![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
The Wellcome Trust Biocentre, School of Life Sciences, University of Dundee, Dundee, United Kingdom,1 Neurology Centre of Excellence for Drug Discovery, GlaxoSmithKline, Essex, United Kingdom2
Received 25 August 2005/ Returned for modification 23 October 2005/ Accepted 30 November 2005
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The cellular expression pattern of Sn is well conserved between mammalian species, being restricted to subsets of tissue macrophages, especially those in secondary lymphoid organs (6, 16, 41). In the mouse, Sn is highly expressed on macrophages within the subcapsular sinus and medulla of lymph nodes and on marginal metallophilic macrophages in spleen (9, 26). Intermediate levels are expressed on 50 to 90% of resident bone marrow macrophages, and low but detectable levels are found for Kupffer cells, red pulp macrophages, and alveolar macrophages (9, 10). Besides expression on subsets of resident tissue macrophages, Sn is expressed at high levels on inflammatory macrophages in rheumatoid arthritis, atherosclerosis (16), experimental autoimmune uveoretinitis (17), experimental allergic encephalomyelitis (37), and nephritis (5) and on macrophages that infiltrate human breast tumors (35). Very recent reports show that Sn can also be expressed by certain dendric cells (2, 20) and on inflammatory blood monocytes following human immunodeficiency virus infection (39).
The biological functions of Sn are still unresolved, but its structural features and high conservation on macrophages point to a role in mediating cell-cell interactions. Cells from the granulocyte lineage have been shown to express high levels of Sn counter-receptors, and Sn was shown to cluster in contact zones between Sn-positive macrophages and developing granulocytes in bone marrow (8, 13). This gave rise to the hypothesis that Sn may be involved in granulocyte development or the retention of granulocytes within the bone marrow or at sites of inflammation. Other studies have demonstrated the binding of Sn to murine erythroleukemia cells (42) as well as T and B cells (44). In the spleen and lymph nodes, B cells are located adjacent to highly Sn-positive macrophages and, in a graft-versus-leukemia model, Sn-positive macrophages in the liver were seen to form clusters with CD8 T cells (32). It is therefore tempting to speculate that Sn may be involved in some aspects of lymphocyte trafficking or activation. The glycoproteins CD43, PSGL-1, and MUC1 have been shown to bind to Sn in a sialic acid-dependent manner and may therefore represent in vivo counter-receptors for Sn (35, 45). In addition, on its extracellular region, Sn displays up to 15 N-linked glycans which have been shown to function as carbohydrate ligands for other mammalian lectins, such as the cysteine-rich domain of the mannose receptor which binds GalNAc-4-SO4-modified glycans (23, 25) and the macrophage galactose C-type lectin 1 (MGL-1) which recognizes Gal and GalNAc residues (21). In the latter case, Sn-MGL-1 interactions have been implicated inthe trafficking functions of macrophages migrating from skin into draining lymph nodes during immune responses.
Although Sn does not mediate phagocytosis, there are some indications that it may be involved in endocytosis of smaller particles and certain pathogens. By immunoelectron microscopy, Sn was found in endosome-like membrane invaginations that were clearly distinct from phagosomes and lysosomes or Golgi (41). Sn on porcine alveolar macrophages has been shown to be the receptor for porcine reproductive and respiratory syndrome virus and to mediate the viral entry via endocytosis (46). In addition, Sn can bind the sialylated lipooligosaccharide of Neisseria meningitidis and enhance phagocytosis of intact bacteria by macrophages (18).
In the present study, we describe the generation of Sn-deficient mice in order to address the biological functions of Sn in vivo. We demonstrate that these mice are viable and show only a minimal phenotype under specific-pathogen-free conditions. Analysis of cell populations in bone marrow, blood, and peritoneal cavity did not reveal any major alteration, and we also did not observe any major differences in acute inflammatory responses to thioglycolate compared with wild-type controls. However, there were small differences in the CD8-positive T-cell population and in B220-positive B cells in spleen and lymph nodes. The immunoglobulin G (IgG) titers were normal, but there was a reduction in serum IgM in Sn-deficient mice. This overall minimal phenotype makes these mice a good model to investigate the role of Sn following immune responses and in inflammatory diseases like rheumatoid arthritis.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(145-2C11, PE), CD4 (PE), CD19 (PE), F4/80 (biotin), GR-1 (PE), and streptavidin (allophycocyanin) were purchased from Caltag (Towcester, United Kingdom). CD5 (53-7.3, biotin) and CD21 (7E9, FITC) were from BD PharMingen (San Diego, CA), CD23 (2G8, PE) was from Southern Biotechnology (Birmingham, AL), CCR3 (PE) was from R&D Systems (Minneapolis, MN), and MAb anti-rat IgG2a (FITC) was from Serotec (Kidlington, Oxford, United Kingdom). FITC-conjugated streptavidin was purchased from Vector Laboratories (Peterborough, United Kingdom). Affinity-purified polyclonal sheep anti-Siglec-E (FITC) and Siglec-F (Alexa 448 or biotin) were prepared and labeled in our own lab (48). CR-Fc fusion protein and FA/11 anti-mouse CD68 were kind gifts from Luisa Martinez-Pomares (Sir William Dunn School of Pathology, Oxford, United Kingdom). Rat anti-Sn MAbs 1C2 and SER-4 (both IgG2a) were used as tissue supernatant (9) and rabbit anti-Sn serum was used as an affinity-purified antibody (11). Generation of Sn-deficient mice. Sn-deficient mice were generated by targeting the Sn gene in embryonic stem (ES) cells by homologous recombination (Fig. 1A). The Sn homology region was subcloned from a phage library (EMBL3) of 129/Sv mouse genomic DNA (31) kindly provided by Anna Marie-Frishauf, CRUK, London, United Kingdom. A 4.9-kb EcoRI fragment was cloned into the multiple cloning site of vector pTZ18U (Bio-Rad, Herts, United Kingdom). The Sn gene was disrupted by insertion of a neomycin resistance gene expression cassette (neomycin cassette, derived from pMC1neopA; Stratagene, Cambridge, United Kingdom) into the unique XhoI site in exon III (Fig. 1A). For negative selection, a SalI/XhoI diphtheria toxin A expression cassette fragment was cloned from pSP72-TKPro-DTA-polyA (kindly supplied by F. Otto, ICRF, London, United Kingdom) into the SalI site within the multiple cloning site 5' of the homology region. Constructs were linearized with SalI prior to transfection into R1 mouse ES cells at CRUK Clare Hall Laboratories. G418-resistant clones were screened for homologous recombination by Southern blotting using an XbaI-EcoRI probe (Fig. 1A). Multiple vector integrations were excluded by Southern blotting using the neomycin cassette as a probe. Two independently obtained ES clones that had undergone homologous recombination were used for blastocyst injection, and the resulting chimeric mice were bred to C57BL/6 mice. All mice used for the phenotype analysis were intercross offspring of heterozygotes backcrossed for eight generations onto a C57BL/6 background unless stated otherwise; age- and sex-matched mice at 8 to 12 weeks of age were used in all experiments. Genotyping of mice was performed by PCR using the following primers: for, CACCACGGTCACTGTGACAA, and rev, GGCCATATGTAGGGTCGTCT (MWG, Milton Keynes, United Kingdom). This resulted in a 468-bp product for the wild-type allele and a 1,729-bp product for the mutated allele (Fig. 1B). Mice were bred and maintained under specific-pathogen-free conditions. Animal experimentation was approved by the University of Dundee Animal Ethics Committee and was done under United Kingdom Home Office Project License PPL60/3187.
|
CT values were calculated after confirming similar amplification efficiencies of target and endogenous control cDNA. Immunohistochemistry and immunofluorescence. Spleens and inguinal lymph nodes were embedded in OCT resin (Agar Scientific, Essex, United Kingdom) and frozen in a 2-methylbutane/dry ice bath. Cryostat sections (7 µm) were fixed for 10 min in acetone. For immunofluorescence, slides were blocked with 4% sheep serum in phosphate-buffered saline (PBS) and stained with polyclonal antibody anti-Sn (1 µg/ml) and CR-Fc (5 µg/ml) in 0.25% bovine serum albumin (BSA)/PBS, followed by the secondary antibodies goat anti-human IgG Fc-FITC (1:60) and goat anti-rabbit IgG-tetramethyl rhodamine isocyanate (1:30) for 1 h in a humidified container. Sections were mounted with 20% wt/vol Mowiol 4-88 (Calbiochem) and 20% vol/vol glycerol in PBS and analyzed using an Axioskop microscope (Zeiss, Munich, Germany) and Axio Vision 3.0 software. Immunoperoxidase staining of tissue sections was carried out using the avidin-biotin-peroxidase staining system (Vectastain; Vector Laboratories, Peterborough, United Kingdom) as described previously (9).
Flow cytometry. Single-cell suspensions were prepared from spleen, femoral bone marrow, lymph nodes, peritoneal cavity, and blood collected from mice euthanized with CO2. In some experiments, spleen and lymph nodes were digested with 0.1% collagenase A (Roche, East Sussex, United Kingdom) and 0.01% DNase (Roche) in RPMI 1640 with 5% fetal calf serum for 30 min at 37°C. Cells were separated by passing them through a cell strainer and washed in PBS-EDTA (5 mM). Prior to staining, blood, splenocytes, and bone marrow cells were subjected to red blood cell lysis (RBL buffer; Sigma). Cells were routinely incubated with 2.4G2 MAb to block Fc receptors and subsequently labeled with antibodies diluted in PBA (PBS, 1% BSA, 0.05% azide) for 20 min on ice. In some cases, a secondary incubation step using an FITC-labeled secondary antibody or allophycocyanin- or FITC-conjugated streptavidin was added. Cells were finally stained with 7-amino actinomycin D to exclude dead cells and analyzed using a FACSCalibur (Becton Dickinson, Oxford, United Kingdom) and CellQuest software.
Thioglycolate-induced inflammation. Mice were injected intraperitoneally with 0.5 ml 3.8% Brewer modified thioglycolate medium (Becton Dickinson). After 4 h or 18 h, animals were euthanized by CO2 inhalation and cells were collected by peritoneal lavage using 5 ml of cold PBS.
Isotype specific ELISA. Antibody titers were determined by enzyme-linked immunosorbent assay (ELISA) using Immulon 4 HBX plates (Thermo Labsystems) coated with goat anti-mouse immunoglobulin (5 µg/ml; Southern Biotechnology, Birmingham, AL) diluted in carbonate buffer. A standard curve was generated with purified mouse IgM, IgG1, IgG2a, IgG2b, and IgG3 (Southern Biotechnology). Plates were blocked with 1% BSA-0.2% gelatin in PBS for 1 h at room temperature, and sera were diluted in blocking buffer (IgM and IgG1, 1:5,000; IgG2a and IgG3, 1:10,000; and IgG2a, 1:25;000) and allowed to bind to the plate for 1 h at room temperature. Antibodies were detected by alkaline phosphatase-coupled immunoglobulin isotype-specific antibodies (Southern Biotechnology) and the substrate fluorescein diphosphate (Molecular Probes, Paisley, United Kingdom). Optical densities at 530 nm were measured with a fluorescent plate reader (Cytofluor; PerSeptive Biosystems).
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Sn expression. Sn is expressed at its highest levels on the subcapsular sinus macrophages in lymph nodes and on marginal metallophilic macrophages in spleen. In order to verify the absence of Sn protein in Sn-deficient mice, we performed fluorescence-activated cell sorter (FACS) analysis for mesenteric lymph node single-cell suspensions. Using a mixture of two monoclonal antibodies specific for Sn, IC2 and SER-4 directed to domains 1 and 3, respectively, about 0.35% of cells isolated from lymph nodes of wild-type mice were strongly labeled. In contrast, no staining above the isotype control background was observed in single-cell suspensions from Sn-deficient lymph nodes (Fig. 2A). We also analyzed tissue sections from lymph nodes by immunofluorescence and immunoperoxidase labeling. Staining of mesenteric lymph nodes using a polyclonal rabbit anti-Sn serum demonstrated that Sn is expressed within only the subcapsular sinus from wild-type but not Sn-deficient mice. To see if subcapsular macrophages were still present in Sn-deficient mice, staining was performed using the CR-Fc fusion protein shown previously to colocalize with this macrophage subset (26). No obvious differences were seen when wild-type and Sn-deficient mice were compared (Fig. 2B). Similar findings were made in the spleen using a highly sensitive avidin-biotin peroxidase staining method (Fig. 2C). The spleen sections of wild-type mice showed typical intense staining of marginal metallophilic macrophages at the inner regions of the marginal zones using the SER-4 MAb and a somewhat weaker staining of macrophages in the red pulp (Fig. 2C, top left). No Sn staining was detectable in spleen sections from Sn-deficient mice (Fig. 2C, bottom left), but the metallophilic macrophages were present normally as shown by staining with the CR-Fc protein (Fig. 2C, middle). The general distribution of macrophages was also normal, as revealed by staining with the panmacrophage marker CD68 (Fig. 2C, right). Finally, spleen sections were also stained with an affinity-purified rabbit antibody directed to a peptide from the C-terminal cytoplasmic tail of Sn. This gave staining similar to that of SER-4 in wild-type mice but no detectable staining of sections from Sn-deficient mice (data not shown). Taken together, these findings establish unequivocally that the Sn–/– mice are true nulls and that the lack of sialoadhesin does not lead to obvious changes either in localization and numbers of lymphoid and splenic macrophage populations or in the overall tissue architecture.
|
|
|
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
More detailed analysis of cell populations revealed that Sn-deficient mice have relatively more CD8 T cells in spleen and lymph node compared to wild-type mice, while the CD4 T-cell population is unaltered. Since no changes were found in T-cell development in the thymus, Sn most likely has an impact on T-cell homeostasis in the periphery. It remains to be seen whether these additional CD8 T cells have an altered phenotype and whether the increase is due to altered recirculation, increased proliferation, or decreased apoptosis. Although we used wild-type and Sn-deficient mice backcrossed for at least eight generations onto a C57BL/6 background, we cannot completely rule out the possibility that minor additional genetic differences account for these small changes. However, sialylation of T cells has been shown to change dramatically during T-cell development and activation and to affect their potential as effector cells (28, 30, 43). Although resting lymphocytes interact only very weakly with Sn, there are indications that activated T cells do express Sn counterreceptors (8, 45). The enzyme most likely responsible for these changes is the sialyltransferase ST3GalI, which sialylates O-glycans on molecules like CD43, previously shown to be the counterreceptor for Sn on T cells (45). Interestingly, in ST3GalI-deficient mice, CD8 T-cell homeostasis is also altered, resulting in a profound loss of CD8 T cells in spleen, while the CD4 population and thymocytes are unaffected (29, 38). For these mice, it was shown that CD8 T cells undergo massive apoptosis in spleen. Whether there is a link between these directly opposing phenotypes remains to be seen, but both findings emphasize the importance of 
2,3 sialylation for CD8 T-cell homeostasis. The selectivity for CD8 T cells could be due to the fact that 2,3-linked sialic acids on CD4 T cells are heavily 9-O acetylated (24), a modification that prevents recognition by Sn (19). It remains to be shown whether the increase in CD8-positive T cells has a functional consequence in Sn-deficient mice.
We also found a small decrease in B220-positive cells in spleen and lymph nodes from Sn-deficient mice which may be a compensatory effect of the increase in CD8 T cells. In spleen, this appeared to correspond to a reduction in follicular B cells. However, the maturation of B cells in bone marrow, lymph nodes, and spleen seemed to be unaltered. Sn in spleen is very strongly expressed on marginal metallophilic macrophages. These cells occupy a prime position on the inner side of the marginal zone, where lymphocytes, blood-borne antigen, and antigen-presenting cells enter the white pulp. They are also in close proximity to B-cell follicles and the marginal zone B cells. We found that soluble IgM levels were reduced by about 50% in Sn-deficient mice, while IgG levels were unaltered. A reasonable hypothesis was that this is due to reduced levels of natural antibodies, but we did not find any indication that natural antibody-producing cells were reduced in number. B-1a cell numbers in the peritoneal cavity were normal, and marginal zone B cells were even slightly increased. Furthermore, there was no alteration in the percentage of cells staining positive for membrane IgM or its staining intensity using FACS analysis.
Interestingly, mice deficient in secreted IgM exhibit rather normal B-cell development and serum IgG levels (3), but this is accompanied by a pronounced increase in natural antibody- producing cells. These mice have a T-dependent IgG response that is impaired with only suboptimal, not optimal, doses of antigen. It remains to be seen whether this is also true for Sn-deficient mice. Experiments with secreted IgM-deficient mice have also demonstrated a critical role of natural IgM in the immediate defense against systemic bacterial infection (4). It will be interesting to see whether Sn-deficient mice are more susceptible to microbial infections in general. It will also be important to examine the susceptibility of Sn-deficient mice to sialylated and nonsialylated pathogens in order to investigate its role in sialic acid-dependent clearance functions. How Sn deficiency results in reduced IgM titers in unchallenged mice is currently unclear. However, there is evidence that Sn-positive macrophages localize within primary B-cell follicles during the initial priming of antibody responses (2). Clearly, further investigation is needed to analyze the role of Sn in eliciting humoral immune responses and cell trafficking upon antigen challenge.
The fact that Sn is highly conserved within mammals relative to the rapidly evolving CD33-related Siglecs (1), together with its very distinct expression pattern, suggests that there are specific functions of Sn that are conserved between mammals. Since steady-state hematopoiesis appears unaffected in Sn-deficient mice, we speculate that the primary role of Sn may be in regulating the immune system. Since specific-pathogen-free Sn-deficient mice have only a subtle phenotype, this makes them an ideal model to investigate the role of Sn in modulating immune and inflammatory responses.
|
ACKNOWLEDGMENTS |
|---|
We thank Ian Rosewell and the transgenic team at Clare Hall (Cancer Research UK) for ES cell work and embryo manipulation.
|
FOOTNOTES |
|---|
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Berney, C., S. Herren, C. A. Power, S. Gordon, L. Martinez-Pomares, and M. H. Kosco-Vilbois. 1999. A member of the dendritic cell family that enters B cell follicles and stimulates primary antibody responses identified by a mannose receptor fusion protein. J. Exp. Med. 190:851-860.
3. Boes, M., C. Esau, M. B. Fischer, T. Schmidt, M. Carroll, and J. Chen. 1998. Enhanced B-1 cell development, but impaired IgG antibody responses in mice deficient in secreted IgM. J. Immunol. 160:4776-4787.
4. Boes, M., A. P. Prodeus, T. Schmidt, M. C. Carroll, and J. Chen. 1998. A critical role of natural immunoglobulin M in immediate defense against systemic bacterial infection. J. Exp. Med. 188:2381-2386.
5. Boyce, N. W., S. R. Holdsworth, C. D. Dijkstra, and R. C. Atkins. 1987. Quantitation of intraglomerular mononuclear phagocytes in experimental glomerulonephritis in the rat using specific monoclonal antibodies. Pathology 19:290-293.[Medline]
6. Brinkman-Van der Linden, E. C., E. R. Sjoberg, L. R. Juneja, P. R. Crocker, N. Varki, and A. Varki. 2000. Loss of N-glycolylneuraminic acid in human evolution. Implications for sialic acid recognition by siglecs. J. Biol. Chem. 275:8633-8640.
7. Crocker, P. R. 2002. Siglecs: sialic-acid-binding immunoglobulin-like lectins in cell-cell interactions and signalling. Curr. Opin. Struct. Biol. 12:609-615.[CrossRef][Medline]
8. Crocker, P. R., S. Freeman, S. Gordon, and S. Kelm. 1995. Sialoadhesin binds preferentially to cells of the granulocytic lineage. J. Clin. Investig. 95:635-643.[Medline]
9. Crocker, P. R., and S. Gordon. 1989. Mouse macrophage hemagglutinin (sheep erythrocyte receptor) with specificity for sialylated glycoconjugates characterized by a monoclonal antibody. J. Exp. Med. 169:1333-1346.
10. Crocker, P. R., and S. Gordon. 1986. Properties and distribution of a lectin-like hemagglutinin differentially expressed by murine stromal tissue macrophages. J. Exp. Med. 164:1862-1875.
11. Crocker, P. R., S. Mucklow, V. Bouckson, A. McWilliam, A. C. Willis, S. Gordon, G. Milon, S. Kelm, and P. Bradfield. 1994. Sialoadhesin, a macrophage sialic acid binding receptor for haemopoietic cells with 17 immunoglobulin-like domains. EMBO J. 13:4490-4503.[Medline]
12. Crocker, P. R., and A. Varki. 2001. Siglecs in the immune system. Immunology 103:137-145.[CrossRef][Medline]
13. Crocker, P. R., Z. Werb, S. Gordon, and D. F. Bainton. 1990. Ultrastructural localization of a macrophage-restricted sialic acid binding hemagglutinin, SER, in macrophage-hematopoietic cell clusters. Blood 76:1131-1138.
14. Doody, G. M., S. E. Bell, E. Vigorito, E. Clayton, S. McAdam, R. Tooze, C. Fernandez, I. J. Lee, and M. Turner. 2001. Signal transduction through Vav-2 participates in humoral immune responses and B cell maturation. Nat. Immunol. 2:542-547.[CrossRef][Medline]
15. Girkontaite, I., K. Missy, V. Sakk, A. Harenberg, K. Tedford, T. Potzel, K. Pfeffer, and K. D. Fischer. 2001. Lsc is required for marginal zone B cells, regulation of lymphocyte motility and immune responses. Nat. Immunol. 2:855-862.[CrossRef][Medline]
16. Hartnell, A., J. Steel, H. Turley, M. Jones, D. G. Jackson, and P. R. Crocker. 2001. Characterization of human sialoadhesin, a sialic acid binding receptor expressed by resident and inflammatory macrophage populations. Blood 97:288-296.
17. Jiang, H. R., L. Lumsden, and J. V. Forrester. 1999. Macrophages and dendritic cells in IRBP-induced experimental autoimmune uveoretinitis in B10RIII mice. Investig. Ophthalmol. Vis. Sci. 40:3177-3185.
18. Jones, C., M. Virji, and P. R. Crocker. 2003. Recognition of sialylated meningococcal lipopolysaccharide by siglecs expressed on myeloid cells leads to enhanced bacterial uptake. Mol. Microbiol. 49:1213-1225.[CrossRef][Medline]
19. Kelm, S., R. Schauer, J. C. Manuguerra, H. J. Gross, and P. R. Crocker. 1994. Modifications of cell surface sialic acids modulate cell adhesion mediated by sialoadhesin and CD22. Glycoconj. J. 11:576-585.[CrossRef][Medline]
20. Kirchberger, S., O. Majdic, P. Steinberger, S. Bluml, K. Pfistershammer, G. Zlabinger, L. Deszcz, E. Kuechler, W. Knapp, and J. Stockl. 2005. Human rhinoviruses inhibit the accessory function of dendritic cells by inducing sialoadhesin and B7-H1 expression. J. Immunol. 175:1145-1152.
21. Kumamoto, Y., N. Higashi, K. Denda-Nagai, M. Tsuiji, K. Sato, P. R. Crocker, and T. Irimura. 2004. Identification of sialoadhesin as a dominant lymph node counter-receptor for mouse macrophage galactose-type C-type lectin 1. J. Biol. Chem. 279:49274-49280.
22. Lauzurica, P., D. Sancho, M. Torres, B. Albella, M. Marazuela, T. Merino, J. A. Bueren, A. C. Martinez, and F. Sanchez-Madrid. 2000. Phenotypic and functional characteristics of hematopoietic cell lineages in CD69-deficient mice. Blood 95:2312-2320.
23. Liu, Y., A. J. Chirino, Z. Misulovin, C. Leteux, T. Feizi, M. C. Nussenzweig, and P. J. Bjorkman. 2000. Crystal structure of the cysteine-rich domain of mannose receptor complexed with a sulfated carbohydrate ligand. J. Exp. Med. 191:1105-1116.
24. Martin, L. T., J. D. Marth, A. Varki, and N. M. Varki. 2002. Genetically altered mice with different sialyltransferase deficiencies show tissue-specific alterations in sialylation and sialic acid 9-O-acetylation. J. Biol. Chem. 277:32930-32938.
25. Martinez-Pomares, L., P. R. Crocker, R. Da Silva, N. Holmes, C. Colominas, P. Rudd, R. Dwek, and S. Gordon. 1999. Cell-specific glycoforms of sialoadhesin and CD45 are counter-receptors for the cysteine-rich domain of the mannose receptor. J. Biol. Chem. 274:35211-35218.
26. Martinez-Pomares, L., M. Kosco-Vilbois, E. Darley, P. Tree, S. Herren, J. Y. Bonnefoy, and S. Gordon. 1996. Fc chimeric protein containing the cysteine-rich domain of the murine mannose receptor binds to macrophages from splenic marginal zone and lymph node subcapsular sinus and to germinal centers. J. Exp. Med. 184:1927-1937.
27. McHeyzer-Williams, M. G. 2003. B cells as effectors. Curr. Opin. Immunol. 15:354-361.[CrossRef][Medline]
28. Merry, A. H., R. J. Gilbert, D. A. Shore, L. Royle, O. Miroshnychenko, M. Vuong, M. R. Wormald, D. J. Harvey, R. A. Dwek, B. J. Classon, P. M. Rudd, and S. J. Davis. 2003. O-Glycan sialylation and the structure of the stalk-like region of the T cell co-receptor CD8. J. Biol. Chem. 278:27119-27128.
29. Moody, A. M., D. Chui, P. A. Reche, J. J. Priatel, J. D. Marth, and E. L. Reinherz. 2001. Developmentally regulated glycosylation of the CD8ß coreceptor stalk modulates ligand binding. Cell 107:501-512.[CrossRef][Medline]
30. Moody, A. M., S. J. North, B. Reinhold, S. J. Van Dyken, M. E. Rogers, M. Panico, A. Dell, H. R. Morris, J. D. Marth, and E. L. Reinherz. 2003. Sialic acid capping of CD8ß core 1-O-glycans controls thymocyte-major histocompatibility complex class I interaction. J. Biol. Chem. 278:7240-7246.
31. Mucklow, S., S. Gordon, and P. R. Crocker. 1997. Characterization of the mouse sialoadhesin gene, Sn. Mamm. Genome 8:934-937.[CrossRef][Medline]
32. Muerkoster, S., M. Rocha, P. R. Crocker, V. Schirrmacher, and V. Umansky. 1999. Sialoadhesin-positive host macrophages play an essential role in graft-versus-leukemia reactivity in mice. Blood 93:4375-4386.
33. Munday, J., H. Floyd, and P. R. Crocker. 1999. Sialic acid binding receptors (siglecs) expressed by macrophages. J. Leukoc. Biol. 66:705-711.[Abstract]
34. Muto, A., S. Tashiro, O. Nakajima, H. Hoshino, S. Takahashi, E. Sakoda, D. Ikebe, M. Yamamoto, and K. Igarashi. 2004. The transcriptional programme of antibody class switching involves the repressor Bach2. Nature 429:566-571.[CrossRef][Medline]
35. Nath, D., A. Hartnell, L. Happerfield, D. W. Miles, J. Burchell, J. Taylor-Papadimitriou, and P. R. Crocker. 1999. Macrophage-tumour cell interactions: identification of MUC1 on breast cancer cells as a potential counter-receptor for the macrophage-restricted receptor, sialoadhesin. Immunology 98:213-219.[CrossRef][Medline]
36. Ochsenbein, A. F., and R. M. Zinkernagel. 2000. Natural antibodies and complement link innate and acquired immunity. Immunol. Today 21:624-630.[CrossRef][Medline]
37. Polman, C. H., C. D. Dijkstra, T. Sminia, and J. C. Koetsier. 1986. Immunohistological analysis of macrophages in the central nervous system of Lewis rats with acute experimental allergic encephalomyelitis. J. Neuroimmunol. 11:215-222.[CrossRef][Medline]
38. Priatel, J. J., D. Chui, N. Hiraoka, C. J. Simmons, K. B. Richardson, D. M. Page, M. Fukuda, N. M. Varki, and J. D. Marth. 2000. The ST3Gal-I sialyltransferase controls CD8+ T lymphocyte homeostasis by modulating O-glycan biosynthesis. Immunity 12:273-283.[CrossRef][Medline]
39. Pulliam, L., B. Sun, and H. Rempel. 2004. Invasive chronic inflammatory monocyte phenotype in subjects with high HIV-1 viral load. J. Neuroimmunol. 157:93-98.[CrossRef][Medline]
40. Rolf, J., V. Motta, N. Duarte, M. Lundholm, E. Berntman, M. L. Bergman, L. Sorokin, S. L. Cardell, and D. Holmberg. 2005. The enlarged population of marginal zone/CD1d(high) B lymphocytes in nonobese diabetic mice maps to diabetes susceptibility region Idd11. J. Immunol. 174:4821-4827.
41. Schadee-Eestermans, I. L., E. C. Hoefsmit, M. van de Ende, P. R. Crocker, T. K. van den Berg, and C. D. Dijkstra. 2000. Ultrastructural localisation of sialoadhesin (siglec-1) on macrophages in rodent lymphoid tissues. Immunobiology. 202:309-325.[Medline]
42. Shi, W. X., R. Chammas, N. M. Varki, L. Powell, and A. Varki. 1996. Sialic acid 9-O-acetylation on murine erythroleukemia cells affects complement activation, binding to I-type lectins, and tissue homing. J. Biol. Chem. 271:31526-31532.
43. Starr, T. K., M. A. Daniels, M. M. Lucido, S. C. Jameson, and K. A. Hogquist. 2003. Thymocyte sensitivity and supramolecular activation cluster formation are developmentally regulated: a partial role for sialylation. J. Immunol. 171:4512-4520.
44. van den Berg, T. K., J. J. Breve, J. G. Damoiseaux, E. A. Dopp, S. Kelm, P. R. Crocker, C. D. Dijkstra, and G. Kraal. 1992. Sialoadhesin on macrophages: its identification as a lymphocyte adhesion molecule. J. Exp. Med. 176:647-655.
45. van den Berg, T. K., D. Nath, H. J. Ziltener, D. Vestweber, M. Fukuda, I. van Die, and P. R. Crocker. 2001. Cutting edge: CD43 functions as a T cell counterreceptor for the macrophage adhesion receptor sialoadhesin (Siglec-1). J. Immunol. 166:3637-3640.
46. Vanderheijden, N., P. L. Delputte, H. W. Favoreel, J. Vandekerckhove, J.Van Damme, P. A. van Woensel, and H. J. Nauwynck. 2003. Involvement of sialoadhesin in entry of porcine reproductive and respiratory syndrome virus into porcine alveolar macrophages. J. Virol. 77:8207-8215.
47. Wilkinson, R., A. B. Lyons, D. Roberts, M. X. Wong, P. A. Bartley, and D. E. Jackson. 2002. Platelet endothelial cell adhesion molecule-1 (PECAM-1/CD31) acts as a regulator of B-cell development, B-cell antigen receptor (BCR)-mediated activation, and autoimmune disease. Blood 100:184-193.
48. Zhang, J. Q., B. Biedermann, L. Nitschke, and P. R. Crocker. 2004. The murine inhibitory receptor mSiglec-E is expressed broadly on cells of the innate immune system whereas mSiglec-F is restricted to eosinophils. Eur. J. Immunol. 34:1175-1184.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
