as described previously (33). The methylated fatty acids were extracted and analyzed by gas chromatography. Fatty acid methyl esters were identified by comparing the retention times to those of known standards. The inclusion of lipid standards with odd-chain fatty acids permitted lipid quantitation in the sample.
Cell cycle analysis.
The cell cycle distribution of asynchronously growing, early-passage (passage number, <5) mouse embryonic fibroblasts (MEF) was assayed by propidium iodide staining and flow cytometry. Histograms were modeled using Modfit software. For analysis of proliferation at high cell density, cultures were maintained at confluence for 3 days, and then bromodeoxyuridine (BrdU) was added for 15 h. Fixed cells were stained with BrdU antibody (Amersham, Piscataway, NJ) and fluorescein isothiocyanate-conjugated secondary antibody (Sigma, St. Louis, MO). For analysis of DNA damage response, subconfluent cultures were treated with 20 Gy
radiation or cisplatin at 16 µM. Fourteen hours later, BrdU was added, and incubation was continued for an additional 10 h before fixing and staining were done.
Protein analysis and histology. Multiple isolates of early-passage and late-passage (passage number, >25) MEF were extracted and protein lysates immunoprecipitated as previously described (27). E2F and Id2 antibodies were from Santa Cruz Biotechnology (E2F1, Sc-193; E2F2, Sc-633; E2F3, Sc-878; E2F4, Sc-1082; Id2, Sc-489). Rb1 protein captured in the immunoprecipitates was detected by Western blotting using the antibody G3-245 (Pharmingen, San Diego, CA). The same antibodies were used to measure input levels of E2F, Id2, or Rb1 protein in extracts by Western blotting. Hsp70 (SPA-820; Stressgen, Victoria, BC, Canada) or ß-actin (CP01; Oncogene Research Products, San Diego, CA) antibody staining served as loading controls.
Peripheral blood samples were obtained from umbilical cords, and smear samples were stained with Wright-Giemsa solution (Sigma, St. Louis, MO). Embryos were fixed in 10% formalin and embedded, and 5-µm sections were cut and stained with hematoxylin and eosin. The antibodies used for immunohistocytochemistry were F4/80 (A3-1), TER119 (both from Caltag Laboratories, Burlingame, CA), phospho-histone H3 (06-570; Upstate, Waltham, MA), and activated caspase-3 (9661; Cell Signaling, Beverly, MA).
Retinal analysis. The conditional, floxed allele of Rb1 was described previously (31). Cre-mediated excision from the floxed Rb1 allele in retinae was verified by PCR amplification of predicted recombination junction fragments (see Fig. S1B in the supplemental material). Possible Cre-mediated interchromosomal recombination between the floxed and R654W Rb1 alleles was not detected in genomic DNA from Chx10-cre; Rb1Lox/654 retinae by PCR amplification of the predicted recombination junctions. Hence, the phenotypes observed in chx10-cre; Rb1Lox/654 retinae were due to hemizygosity of the R654W allele.
Retinae from P14 pups were immunostained with antibodies to the major classes of retinal cell types (see Table S1 in the supplemental material). Retinal cryosections and dissociated retinae were immunolabeled as described previously (14, 15). To label S-phase retinal progenitor cells, freshly dissected retinae were incubated in 1 ml explant culture medium containing [3H]thymidine (5 µCi ml1; 89 Ci mmol1) or 10 µM BrdU for 1 h at 37°C. Autoradiography and BrdU detection were carried out as described previously (14, 15). For apoptosis analysis, a colorimetric terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling apoptosis system (Promega, Madison, WI) was used, with tyramide-Cy3 being used for detection. Real-time PCR was performed using an ABI 7900 HT sequence detection system (Applied Biosystems, Foster City, CA). Primers and probes were designed using Primer Express software. Probes were synthesized with 5'-labeled 6-carboxyfluorescein and 3'-labeled BMQ. RNA was prepared using Trizol, and cDNA was synthesized using a Superscript system (Invitrogen, Carlsbad, CA). Samples were analyzed in duplicate and normalized to glyceraldehyde-3-phosphate dehydrogenase and GPI1 expression levels.
| RESULTS |
|---|
|
|
|---|
|
R654W pRb is deficient in binding E2F1, E2F2, and E2F3 and regulating the cell cycle. To test the ability of wild-type and R654W pRb to associate with E2F, we analyzed total protein extracts from MEF of the relevant genotypes by coimmunoprecipitation. E2F1, E2F2, and E2F3 immunoprecipitates capture 10- to 20-fold less pRb from homozygous R654W MEF extracts than from wild-type extracts, based on the quantitation of relative signal levels from multiple blots (Fig. 2A). Input levels of E2F1 and E2F3 are noticeably higher in R654W MEF extracts than in wild-type extracts (Fig. 2A, right panel), so the coimmunoprecipitation results may overestimate the avidity of R654W pRb/E2F1 or pRb/E2F3 binding. Since E2F1 and E2F3 are themselves E2F regulated, this observation also indicates that any residual R654W pRb/E2F binding is unable to normally regulate E2F1 or E2F3 expression. The inability of R654W pRb to functionally interact with E2F1 has been confirmed by use of a sensitive reporter gene assay (Fig. 2B). Exogenously expressed wild-type pRb efficiently represses expression from a reporter gene driven by the E2F-responsive E2F1 promoter. In contrast, R654W pRb demonstrates no activity in this assay relative to the empty vector control or a previously characterized null pRb mutant (C706Y). As expected, the analogous human mutant (R661W) also fails to show significant activity in this assay, consistent with previously published data (1, 37, 44).
|
Previous reports demonstrated various cell cycle defects in Rb1 null MEF cultured in vitro. For example, loss of Rb1 caused a shift in cell cycle distribution in asynchronously growing MEF and compromised their ability to arrest at G1/S in response to DNA damage (19). Loss of Rb1 also compromised confluence-induced cell cycle arrest of MEF (24). We compared Rb1 null and R654W MEF in these aspects of in vitro cell cycle control. Relative to asynchronous cultures of wild-type MEF, both Rb1 null and homozygous R654W MEF had an increased fraction of cells in the S and G2/M phases of the cell cycle (Fig. 3A). Rb1 null and R654W MEF cultured at confluence also had equally high percentages of cells incorporating BrdU in S phase. In contrast, a low percentage of wild-type MEF incorporated BrdU when cultured at confluence (Fig. 3B). Finally, Rb1 null and R654W MEF failed to efficiently trigger G1/S cell cycle arrest in response to DNA damage. In contrast to wild-type MEF, both Rb1 null and R654W MEF exhibited large fractions of BrdU-positive cells subsequent to treatment by irradiation or with cisplatin (Fig. 3C).
|
R654W pRb partially rescues developmental defects characteristic of Rb1 null embryos. Intermating of heterozygous R654W mice failed to yield viable offspring homozygous for the R654W allele from among the more than 340 pups that were genotyped. Hence, the R654W allele was insufficient to support normal embryonic development. We assessed embryo cardiac function as a measure of viability from gestational ages E13.5 to E18.5 to compare the timings of lethality in Rb1 null and R654W homozygous embryos. Consistent with previously published reports (6, 22, 25), live Rb1 null embryos were rarely recovered at E15.5 (2 of 11 viable) and were never recovered at E16.5 or later (0 of 7 viable). In contrast, live homozygous R654W embryos were routinely recovered at E15.5 (11 of 18 viable) and E16.5 (6 of 11 viable). Live homozygous R654W embryos could be recovered as late as E17.5 (2 of 18 viable). R654W allele dosage did not have a significant effect on viability, since hemizygous R654W embryos (654/) survived at least as long as homozygous R654W embryos (16 of 18 viable at E15.5 and 3 of 7 viable at E17.5). On average, embryos homozygous for R654W Rb1 survived at least 2 days longer than Rb1 null embryos.
Homozygous or hemizygous R654W embryos exhibit gross morphological defects that are similar to those of Rb1 null embryos although generally less severe (Fig. 4A). For example, Rb1 null embryos are considerably smaller than wild-type littermates and exhibit pale coloration. Homozygous or hemizygous R654W embryos are larger than age-matched Rb1 null embryos and exhibit improved coloration. The pale color of Rb1 null embryos has been associated with deficient erythrocyte maturation (6, 22, 25). To assess erythrocyte maturation in R654W embryos, we counted the percentage of mature, enucleated erythrocytes in peripheral blood at different stages of gestation. The percentage of enucleated erythrocytes is significantly greater in the blood of homozygous or hemizygous R654W embryos than in that of Rb1 null embryos. At later stages of gestation, the percentage of enucleated erythrocytes approaches 90%, close to the percentage observed in wild-type embryos (Fig. 4B). A small percentage of erythrocytes still exhibit enucleation defects and other morphological abnormalities in E17.5 homozygous or hemizygous R654W embryos (Fig. 4C). Hence, the R654W allele partially rescues the erythrocyte maturation defect associated with the complete loss of Rb1.
|
|
|
Id2 is an inhibitor of the tissue-restricted transcription factor PU.1, a regulator of macrophage differentiation (35). Rb1 protein binds Id2 and prevents it from inhibiting PU.1, thereby promoting FLM differentiation (21). We have tested whether this mechanism may account for the improved FLM differentiation observed in R654W embryos. R654W pRb retains the ability to bind Id2, as assessed by coimmunoprecipitation; Id2 immunoprecipitates from MEF or liver extracts capture at least as much R654W pRb as wild-type pRb (Fig. 4D). Hence, the ability to physically interact with Id2 is retained by R654W pRb, and this interaction may directly contribute to the improved differentiation of FLM by blocking Id2-mediated inhibition of PU.1. Further, improved FLM differentiation may indirectly contribute to the increased erythrocyte maturation observed in homozygous R654W embryos.
Retinal defects in homozygous R654W mice. During normal development of the mouse retina, Rb1 is expressed in proliferating retinal progenitor cells and postmitotic neurons and glia (53). Loss of Rb1 causes mild deregulation of retinal progenitor cell proliferation, yet there is a dramatic loss of rod photoreceptors. Rather than switching fates, cells destined to become rod photoreceptors remain immature and express retinal progenitor cell markers, such as Pax6 and Chx10. We have examined postnatal retinae to assess the effects of R654W pRb on retinal progenitor cell differentiation. To overcome the embryonic lethality in the mutant mice, we have inactivated a floxed wild-type Rb1 allele specifically in the retina in a heterozygous R654W background with a Chx10-cre transgene. The mating generates offspring heterozygous for the R654W allele, and hence viable, but hemizygous for R654W in retinal cells. Predominant expression of the R654W allele in Chx10-cre; Rb1Lox/654 retinae has been confirmed by RT-PCR and DNA sequence analysis of RNA (see Fig. S1A in the supplemental material).
Retinae from P14 pups were immunostained with antibodies to the major classes of retinal cell types (see Table S1 in the supplemental material). Rod photoreceptors were significantly reduced in hemizygous R654W retinae, and there were no changes in the quantities of other major cell types (Table 2 and Fig. 6). In particular, cones and bipolar cells differentiated normally (Fig. 6 and Fig. S2 in the supplemental material). Horizontal cell synaptogenesis was also defective in the Chx10-cre; Rb1Lox/654 retinae, as previously observed in Rb1 null retinae (12). Proliferating cells incorporating [3H]thymidine expressed markers of retinal progenitor cells, including Chx10 and Pax6. For example, the proportion of Pax6-positive, [3H]thymidine-positive cells to [3H]thymidine-positive cells was 14% ± 2.5% in P14 Chx10-cre; Rb1Lox/654 retinae (Table 2). No [3H]thymidine-positive cells were detected in the retinae from control littermates (Chx10-cre; Rb1654/+ or Chx10-cre; Rb1+/). Ectopic Pax6- and Chx10-positive cells were observed in the outer nuclear layer, consistent with the observation that cells that normally differentiated into rods remained as immature cells (12, 53). Real-time RT-PCR demonstrated that retinal progenitor cell markers Fgf15, Eya2, and Sfrp1 (2) were upregulated in the Chx10-cre; Rb1Lox/654 retinae. Expression of the E2F-regulated p107 gene was also upregulated in these retinae, consistent with the lack of pRb/E2F1-, pRb/E2F2-, and pRb/E2F3-mediated transcriptional regulation in these cells. Analysis of E14.5 retinae from homozygous R654W embryos and their heterozygous and wild-type littermates verified that there was no proliferation or differentiation defect in the embryonic retina that could contribute to the failure of rods to form (see Fig. S3 in the supplemental material). In sum, the phenotype of Chx10-cre; Rb1Lox/654 retinae was indistinguishable from that of Chx10-cre; Rb1Lox/ retinae.
|
|
| DISCUSSION |
|---|
|
|
|---|
An E2F-independent mechanism involving pRb/Skp2 interaction and stabilization of p27kip1 has also been proposed to contribute to pRb cell cycle regulation, and human R661W pRb apparently retains this activity (23). We have been able to detect stable pRb/Skp2 interaction in MEF, liver, or rescued prostate epithelial cell extracts, although the R654W pRb typically interacts less well with Skp2 (H. Sun and D. W. Goodrich, unpublished). While pRb/Skp2 binding is detectable, the level of p27Kip1 is no greater in wild-type extracts than in Rb1 null extracts. The pRb/Skp2 mechanism has originally been identified in osteosarcoma cell lines by use of exogenously expressed Rb1 proteins. Hence, the disparity between our results and those of Ji et al. (23) may be due to the different cell types in which the experiments are performed, differences between human pRb and mouse pRb, or differences in the effects of endogenous versus ectopic pRb expression.
Despite the loss of cell cycle control observed in R654W embryos, embryonic development is partially rescued relative to the development of Rb1 null embryos. Partial rescue is associated with a significant improvement in the differentiation of some tissues but not of others. Thus, differentiation in these cell types requires a function of pRb that is independent of its general ability to bind E2F1, E2F2, and E2F3 and regulate the cell cycle. We propose a model for three tissue-specific mechanisms that pRb may use to directly influence differentiation (Fig. 7). We suggest that E2F1, E2F2, and E2F3 facilitate expression of a gene that prevents rod cell fate specification in the retina. The pRb/E2F1, pRb/E2F2, and pRb/E2F3 complexes would silence expression of this gene, permitting rod cell differentiation. Previous characterizations of Rb1 null retinae suggest that impaired rod photoreceptor differentiation is unrelated to progenitor cell cycle control (12, 53). Hence, the hypothetical pRb/E2F1-, pRb/E2F2-, or pRb/E2F3-regulated gene would function primarily in differentiation and not in the cell cycle. This proposed mechanism is consistent with the inability of R654W pRb to affect rod cell differentiation and the observation that a number of potential E2F1 target genes are involved in cellular differentiation (3). While other, unidentified pRb protein interactions lost in the R654W mutant may also be involved, our hypothesis makes the testable prediction that the compound loss Rb1 and E2F1, E2F2, or E2F3 will rescue rod cell differentiation. Loss of E2F4 causes a cell-autonomous defect in erythrocyte maturation similar to that observed in Rb1 null mice (20, 39). The fact that both Rb1 and E2F4 null mice exhibit an overlapping phenotype suggests that the pRb/E2F4 interaction may be required; the pRb/E2F4 complex may silence the expression of an inhibitor of erythrocyte maturation. This hypothesis is supported by the observations that R654W pRb retains the ability to stably bind E2F4 and that this correlates with improved erythrocyte maturation in R654W embryos. Additional reconstitution and conditional ablation experiments will be required to critically test this hypothesis since pRb also makes cell-extrinsic contributions to erythrocyte maturation. Id2 is an inhibitor of the tissue-restricted transcription factor PU.1, which controls the expression of genes important for macrophage differentiation (35). Binding of pRb to Id2 blocks Id2-mediated inhibition of PU.1, facilitating normal FLM differentiation in a cell-autonomous manner (21). Since R654W pRb retains the ability to interact with Id2, this mechanism is proposed to account for the improved FLM differentiation observed in R654W embryos.
|
| ACKNOWLEDGMENTS |
|---|
This work was supported by grants from the NIH to D.W.G. (CA70292), S.W.H. (CA96403), and M.A.D. (EY014867). The Charlotte Geyer Foundation (D.W.G.), the American Lebanese Syrian Associated Charities (M.A.D.), and Research to Prevent Blindness (M.A.D.) also supported the work described. M.A.D. is a Pew Scholar.
| FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
These authors contributed equally to the work. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Blackshaw, S., S. Harpavat, J. Trimarchi, L. Cai, H. Huang, W. P. Kuo, G. Weber, K. Lee, R. E. Fraioli, S. H. Cho, R. Yung, E. Asch, L. Ohno-Machado, W. H. Wong, and C. L. Cepko. 2004. Genomic analysis of mouse retinal development. PLoS Biol. 2:1411-1431.
3. Bracken, A. P., M. Ciro, A. Cocito, and K. Helin. 2004. E2F target genes: unraveling the biology. Trends Biochem. Sci. 29:409-417.[CrossRef][Medline]
4. Chan, H. M., L. Smith, and N. B. La Thangue. 2001. Role of LXCXE motif-dependent interactions in the activity of the retinoblastoma protein. Oncogene 20:6152-6163.[CrossRef][Medline]
5. Clark, A. J., K. M. Doyle, and P. O. Humbert. 2004. Cell-intrinsic requirement for pRb in erythropoiesis. Blood 104:1324-1326.
6. Clarke, A. R., E. R. Maandag, M. van Roon, N. M. van der Lugt, M. van der Valk, M. L. Hooper, A. Berns, and H. te Riele. 1992. Requirement for a functional Rb-1 gene in murine development. Nature 359:328-330.[CrossRef][Medline]
7. Classon, M., and N. Dyson. 2001. p107 and p130: versatile proteins with interesting pockets. Exp. Cell Res. 264:135-147.[CrossRef][Medline]
8. Classon, M., and E. Harlow. 2002. The retinoblastoma tumour suppressor in development and cancer. Nat. Rev. Cancer 2:910-917.[CrossRef][Medline]
9. Cobrinik, D. 2005. Pocket proteins and cell cycle control. Oncogene 24:2796-2809.[CrossRef][Medline]
10. Dick, F. A., E. Sailhamer, and N. J. Dyson. 2000. Mutagenesis of the pRB pocket reveals that cell cycle arrest functions are separable from binding to viral oncoproteins. Mol. Cell. Biol. 20:3715-3727.
11. Dimova, D. K., and N. J. Dyson. 2005. The E2F transcriptional network: old acquaintances with new faces. Oncogene 24:2810-2826.[CrossRef][Medline]
12. Donovan, S. L., and M. A. Dyer. 2004. Developmental defects in Rb-deficient retinae. Vision Res. 44:3323-3333.[CrossRef][Medline]
13. Dyer, M. A., and R. Bremner. 2005. The search for the retinoblastoma cell of origin. Nat. Rev. Cancer 5:91-101.[Medline]
14. Dyer, M. A., and C. L. Cepko. 2001. p27Kip1 and p57Kip2 regulate proliferation in distinct retinal progenitor cell populations. J. Neurosci. 21:4259-4271.
15. Dyer, M. A., and C. L. Cepko. 2001. The p57Kip2 cyclin kinase inhibitor is expressed by a restricted set of amacrine cells in the rodent retina. J. Comp. Neurol. 429:601-614.[CrossRef][Medline]
16. Folch, J., M. Lees, and G. H. Sloane-Stanley. 1957. A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226:497-509.
17. Goodrich, D. W., N. P. Wang, Y. W. Qian, E. Y. Lee, and W. H. Lee. 1991. The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell 67:293-302.[CrossRef][Medline]
18. Harbour, J. W. 2001. Molecular basis of low-penetrance retinoblastoma. Arch. Ophthalmol. 119:1699-1704.
19. Harrington, E. A., J. L. Bruce, E. Harlow, and N. Dyson. 1998. pRB plays an essential role in cell cycle arrest induced by DNA damage. Proc. Natl. Acad. Sci. USA 95:11945-11950.
20. Humbert, P. O., C. Rogers, S. Ganiatsas, R. L. Landsberg, J. M. Trimarchi, S. Dandapani, C. Brugnara, S. Erdman, M. Schrenzel, R. T. Bronson, and J. A. Lees. 2000. E2F4 is essential for normal erythrocyte maturation and neonatal viability. Mol. Cell 6:281-291.[CrossRef][Medline]
21. Iavarone, A., E. R. King, X. M. Dai, G. Leone, E. R. Stanley, and A. Lasorella. 2004. Retinoblastoma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 432:1040-1045.[CrossRef][Medline]
22. Jacks, T., A. Fazeli, E. M. Schmitt, R. T. Bronson, M. A. Goodell, and R. A. Weinberg. 1992. Effects of an Rb mutation in the mouse. Nature 359:295-300.[CrossRef][Medline]
23. Ji, P., H. Jiang, K. Rekhtman, J. Bloom, M. Ichetovkin, M. Pagano, and L. Zhu. 2004. An Rb-Skp2-p27 pathway mediates acute cell cycle inhibition by Rb and is retained in a partial-penetrance Rb mutant. Mol. Cell 16:47-58.[CrossRef][Medline]
24. Lee, E. Y., H. Cam, U. Ziebold, J. B. Rayman, J. A. Lees, and B. D. Dynlacht. 2002. E2F4 loss suppresses tumorigenesis in Rb mutant mice. Cancer Cell 2:463-472.[CrossRef][Medline]
25. Lee, E. Y., C. Y. Chang, N. Hu, Y. C. Wang, C. C. Lai, K. Herrup, and W. H. Lee. 1992. Mice deficient for Rb are nonviable and show defects in neurogenesis and haematopoiesis. Nature 359:288-294.[CrossRef][Medline]
26. Lee, M. H., B. O. Williams, G. Mulligan, S. Mukai, R. T. Bronson, N. Dyson, E. Harlow, and T. Jacks. 1996. Targeted disruption of p107: functional overlap between p107 and Rb. Genes Dev. 10:1621-1632.
27. Li, Y., X. Wang, X. Zhang, and D. W. Goodrich. 2005. Human hHpr1/p84/Thoc1 regulates transcriptional elongation and physically links RNA polymerase II and RNA processing factors. Mol. Cell. Biol. 25:4023-4033.
28. Lohmann, D. R., B. Brandt, W. Hopping, E. Passarge, and B. Horsthemke. 1994. Distinct RB1 gene mutations with low penetrance in hereditary retinoblastoma. Hum. Genet. 94:349-354.[CrossRef][Medline]
29. Maandag, E. C., M. van der Valk, M. Vlaar, C. Feltkamp, J. O'Brien, M. van Roon, L. N. van der Lugt, A. Berns, and H. te Reile. 1994. Developmental rescue of an embryonic-lethal mutation in the retinoblastoma gene in chimeric mice. EMBO J. 13:4260-4268.[Medline]
30. MacPherson, D., J. Sage, T. Kim, D. Ho, M. E. McLaughlin, and T. Jacks. 2004. Cell type-specific effects of Rb deletion in the murine retina. Genes Dev. 18:1681-1694.
31. Marino, S., M. Vooijs, H. van Der Gulden, J. Jonkers, and A. Berns. 2000. Induction of medulloblastomas in p53-null mutant mice by somatic inactivation of Rb in the external granular layer cells of the cerebellum. Genes Dev. 14:994-1004.
32. Miccadei, S., C. Provenzano, M. Mojzisek, P. G. Natali, and D. Civitareale. 2005. Retinoblastoma protein acts as Pax 8 transcriptional coactivator. Oncogene 24:6993-7001.[CrossRef][Medline]
33. Morrison, W. R., and L. M. Smith. 1964. Preparation of fatty acid methyl esters and dimethylacetals from lipids with boron fluoride-methanol. J. Lipid Res. 5:600-608.[Medline]
34. Neuman, E., E. K. Flemington, W. R. Sellers, and W. G. Kaelin, Jr. 1994. Transcription of the E2F-1 gene is rendered cell cycle dependent by E2F DNA-binding sites within its promoter. Mol. Cell. Biol. 14:6607-6615.
35. Oikawa, T., T. Yamada, F. Kihara-Negishi, H. Yamamoto, N. Kondoh, Y. Hitomi, and Y. Hashimoto. 1999. The role of Ets family transcription factor PU.1 in hematopoietic cell differentiation, proliferation and apoptosis. Cell Death Differ. 6:599-608.[CrossRef][Medline]
36. Onadim, Z., A. Hogg, P. N. Baird, and J. K. Cowell. 1992. Oncogenic point mutations in exon 20 of the RB1 gene in families showing incomplete penetrance and mild expression of the retinoblastoma phenotype. Proc. Natl. Acad. Sci. USA 89:6177-6181.
37. Otterson, G. A., W. Chen, A. B. Coxon, S. N. Khleif, and F. J. Kaye. 1997. Incomplete penetrance of familial retinoblastoma linked to germ-line mutations that result in partial loss of RB function. Proc. Natl. Acad. Sci. USA 94:12036-12040.
38. Otterson, G. A., S. Modi, K. Nguyen, A. B. Coxon, and F. J. Kaye. 1999. Temperature-sensitive RB mutations linked to incomplete penetrance of familial retinoblastoma in 12 families. Am. J. Hum. Genet. 65:1040-1046.[CrossRef][Medline]
39. Rempel, R. E., M. T. Saenz-Robles, R. Storms, S. Morham, S. Ishida, A. Engel, L. Jakoi, M. F. Melhem, J. M. Pipas, C. Smith, and J. R. Nevins. 2000. Loss of E2F4 activity leads to abnormal development of multiple cellular lineages. Mol. Cell 6:293-306.[CrossRef][Medline]
40. Saavedra, H. I., L. Wu, A. de Bruin, C. Timmers, T. J. Rosol, M. Weinstein, M. L. Robinson, and G. Leone. 2002. Specificity of E2F1, E2F2, and E2F3 in mediating phenotypes induced by loss of Rb. Cell Growth Differ. 13:215-225.
41. Sage, J., A. L. Miller, P. A. Perez-Mancera, J. M. Wysocki, and T. Jacks. 2003. Acute mutation of retinoblastoma gene function is sufficient for cell cycle re-entry. Nature 424:223-228.[CrossRef][Medline]
42. Sage, J., G. J. Mulligan, L. D. Attardi, A. Miller, S. Chen, B. Williams, E. Theodorou, and T. Jacks. 2000. Targeted disruption of the three Rb-related genes leads to loss of G(1) control and immortalization. Genes Dev. 14:3037-3050.
43. Schweers, B. A., and M. A. Dyer. 2005. Perspective: new genetic tools for studying retinal development and disease. Vis. Neurosci. 22:553-560.[Medline]
44. Sellers, W. R., B. G. Novitch, S. Miyake, A. Heith, G. A. Otterson, F. J. Kaye, A. B. Lassar, and W. G. Kaelin, Jr. 1998. Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth. Genes Dev. 12:95-106.
45. Spike, B. T., A. Dirlam, B. C. Dibling, J. Marvin, B. O. Williams, T. Jacks, and K. F. Macleod. 2004. The Rb tumor suppressor is required for stress erythropoiesis. EMBO J. 23:4319-4329.[CrossRef][Medline]
46. Takahashi, C., R. T. Bronson, M. Socolovsky, B. Contreras, K. Y. Lee, T. Jacks, M. Noda, R. Kucherlapati, and M. E. Ewen. 2003. Rb and N-ras function together to control differentiation in the mouse. Mol. Cell. Biol. 23:5256-5268.
47. Thomas, D. M., S. A. Carty, D. M. Piscopo, J. S. Lee, W. F. Wang, W. C. Forrester, and P. W. Hinds. 2001. The retinoblastoma protein acts as a transcriptional coactivator required for osteogenic differentiation. Mol. Cell 8:303-316.[CrossRef][Medline]
48. Tsai, K. Y., Y. Hu, K. F. Macleod, D. Crowley, L. Yamasaki, and T. Jacks. 1998. Mutation of E2f-1 suppresses apoptosis and inappropriate S phase entry and extends survival of Rb-deficient mouse embryos. Mol. Cell 2:293-304.[CrossRef][Medline]
49. Whitaker, L. L., H. Su, R. Baskaran, E. S. Knudsen, and J. Y. J. Wang. 1998. Growth suppression by an E2F-binding-defective retinoblastoma protein (RB): contribution from the RB C pocket. Mol. Cell. Biol. 18:4032-4042.
50. Williams, B. O., E. M. Schmitt, L. Remington, R. T. Bronson, D. M. Albert, R. A. Weinberg, and T. Jacks. 1994. Extensive contribution of Rb-deficient cells to adult chimeric mice with limited histopathological consequences. EMBO J. 13:4251-4259.[Medline]
51. Wu, L., A. de Bruin, H. I. Saavedra, M. Starovic, A. Trimboli, Y. Yang, J. Opavska, P. Wilson, J. C. Thompson, M. C. Ostrowski, T. J. Rosol, L. A. Woollett, M. Weinstein, J. C. Cross, M. L. Robinson, and G. Leone. 2003. Extra-embryonic function of Rb is essential for embryonic development and viability. Nature 421:942-947.[CrossRef][Medline]
52. Wu, L., C. Timmers, B. Maiti, H. I. Saavedra, L. Sang, G. T. Chong, F. Nuckolls, P. Giangrande, F. A. Wright, S. J. Field, M. E. Greenberg, S. Orkin, J. R. Nevins, M. L. Robinson, and G. Leone. 2001. The E2F1-3 transcription factors are essential for cellular proliferation. Nature 414:457-462.[CrossRef][Medline]
53. Zhang, J., J. Gray, L. Wu, G. Leone, S. Rowan, C. L. Cepko, X. Zhu, C. M. Craft, and M. A. Dyer. 2004. Rb regulates proliferation and rod photoreceptor development in the mouse retina. Nat. Genet. 36:351-360.[CrossRef][Medline]
54. Ziebold, U., T. Reza, A. Caron, and J. A. Lees. 2001. E2F3 contributes both to the inappropriate proliferation and to the apoptosis arising in Rb mutant embryos. Genes Dev. 15:386-391.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||