A Nucleolin-Binding 3' Untranslated Region Element Stabilizes {beta}-Globin mRNA In Vivo

The normal expression of human ß globin is criticallydependent upon the constitutively high stability of its encodingmRNA. Unlike with ${alpha}$ -globin mRNA, the specific cis-acting determinantsand trans-acting factors that participate in stabilizing ß-globinmRNA are poorly described. The current work uses a linker-scanningstrategy to identify a previously unknown determinant of mRNAstability within the ß-globin 3' untranslated region(3'UTR). The new determinant is positioned on an mRNA half-stemopposite a pyrimidine-rich sequence targeted by ${alpha}$ CP/hnRNP-E,a factor that plays a critical role in stabilizing human ${alpha}$ -globinmRNA. Mutations within the new determinant destabilize ß-globinmRNA in intact cells while also ablating its 3'UTR-specificinteraction with the polyfunctional RNA-binding factor nucleolin.We speculate that 3'UTR-bound nucleolin enhances mRNA stabilityby optimizing ${alpha}$ CP access to its functional binding site. Thismodel is favored by in vitro evidence that ${alpha}$ CP binding is enhancedboth by cis-acting stem-destabilizing mutations and by the trans-actingeffects of supplemental nucleolin. These studies suggest a mechanismfor ß-globin mRNA stability that is related to, butdistinct from, the mechanism that stabilizes human ${alpha}$ -globin mRNA.

INTRODUCTION

Top

Introduction

Erythroid cells accumulate hemoglobin through a process thatis critically dependent upon the high stabilities of mRNAs thatencode their constituent ${alpha}$ - and ß-globin subunits (10,64). In vivo analyses estimate a half-life for human ${alpha}$ -globinmRNA of between 24 and 60 h (47, 62, 63, 74), while similarstudies with cultured NIH 3T3 and murine erythroleukemia (MEL)cells (2, 36, 42), primary mouse hematopoietic cells (4), andhuman erythroid progenitors (62, 63) suggest a half-life valuefor human ß-globin mRNA that exceeds 16 to 20 h. GlobinmRNAs survive, and continue to translate at high levels, foras long as a week following nuclear condensation and extrusionin transcriptionally silent erythroid progenitor cells. As mightbe anticipated, mutations that impair the normal stabilitiesof globin mRNAs can severely impact the levels of their encodedproteins. For example, an mRNA-destabilizing mutation reducesthe expression of ${alpha}$ ^{Constant Spring} to less than 2% of normallevels (45, 51, 80), resulting in a clinically important formof thalassemia characterized by a substantial imbalance in ${alpha}$ -and ß-globin chain accumulation (10, 64).

The cis-acting determinants and trans-acting factors that participatein regulating ${alpha}$ -globin mRNA stability have recently been identified,and the relevant molecular mechanisms have been described indetail. Mutational analyses carried out with cultured cells(80, 81) and with animal models (52, 66) clearly demonstratethe importance of the 3' untranslated region (3'UTR) to theconstitutively high stability of ${alpha}$ -globin mRNA (45). Other studieshave mapped this characteristic to a phylogenically conserved,16-nucleotide (nt) C/U-rich element in this region (39, 75,76). The cis-acting pyrimidine-rich element (PRE) assemblesan mRNP " ${alpha}$ -complex" that comprises a member of the ${alpha}$ CP/hnRNP-Efamily of mRNA-binding proteins (37, 39, 48, 75) and possiblyone or more additional trans-acting factors (17, 38, 77). The ${alpha}$ -complex may slow ${alpha}$ -globin mRNA decay by enhancing the bindingof poly(A)-binding protein to the poly(A) tail (77, 79). The ${alpha}$ -complex may also prevent the access of an erythroid-cell-specificendoribonuclease to the ${alpha}$ -PRE (61, 78, 79), mimicking mechanismsthrough which several nonglobin mRNAs evade endonucleolyticcleavage (5, 6, 8).

Unlike with ${alpha}$ -globin mRNA, neither the cis elements nor the trans-actingfactors that specify the constitutively high stability of humanß-globin mRNA have been fully described. Althoughseveral hundred mutations are known to affect ß-globingene expression, few offer any insight into the position ofa specific ß-globin mRNA stability-enhancing regionor its likely mechanism (10). Common mutations that encode prematuretranslation termination codons or adversely affect processingof ß-globin pre-mRNA, though accelerating its degradation,utilize mRNA-indifferent decay pathways (10, 26, 49) and consequentlydo not illuminate the putative ß-globin mRNA-restrictedmechanism(s) that defines its high baseline stability.

The search for a discrete ß-globin mRNA stabilityelement has focused largely on its 3'UTR, since sequences dictatingthe stabilities of mRNAs encoding ${alpha}$ globin (80, 81), transferrinreceptor (40), histones (57), and a variety of cytokines andlymphokines (70) are commonly positioned in this ribosome-freeregion. This expectation has been fulfilled by studies of chimericfos-ß-globin mRNA in cultured cells (36) and full-lengthß-globin mRNA in MEL cells and in whole-animal models(65, 84). The latter studies were particularly informative,demonstrating that ß-globin mRNA can be destabilizedby engineered mutations that permit ribosomes to read past itsnative translational terminal codon and through the entire 3'UTR,disrupting hypothetical mRNP structures positioned in that region.In contrast, ß-globin expression is minimally impactedby naturally occurring and synthetic frameshift mutations thatrestrict ribosomal readthrough to the proximal one-third ofthe 3'UTR (11, 20, 25, 65), suggesting that critical determinantsof mRNA stability are likely to be positioned further downstream.Scattered, naturally occurring single-nucleotide substitutionsand small deletions in the terminal portion of the 3'UTR donot materially affect ß-globin mRNA stability (3,12, 34) and are consequently of little help in mapping importantcis-acting stability elements. Recent interest has focused ona 14-nt pyrimidine-rich element in the ß-globin 3'UTR(the ß-PRE) because of its obvious similarity to the ${alpha}$ -PRE stability determinant. Deletion or purine substitutionof the ß-PRE reduces the stability of human ß-globinmRNA in transgenic mice by approximately one-half (84), indicatingthe importance of this structure to ß-globin geneexpression.

Although the mechanism through which the ß-PRE confersstability to the ß-globin mRNA is not known, severalobservations suggest that it, like the ${alpha}$ -PRE, may be functionallytargeted by ${alpha}$ CP. First, the human ${alpha}$ - and ß-globin genesevolved from a single ancestral globin gene (28, 29), raisingthe possibility of a primitive, evolutionally conserved mechanismfor stabilizing their mRNAs. Second, ${alpha}$ CP is known to play animportant role in stabilizing several nonglobin mRNAs that containpyrimidine-rich 3'UTR motifs [e.g., 15-lipoxygenase (55), tyrosinehydroxylase (18), and ${alpha}$ 1(I) collagen (73)] and may participatein stabilizing other globin mRNAs (66). Third, electrophoreticmobility studies demonstrate that the ß-globin 3'UTRassembles an mRNP structure in vitro that may contain ${alpha}$ CP (84).Formal attempts to directly link ${alpha}$ CP to ß-globin mRNAstability, however, have been unsuccessful, suggesting thatthe constitutive stability of ß-globin mRNA in vivorequires mRNA structural conformations or additional trans-actingfactors that are poorly recapitulated in vitro. Consequently,the posttranscriptional mechanisms that maintain ß-globinmRNA levels in vivo remain poorly understood, despite theirobvious relevance to common disorders of globin gene expression.

The current article provides new insights into the structuralbasis for ß-globin mRNA stability, suggesting an underlyingmechanism that differs in several fundamental respects fromthe mechanism dictating the stability of human ${alpha}$ -globin mRNA.A previously unrecognized cis determinant of ß-globinmRNA stability is identified by assessing the survival of derivativemRNAs containing defined site-specific mutations in vivo. Independentexperiments in vitro, in cultured cells, and in primary humanerythroid progenitors identify nucleolin, a ubiquitous, structurallyheterogeneous, polyfunctional RNA-binding protein, as a cytoplasmicfactor that binds to the ß-globin 3'UTR in a sequence-specificmanner. A link between nucleolin binding and mRNA stabilityis provided by subsequent in vitro and in vivo analyses demonstratingthat functional mutations within the stability determinant alsointerfere with nucleolin binding. These data, and previous experimentalevidence favoring an mRNA-stabilizing role for ${alpha}$ CP, are accommodatedby a model in which nucleolin facilitates the access of ${alpha}$ CP toits functional ß-globin 3'UTR target site. We demonstratea key aspect of this model by showing that disruption of a high-orderstructure within the ß-globin 3'UTR facilitates ${alpha}$ CPbinding in vitro. These studies suggest a mechanism for ß-globinmRNA stability that is related to, but distinct from, the mechanismthat stabilizes human ${alpha}$ -globin mRNA.

MATERIALS AND METHODS

Top

Materials and Methods

Cell culture. HeLa cells expressing the tetracycline-regulated transactivator(tTA) fusion protein (BD Biosciences) were maintained in Dulbecco'smodified Eagle's medium supplemented with 10% fetal bovine serumin a humidified 5% CO₂ environment. Suspension MEL cells werecultured under similar conditions, while human K562 cells weregrown in Iscove's modified Dulbecco's medium containing 4 mMglutamine and 1.5 g/liter sodium bicarbonate and supplementedwith 10% fetal bovine serum. Cells ( $~$ 5 x 10⁵) were transfectedwith 5 µg supercoiled DNA using Superfect reagent as recommendedby the manufacturer (QIAGEN). Doxycycline was added to a finalconcentration of 1 µg/ml when required.

Gene cloning. pTRE-ß^WT was constructed from a 3.3-kb fragment ofhuman genomic DNA containing the intact ß-globin geneand contiguous 3' flanking region, inserted into the SacII-ClaIpolylinker site of pTRE2 (BD Biosciences). Linker-scanning mutationswere introduced into the human ß-globin gene by asplice overlap extension-PCR method (65, 84) using paired, complementary30-nt primers containing the desired HindIII mutation (5'AAGCTT3').The resulting mutated 904-bp cDNAs were then substituted forthe cognate EcoRI-EcoNI fragment of pTRE-ß^WT. Chemicallycompetent DH5 ${alpha}$ Escherichia coli cells were transformed (Invitrogen),mini-prep DNA was prepared from individual colonies (QIAGEN),and the structures of the variant ß-globin genes weresubsequently validated by HindIII digestion and by automateddideoxy sequencing. pTRE-ß^ARE104 and pTRE-ß^ARE130were constructed by introducing a 59-bp A/U-rich mRNA instabilityelement (70) into the HindIII sites of pTRE-ß^H104and pTRE-ß^H130, respectively.

RNase protection analysis. Cellular RNAs prepared from cultured cells using TRIzol reagent(Gibco-BRL) were analyzed as described previously (66, 84).³²P-labeled ß-globin and ß-actin probeswere prepared by in vitro transcription of DNA templates usingSP6 RNA polymerase (Ambion). The 287-nt ß-globin probeprotects a 199-nt sequence of human ß-globin mRNAexon II, while the 313-nt ß-actin probe protects a160-nt exonic fragment of human ß-actin mRNA (84).Band intensities were quantitated from PhosphorImager filesusing ImageQuant software (Amersham Biosciences).

RT-PCR⁺¹ analysis (65). Purified RNAs ( $~$ 500 ng) were reverse transcribed and thermallyamplified using Superscript one-step reagents under conditionsrecommended by the manufacturer (Invitrogen) and then amplifiedfor 40 cycles using exon II (5'ACCTGGACAACCTCAAGG3') and exonIII (5'TTTTTTTTTTGCAATGAAAATAAATG3') primers that generate a355-bp cDNA product encompassing the full ß-globin3'UTR. Reaction mixtures were subsequently augmented with 100µmol of a nested ³²P-labeled exon II primer (5'CCACACTGAGTGAGCTGC3')and 0.5 µl Platinum Taq (Invitrogen) and product DNA amplifiedfor one additional cycle. This method generates 328-nt ³²P-labeledhomodimeric DNAs that fully digest with HindIII to generate³²P-labeled products between 189 and 285 bp in length.

Proteomics. Analyses were carried out by the University of PennsylvaniaProteomics Facility. Tryptic digests were resolved on a VoyagerDE Pro (Applied Biosystems), and protein identities were deducedfrom MS-Fit (University of California) analysis of peptide fragmentsusing the NCBInr database. Time-of-flight (TOF)-TOF analysiswas carried out using a 4700 proteomics analyzer (Applied Biosystems)equipped with Global Proteomics Server analytical software.

Cytosolic extract. Extracts were prepared as previously described (19, 21). Briefly,phosphate-buffered saline (PBS)-washed cells were incubatedfor 20 min at 4°C in RNA immunoprecipitation assay (RIPA)buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1%NP-40, 1 mM Na₃VO₄, 1 mM NaF, and 1x protease inhibitor cocktail[BD Biosciences]). The lysate was centrifuged at 13,000 x gfor 15 min, and the supernatant was collected and stored at–80°C. For cross-linking studies, in vitro-transcribed,³²P-labeled RNAs were incubated with cytoplasmic extract andexposed to UV light (3,000 mJ/cm²) for 5 min.

Fluorescence-activated cell sorter (FACS) analysis. A protocol for all animal work was approved by the InstitutionalAnimal Care and Use Committee at the University of PennsylvaniaSchool of Medicine. EDTA-anticoagulated whole blood was stainedwith thiazole orange as directed by the manufacturer (Sigma)(31). Erythroid cells were identified by their characteristicforward- and side-scatter properties using a FACSVantage cellsorter equipped with Digital Vantage options (Becton-Dickinson).Thiazole orange-staining cells (reticulocytes) were collected,excluding a small population of hyper-staining nucleated erythroidprogenitor cells.

Affinity enrichment studies. Custom 5'-terminal biotinylated single-stranded DNAs (ssDNAs)were purchased from Integrated DNA Technologies (Coralville,IA). Molar equivalents of each ssDNA (3 pmol) were incubatedfor 1 h at 4°C in PBS (pH 7.2) along with 100 µl ofpreequilibrated ImmunoPure immobilized avidin agarose beads(Pierce Biotechnology). The pelleted beads were washed fourtimes with PBS, incubated at 4°C for 1 h with 1 ml cytoplasmicextract, and then washed five times with PBS. Bound proteinswere eluted with loading buffer and resolved on precast 4 to12% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis(SDS-PAGE) gels as recommended by the manufacturer (Invitrogen).A parental ssDNA corresponding to the ß-globin 3'UTRstem-loop structure (5'ATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATC3')was modified by the deletion of an internal 18-nt sequence (5'GGGGGATATTATGAAGGG3')and by the substitution of an unrelated 18-nt sequence (5'ATGCCGTAATGCCGTAAT3')or a sequence encompassing the ß-PRE (5'TTCCTTTGTTCCCTAAGT3')at the same site.

Western blotting. Antibodies purchased from Santa Cruz Biotechnology includedmouse monoclonal anti-human nucleolin (MS-3), rabbit polyclonalanti-human nucleolin (H-250), goat polyclonal anti-human HDAC-2(C-19), rabbit polyclonal anti-human tumor necrosis factor alpha,and goat polyclonal anti-human hnRNP-E1 (T-18). Rabbit polyclonalanti-human actin antibodies were purchased from Sigma (A-2066).Protein samples in loading buffer were denatured at 100°Cfor 5 min, resolved on a precast 4 to 12% gradient SDS-PAGEgel, and transferred to a nitrocellulose membrane using an XCellII blot module according to the manufacturer's instructions(Invitrogen). Blots were blocked for 1 h at room temperaturein PBS containing 0.1% Tween 20, supplemented with 3% driedmilk, and then incubated for an additional hour following antibodyaddition. Membranes washed with the Tween 20-PBS mixture weresubsequently incubated for 1 h with a horseradish peroxidase-conjugatedsecondary antibody (Amersham Biosciences) and analyzed usinga chemiluminescence method (ECL kit; Amersham).

RNA immunoprecipitation. HeLa cell extracts were prepared as previously described (15,16). PBS-washed erythrocytes were isolated from EDTA-anticoagulatedwhole blood by fractionation over a Histopaque 1.077/1.119 bilayercushion (Sigma). Extracts prepared in RIPA buffer (1 ml) wereprecleared with 60 µl protein A-agarose beads (Invitrogen)and then incubated at 4°C for 3 h with nucleolin H-250 antibodies.Fresh protein A-agarose beads (60 µl) were then added,and the incubation continued for another 2 h. Immunoprecipitateswere washed three times in RIPA buffer, and bound RNAs werecollected by TRIzol extraction and ethanol precipitation forsubsequent analysis. Control 18S pre-RNAs were RT-PCR amplifiedusing oligomers 5'GTTCGTGCGACGTGTGGCGTGG3' and 5'CAGACCCGCGACGCTTCTTCGT3',producing a 501-bp cDNA fragment (1).

Preparation of recombinant ${alpha}$ CP and purification of nucleolin. A glutathione S-transferase- ${alpha}$ CP1 fusion protein was purifiedfrom DH5 ${alpha}$ cells transfected with pEGX-6P- ${alpha}$ CP1 (kind gift of M.Kiledjian, Rutgers University); the glutathione S-transferasedomain was subsequently cleaved with PreScission proteinase(Pharmacia Biotech). Human nucleolin was affinity enriched fromHeLa and/or K562 cell extract using an agarose-immobilized 2'-O-methylRNA sequence (5'UAUUAAAGGUUCCUUUGUUCCCUAAGUCCAAC3'). A relatedmethod was used to prepare nucleolin-depleted extract.

RESULTS

Top

Results

Validation of a method for analyzing the stability of ß-globin mRNA in intact cells. To facilitate our studies of ß-globin mRNA stability,we developed a system in which a single defined gene can betranscriptionally silenced in intact, translationally competentcells. This approach permits mRNA decay to be assessed in vivousing a transcriptional chase approach that does not compromisecell viability (41, 82). The method requires cells that constitutivelyexpress a tTA fusion protein that activates genes linked toa recombinant hybrid tetracycline response element (TRE). tTAactivity is rapidly and efficiently inhibited in the presenceof tetracycline or doxycycline (Dox), which does not affectthe expression of other, constitutively expressed eukaryoticgenes. Consequently, the stabilities of mRNAs encoded by TRE-linkedgenes can be estimated by assessing their rate of disappearancefrom Dox-treated cells.

The proposed use of tTA-expressing HeLa cells was tested byassessing the fate of mRNAs carrying a known mRNA-destabilizingdeterminant, the 3'UTR A/U-rich element (ARE) derived from humangranulocyte-macrophage colony-stimulating factor mRNA (70) (Fig.1A). TRE-linked ß-globin genes were constructed tocontain either the native 3'UTR (pTRE-ß^WT) (84) or3'UTRs engineered to contain single-copy ARE inserts (pTRE-ß^ARE104and pTRE-ß^ARE130). pTRE-ß^WT was cotransfectedinto HeLa^tTA cells with either pTRE-ß^ARE104 or pTRE-ß^ARE130,and the levels of their encoded mRNAs were established at definedintervals following Dox exposure. Unlike with ß^WTmRNA, the level of each ß^ARE mRNA fell rapidly (Fig.1B and C), confirming the utility of the tTA-TRE system fordifferentiating unstable and stable mRNAs in intact, culturedcells.

View larger version (28K):
[in this window]
[in a new window]
FIG. 1. Unstable and stable variant ß-globin mRNAs can be distinguished in intact cells. (A) Structures of conditionally expressed reporter genes encoding variant ß-globin mRNAs. pTRE-ß^WT contains the full-length human ß-globin gene, including native intronic, exonic, and 3'-flanking sequences (thin, thick, and intermediate gray lines, respectively), downstream of a Tet-conditional TRE promoter (dotted cross-hatching). pTRE-ß^ARE104 and pTRE-ß^ARE130 are identical to pTRE-ß^WT except for a 59-bp ARE instability element ( ${boxtimes}$ ) at either of two 3'UTR positions. (B) Variant ß^ARE104 mRNA is unstable in cultured cells. The levels of ß^WT and ß^ARE104 mRNAs in transiently transfected HeLa^tTA cells were assessed by RT-PCR⁺¹ at defined intervals following Dox exposure. The intensities of the ß^WT bands were balanced by adjusting sample loading. C1 and C2 contain RNA from cells transfected singly with pTRE-ß^WT and pTRE-ß^ARE104, respectively. (C) ARE-mediated destabilization of ß-globin mRNA in cultured cells. The autoradiograph in panel B was analyzed by PhosphorImager densitometry and the ß^ARE104/ß^WT ratio plotted (black squares). Results from a parallel study of ß^ARE130 are also plotted (gray circles). The dashed line indicates the ß^ARE/ß^WT ratio that would be observed if the two mRNAs were equally stable.

Human ß-globin mRNA is destabilized by either of two adjacent site-specific 3'UTR mutations. To map critical cis determinants of ß-globin mRNAstability, 17 full-length ß-globin genes were constructed,each containing a hexanucleotide substitution at a unique 3'UTRposition (Fig. 2A). Collectively, the mutations saturate 102nt of the 107-nt sequence of ß-globin 3'UTR betweenthe native TAA translational termination codon and the AATAAApolyadenylation signal. HeLa^tTA cells were cotransfected withDNA mixes comprising different combinations of TRE-linked, variantß^H-globin genes, including one (ß^H100) thatwas arbitrarily selected as an internal control (Fig. 2B). Thelevel of each variant ß^H mRNA, relative to that ofß^H100 mRNA, was subsequently determined by RT-PCR⁺¹following 24- and 48-hour exposures to Dox (65). Two of thevariant ß^H mRNAs containing hexanucleotide substitutionsat 3'UTR positions 122 and 124 displayed levels that fell four-to fivefold faster than those of other variant ß^HmRNAs (Fig. 2C and D). These results were confirmed in a duplicateanalysis utilizing a different post-Dox interval (not shown)and in related experiments in which genes encoding unstablevariant ß^H122 and ß^H124 mRNAs and stablevariant ß^H114 mRNA were separately transfected intoHeLa^tTA cells along with internal control pTRE-ß^H100(Fig. 2E). Formal mRNA stability studies were subsequently carriedout using Dox-exposed HeLa^tTA cells that had been cotransfectedwith TRE-linked genes encoding ß^WT and either ß^H114or ß^H124 mRNA (Fig. 2F to H). By comparison to thelevel of ß^WT mRNA, that of ß^H124 mRNA fellrapidly (Fig. 2F and H), while that of control ß^H114mRNA remained stable (Fig. 2G and H). The combined results ofscreening and formal mRNA stability analyses confirm the importanceof the 12-nt H122/H124 sequence to the intrinsically high stabilityof ß-globin mRNA.

View larger version (59K):
[in this window]
[in a new window]
FIG. 2. Two adjacent hexanucleotide mutations destabilize ß-globin mRNA in intact cultured cells. (A) Structures of variant ß-globin genes. The 3'UTR of the wild-type ß-globin gene (WT) is illustrated, with the TAA termination codon and AATAAA polyadenylation signal underlined. Each variant ß-globin gene (designated H100, H102, and H104, etc.) contains a site-specific AAGCTT hexanucleotide substitution encoding a HindIII recognition site. Dashes indicate identity with the WT sequence. (B) Composition of DNA mixes used for mRNA stability studies in cultured cells. Mixes A to D each contain four or five variant TRE-linked ß^H-globin genes, including one (ß^H100) whose mRNA is used as a normalization control in subsequent analyses. Mix E contains a control variant ß^H126 gene for the same purpose. (C) Relative stabilities of variant ß-globin mRNAs following transcriptional silencing of their encoding genes. HeLa^tTA cells transfected with DNA mixes A to E were exposed to Dox, and total RNA was recovered from aliquots following an additional 24 or 48 h of culture. RT-PCR⁺¹-amplified products were restricted with HindIII to generate differently sized DNA fragments whose quantities correspond to the levels of individual variant ß^H mRNAs in the original sample. Brackets emphasize the rapid interval decline in ß^H122 mRNA (lanes 7 and 8) and ß^H124 mRNA (lanes 9 and 10), relative to levels of other variant ß^H mRNAs. Lanes 1 and 2 contain ³²P-labeled size markers and the undigested PCR product from mix A, respectively. (D) Relative stabilities of variant ß^H mRNAs. The stabilities of individual variant ß^H mRNAs are plotted. Stability is defined as [(ß^H)₄₈/(ß^H)₂₄]/[(ß^H100)₄₈/(ß^H100)₂₄], with the stability of ß^H100 arbitrarily assigned unit value (subscript values represent the post-Dox intervals in hours). (E) Accelerated decay of variant ß^H mRNAs in intact cultured cells. The stabilities of mRNAs encoded by variant ß^H114, ß^H122, and ß^H124 genes (top) were established singly, relative to that of internal control ß^H100 mRNA, as described for panel C. The positions of individual HindIII-restricted RT-PCR⁺¹ products are indicated to the right. Lane 1 contains a DNA size marker. (F and G) Formal decay analyses of ß^H124 and control ß^H114 mRNAs. Mixes containing pTRE-ß^WT and either pTRE-ß^H124 (F) or pTRE-ß^H114 (G) were transfected into HeLa^tTA cells, and relative mRNA levels were established by RT-PCR⁺¹ at defined intervals following Dox exposure. Controls (Cont) include undigested ß^WT (C1), HindIII-digested ß^WT (C2), HindIII-digested ß^H124 (C3), undigested ß^H114 (C4), and HindIII-digested ß^H114 (C5). (H) Relative stabilities of ß^H124 and control ß^H114 mRNAs. Band intensities were established from the autoradiographs in panels F and G by PhosphorImager densitometry. Levels of ß^H124 and ß^H114 mRNAs, relative to levels of coexpressed ß^WT mRNA and normalized to the corresponding ratio at time zero, are plotted in gray and black, respectively.

Nucleolin binds to the ß-globin 3'UTR in intact cultured cells and primary erythroid cells. The stabilities of many mRNAs, including those encoding ${alpha}$ globin(75), ${alpha}$ 1(I) collagen (73), tyrosine hydroxylase (18), histone(57), and the transferrin receptor (53), require the assemblyof defined mRNP effector complexes on specific determinantswithin their 3'UTRs. To identify candidate trans-acting factorsthat might functionally interact with the ß-globin3'UTR, agarose-immobilized ssDNAs corresponding to the ß^WT3'UTR and to negative-control poly(dI · dC) were separatelyincubated with cytoplasmic extract prepared from cultured humanerythroid K562 cells. Three bands that displayed relative specificitiesfor the ß^WT 3'UTR were subsequently excised and subjectedto matrix-assisted laser desorption ionization (MALDI)-TOF analysis(Fig. 3A). The $~$ 100-kDa band was unambiguously identified asnucleolin from 14 tryptic peptide fragments representing 22%coverage (molecular weight search, 1.469 x 10⁴) (Fig. 3B); theidentities of the remaining two bands could not be establishedwith certainty. Companion experiments indicated that nucleolinbinds equally well to related full-length and truncated agarose-immobilizedRNAs and 2'-O-methylated RNAs, respectively (Fig. 3C). Theseresults were corroborated by parallel TOF-TOF analyses of affinity-enrichederythroid MEL cell extract that also unequivocally identifiednucleolin (data not shown). This dual preliminary identificationwas subsequently confirmed by Western blot analysis of affinity-enrichedproteins using a polyclonal nucleolin antibody (Fig. 3D). Nucleolinappears to bind to the ß-globin 3'UTR in a sequence-specificmanner, as increasing quantities of an unrelated soluble competitorssDNA effectively compete background proteins from an agarose-immobilizedssDNA ß-globin 3'UTR ligand but do not affect nucleolinbinding (Fig. 3E). In addition, UV-cross-linked nucleolin-ß-3'UTRmRNPs assemble in K562 cytoplasmic extract but not in extractsthat are affinity depleted of nucleolin, confirming that nucleolinalso binds to ß^WT RNA (Fig. 3F, lanes T and D, respectively).These results document the sequence-specific binding of nucleolinto the ß-globin mRNA 3'UTR in vitro and suggest thatthis interaction may subserve a critical function in vivo.

View larger version (31K):
[in this window]
[in a new window]
FIG. 3. Identification of a cytoplasmic factor that exhibits binding specificity for the ß^WT 3'UTR. (A) Affinity enrichment of candidate ß-globin 3'UTR-binding factors. Agarose-immobilized ssDNAs corresponding to the 132-nt full-length ß-globin 3'UTR (ß^WT) or to a poly(dI · dC) negative control (NC) were incubated with K562 cytoplasmic extract, and adherent factors were resolved by SDS-PAGE. Three bands were analyzed by MALDI-TOF (asterisks). Lanes M and U contain protein size markers and unfractionated extract, respectively. (B) Identification of nucleolin as a ß-globin 3'UTR-binding factor. A diagram illustrates key structural features of full-length human nucleolin, including amino-terminal acidic domains (light shading), RNA-binding domains (dark shading), and a carboxy-terminal, RGG-rich domain (crosshatched). The sizes and positions of tryptic-digest fragments, identified by MALDI-TOF analysis of affinity-enriched K562 cell extract, are indicated as black boxes below the diagram. (C) Nucleolin (Nuc) binds liganded ssDNAs and RNAs corresponding to the ß-globin 3'UTR. K562 extract was affinity enriched using a 32-nt ligand corresponding to the H122/H124 site (32 nt) or ligands comprising the full-length (FL) ß-globin 3'UTR. Ligands comprised ssDNA, in vitro-transcribed RNA (RNA), or 2'-O-methyl RNA (Me-RNA). Poly(dI · dC) was assessed in parallel as a negative control. Lanes M and U contain protein size markers and unfractionated extract, respectively. (D) Immunological confirmation of nucleolin as a ß-globin 3'UTR-binding factor. Affinity-enriched lysate from panel A was analyzed by Western transfer analysis using nucleolin antibody MS-3. Lane U contains unfractionated extract analyzed in parallel as a migration control. (E) Sequence-specific binding of nucleolin to the ß-globin 3'UTR. Agarose-immobilized ssDNAs corresponding to the ß^WT 3'UTR were incubated with MEL cytoplasmic extract in the presence of defined quantities of competitor poly(dI · dC). Adherent proteins were resolved on a Coomassie blue-stained SDS-polyacrylamide gel (top) and subjected to Western blot analysis using nucleolin antibody MS-3 (bottom). (F) Nucleolin binds to the 3'UTR of ß-globin mRNA. In vitro-transcribed, ³²P-labeled RNAs corresponding to the ß^WT 3'UTR were incubated with total (lane T) or nucleolin-depleted (lane D) K562 extract and cross-linked with UV light, and mRNPs were resolved on a nondenaturing acrylamide gel. RNAs incubated in reconstituted lysate (lane R) and with affinity-purified nucleolin (lane C) were analyzed in parallel as controls. Bands corresponding to nucleolin-ß-3'UTR mRNPs are indicated (black spots). (Bottom) The efficiency of nucleolin depletion was assessed by Western blot analysis of reagent extracts using nucleolin antibodies (bottom). The stripped blot was rehybridized with a ß-actin antibody to control for variations in sample loading.

Nucleolin localizes to the cytoplasm of intact erythroid progenitor cells. Although nucleolin has been identified in the cytoplasm of nonerythroidcells (7, 68), its presence in erythroid cytoplasm has neverbeen formally established. Two methodologically independentapproaches were used to demonstrate that nucleolin can be foundin the cytoplasm of erythroid cells representing temporallydistinct stages of terminal differentiation. Nucleolin was easilydetected by Western analysis of cytoplasm prepared from murineerythroid MEL cells (Fig. 4A) and was also identified in extractprepared from FACS-sorted murine reticulocytes (Fig. 4B). Theseresults confirm that nucleolin is abundant in erythroid cytoplasm,permitting consideration of its potential role in stabilizingthe relatively pure population of globin mRNAs that also populatethese cells.

View larger version (32K):
[in this window]
[in a new window]
FIG. 4. Nucleolin is present in the cytoplasms of differentiating erythroid cells. (A) Nucleated erythroid progenitors contain cytoplasmic nucleolin. Western blot analysis was performed on total (T), nuclear (N), and cytoplasmic (C) extracts prepared from MEL cells using nucleolin (Nuc) antibody. The blot was stripped and rehybridized with antibodies directed against nucleus- and cytoplasm-specific histone deacetylase-2 (HDAC-2) and ß actin, respectively. Affinity-purified nucleolin was analyzed in parallel as a positive control. (B) Anucleate erythroid progenitors (reticulocytes) contain cytoplasmic nucleolin. Hemolysate prepared from FACS-sorted murine reticulocytes (Retic) was analyzed by Western transfer analysis using nucleolin antibody. Total, cytoplasmic, and nuclear extracts prepared from MEL cells were analyzed in parallel as positive controls, and recombinant ${alpha}$ CP was run as a negative control (NC). The blot was stripped and rehybridized with HDAC-2 antibody to confirm the absence of contaminating nucleoplasm in the Retic sample.

Nucleolin binds human ß-globin mRNA in both cultured cells and primary human erythroid progenitors. The demonstration that nucleolin binds to ssDNA and RNA correspondingto the ß-globin 3'UTR in vitro predicted its capacityto interact with full-length ß-globin mRNA transcriptsin vivo in intact cells. This hypothesis was subsequently testedusing an RNA-immunoprecipitation (RIP) method (15, 16). Humanß-globin mRNA was detected in cell extract as wellas in a nucleolin immunoprecipitate prepared from cells transfectedwith pTRE-ß^WT (Fig. 5A, lanes 3 and 5) but not infractions prepared from cells transfected with an empty pTREcontrol vector (lanes 2 and 4). The specificity of the nucleolin-globinmRNA interaction was indicated by control experiments in whichconstitutively expressed GAPDH (glyceraldehyde-3-phosphate dehydrogenase)mRNA was observed in cell extract (Fig. 5A, lanes 6 and 7) butnot in the nucleolin immunoprecipitate (Fig. 5A, lanes 8 and9). Human ß-globin mRNA was not identified in immunoprecipitateprepared with an unrelated antibody (Fig. 5B, compare lanes4 and 5), demonstrating that the results do not arise from artifactualbinding of ß-globin mRNA to immunoglobulin. The likelyphysiological importance of the interaction between nucleolinand the ß-globin mRNA was indicated by RIP analysesof lysate prepared from density-fractionated human erythroidprogenitors. Both ß-globin mRNA and control GAPDHmRNA were observed in the unfractionated lysate (Fig. 5C, lanes2 and 4), while ß-globin mRNA, but not GAPDH mRNA,was detected in immunoprecipitate prepared using nucleolin antibody(Fig. 5C, compare lanes 3 and 5). These experiments confirmthat ß-globin mRNA and nucleolin interact with highmutual specificity in intact cultured cells as well as in primaryhuman erythrocytes.

View larger version (32K):
[in this window]
[in a new window]
FIG. 5. Nucleolin binds to ß-globin mRNA in intact cells. (A, B) Specificity of nucleolin-ß-globin mRNA interaction in vivo. (A) HeLa^tTA cells were transfected with pTRE-ß^WT (ß^WT) or with an empty pTRE vector control (C). Total RNA recovered from cell extract (E) or nucleolin immunoprecipitate (IP) was RT-PCR amplified using ß^WT sequence-specific oligomers, generating a 261-bp product (lanes 2 to 5), or with GAPDH mRNA-specific oligomers, producing a 116-bp product (lanes 6 to 9). Lane 1 contains a 100-bp DNA ladder. (B) Total RNA was recovered from immunoprecipitate (lanes 3 to 5) or extract (lanes 6 and 7) prepared from cells transfected with pTRE-ß^WT (ß^WT) or with the empty pTRE vector control (C). Immunoprecipitates were prepared using nucleolin- or tumor necrosis factor-specific antibodies (Nuc or TNF, respectively). RNAs were analyzed by RNase protection using in vitro-transcribed, ³²P-labeled RNA probes (84). Intact and RNase-digested ³²P-labeled probes were run in lanes 1 and 2, respectively. (C) Nucleolin binds ß-globin mRNA in intact human erythroid cells. Purified RNA prepared from the extract or nucleolin immunoprecipitate of density-fractionated human erythroid cells was RT-PCR amplified using human ß-globin- and GAPDH-specific oligomers. M, DNA size markers.

An mRNA-destabilizing mutation in the ß-globin 3'UTR reduces nucleolin binding in vitro and in vivo. The proposed functional linkage between nucleolin binding andß-globin mRNA stability was subsequently investigatedby assessing the affinity of nucleolin for variant ß^H-globinmRNAs containing destabilizing and control nondestabilizing3'UTR hexanucleotide linker-scanning substitutions. The affinityof purified nucleolin for ssDNAs corresponding to the ß-globin3'UTR was substantially reduced by the mRNA-destabilizing H124mutation but not by flanking mutations at position H120 or H126that had had no discernible effect on ß-globin mRNAstability in earlier in vivo studies (Fig. 6A). The adverseeffect of the H124 mutation on nucleolin binding was also demonstratedin vivo using RIP analyses of HeLa^tTA cells expressing ß^WT,ß^H112, and ß^H124 mRNAs (Fig. 6B). Each mRNAwas easily detected in the cell extract (Fig. 6B, lanes 2, 4,and 6), while only the stable ß^WT and ß^H112mRNAs—but not the unstable ß^H124 mRNA—werepresent in the nucleolin immunoprecipitate (Fig. 6B, lanes 3,5, and 7). Pre-rRNA, which is known to bind nucleolin strongly(1), was observed in all samples, confirming the quality ofthe mRNAs and controlling for other aspects of the experimentalmethod. These results were corroborated by parallel analysesof ß^WT, ß^H112, and ß^H124 mRNAsusing an independent RNase protection approach (Fig. 6C) andconfirmed in repeat analyses (data not shown). Consequently,the native sequence targeted by the H124 mutation appears tofunction both as a determinant of ß-globin mRNA stabilityand as a binding site for nucleolin, providing a critical linkbetween these two processes.

View larger version (17K):
[in this window]
[in a new window]
FIG. 6. Differential binding of nucleolin to mRNA-stabilizing and -destabilizing 3'UTR determinants. (A) ß-Globin mRNA-destabilizing linker-scanning mutations reduce nucleolin binding in vitro. Agarose-immobilized, 59-nt ssDNAs corresponding to the proposed 3'UTR nucleolin-binding region of ß-globin mRNA were incubated in cytoplasmic extract, and adherent proteins were assessed by Western transfer analysis using nucleolin antibody. The wild-type sequence (WT) as well as sequences containing destabilizing (H124) and nondestabilizing (H120 and H126) HindIII mutations were assessed. Unfractionated extract (E) and extract adhering to unliganded agarose beads were run in the first two lanes as controls. (B, C) Full-length, unstable ß^H124 mRNA binds nucleolin poorly in vivo in intact, cultured cells. Unfractionated cell extract or nucleolin immunoprecipitate (IP) was prepared from cultured cells transfected with genes encoding ß^WT, ß^H112, and ß^H124 mRNAs. (B) Recovered RNAs were RT-PCR amplified using primers specific to ß-globin mRNA (top) or to internal control pre-rRNA (bottom). The reaction products were resolved on an ethidium bromide-stained, nondenaturing polyacrylamide gel. Lane 1 contains a 100-bp DNA ladder. (C) Recovered RNAs were assessed by RNase protection using an in vitro-transcribed, ³²P-labeled ß-globin RNA probe.

A model for ß-globin mRNA stability. Although the ß-PRE appears to be a determinant ofß-globin mRNA stability in vivo (84), its anticipatedrole as a target for ${alpha}$ CP binding has been difficult to recapitulatein vitro. We propose a model for ß-globin mRNA stabilitythat incorporates the findings presented here and, in addition,accounts for previous experimental evidence that indirectlyimplicates ${alpha}$ CP in this process. In this model, the ß-globin3'UTR has the potential to assume a highly stable stem-loopstructure that incorporates the ß-PRE and nucleolin-bindingsites into its left and right half-stems, respectively (Fig.7A). If secondary structure were to inhibit the access of ${alpha}$ CPto the ß-PRE-binding site, then any process that weakensthe stem structure would be predicted to facilitate ${alpha}$ CP binding(Fig. 7B).

View larger version (20K):
[in this window]
[in a new window]
FIG. 7. Model for regulated ß-globin mRNA stability. (A) A secondary structure exists within the ß-globin 3'UTR. A stable stem-loop structure within the ß-globin 3'UTR is predicted by the Zuker algorithm using default parameters (50, 87). The positions of the ß-PRE and the two previously identified mRNA-destabilizing hexanucleotide mutations (H122 and H124) (gray) are indicated. (B) Predicted effect of the secondary structure on ${alpha}$ CP binding. The access of ${alpha}$ CP to its functional ß-PRE-binding site (black) is favored by the relaxation of a native ß-globin mRNA stem-loop motif. The positioning of a binding site for nucleolin on the opposite (right) half-stem suggests a role for nucleolin in shaping the high-order 3'UTR structure. (C) RNA context-dependent binding of ${alpha}$ CP to the ß-PRE. ssDNA ligand-bound r ${alpha}$ CP was resolved by Coomassie blue staining after SDS-PAGE. Agarose-immobilized ligands (top), including the ${alpha}$ -PRE and ß-PRE (lanes 3 and 6), the full-length ß-3'UTR (lane 5), a full-length ${alpha}$ -globin 3'UTR in which the ß-PRE is substituted for the ${alpha}$ -PRE (lane 7), and a negative-control poly(dI · dC) (lane 4), are identified. Lanes 1 and 2 contain protein standards (M) and r ${alpha}$ CP, respectively. (D) ${alpha}$ CP binding to the ß-PRE is inhibited by its participation in a stable stem structure. Agarose-immobilized 2'-O-methylated RNAs corresponding to the predicted left and right half-stems (LHS and RHS, respectively) of the 3'UTR structure (32 nt each) were incubated with r ${alpha}$ CP either singly (lanes 2 and 3) or in combination (lane 4), and adherent ${alpha}$ CP was resolved by Coomassie blue staining of SDS-PAGE gels. The LHS (black) and RHS (gray) contain the ß-PRE and the H122/H124 nucleolin-binding sites, respectively. M, protein size markers. (E) Mutations that disrupt the 3'UTR secondary structure enhance ${alpha}$ CP binding to ß-globin mRNA. Agarose-immobilized ssDNAs were incubated with HeLa cell extract, and adherent factor was analyzed by Western blot analysis using ${alpha}$ CP antibody. The predicted structures of individual ssDNAs are schematically illustrated (top). The ß-PRE and proposed nucleolin-binding sites are represented as thick black and gray lines. Right-half-stem modifications include the deletion of a native 18-nt sequence (broken thin black line) (lane 5), the substitution of an unrelated 18-nt sequence (thin gray line) (lane 3), and the substitution of a stem-destabilizing 18-nt region containing the ß-PRE (lane 6). The unrelated stem-destabilizing sequence was analyzed as a control (lane 4). Lane 1 contains recombinant ${alpha}$ CP as a migration control (C). See Materials and Methods for details of each ssDNA sequence. (F) Nucleolin (Nuc) enhances ${alpha}$ CP binding to the ß-globin 3'UTR in vitro. Agarose-immobilized ssDNAs corresponding to the ß-globin 3'UTR were incubated with r ${alpha}$ CP following no pretreatment (lane 2), heat denaturation at 95°C for 5 min ( ${Delta}$ T) (lane 3), or preincubation with affinity-purified nucleolin (lane 4). Ligand-bound r ${alpha}$ CP was analyzed by SDS-PAGE. Lane 1 contains r ${alpha}$ CP as a migration control.

The possibility that native secondary structure inhibits ${alpha}$ CPbinding was tested in three independent affinity-binding studies.Results from the first study suggest that ${alpha}$ CP access to the ß-PREis highly dependent upon its mRNA context: recombinant ${alpha}$ CP (r ${alpha}$ CP)binds poorly to an ssDNA corresponding to the full-length ß-3'UTR(Fig. 7C, lane 5), while binding avidly to ssDNAs correspondingto the ß-PRE either in isolation (Fig. 7C, lane 6)or when inserted into a different 3'UTR (Fig. 7C, lane 7). Ina second study, baseline interaction of r ${alpha}$ CP with the left-half-stemß-PRE was ablated by its preincubation with an ssDNAcorresponding to the right half-stem (Fig. 7D). A third studydemonstrated that ${alpha}$ CP binds poorly to the intact 3'UTR stem-loopstructure (Fig. 7E, lane 2) while, in agreement with our predictions,binding strongly to 3'UTRs that contain stem-destabilizing substitutions(Fig. 7E, lanes 3 and 6) or deletions (Fig. 7E, lane 5). Theresults of all three experiments are consistent with a modelin which native structure within the ß-globin 3'UTRmust be remodeled as a precondition for ${alpha}$ CP interaction withthe ß-PRE.

The potential role that nucleolin may play in remodeling the3'UTR stem-loop structure in vivo was investigated by assessingthe binding of r ${alpha}$ CP to agarose-immobilized ß-globin3'UTRs in vitro under different conditions. The poor baselineaffinity of r ${alpha}$ CP for the naked probe is significantly enhancedby preincubating the ß-globin 3'UTR with affinity-purifiednucleolin (Fig. 7F, compare lanes 2 and 4). Although this resultdoes not favor any specific mechanism, the possibility thatnucleolin facilitates ${alpha}$ CP binding through its effect on mRNAstructure is suggested by the observation that ${alpha}$ CP binding isalso enhanced, in the absence of nucleolin, by prior heat denaturationof the agarose-immobilized ß-3'UTR ligand (Fig. 7F,lane 3). In the aggregate, the results of these in vitro analysesare consistent with the assembly of a stable structure withinthe ß-globin 3'UTR that inhibits ${alpha}$ CP binding and suggestthat nucleolin facilitates ${alpha}$ CP access through interaction withthis structure.

DISCUSSION

Top

Discussion

Although the high stability of human ß-globin mRNAhas been repeatedly demonstrated (2, 4, 36, 42, 62, 63) andthe importance of this characteristic to normal ß-globinexpression firmly established (10, 64), the relevant molecularmechanisms have yet to be defined. The current article providesoriginal evidence that this process is likely to require cisdeterminants and trans-acting factors that have not previouslybeen appreciated. We initially designed and validated an importantmethod for assessing the stability of an mRNA in vivo in intactcultured cells without affecting the expression or functionof other cellular mRNAs (Fig. 1). Using this approach, we identifieda defined 3'UTR region that is critical to normal ß-globinmRNA stability (Fig. 2), thus linking this important functionalcharacteristic to a discrete, previously unrecognized structuraldeterminant. This evidence does not rule out the possibilitythat other cis elements may participate in this process, sincethe experimental method is likely to overlook extensive and/orhighly degenerate structural determinants. This technical limitationmay explain why the ß-PRE element, whose importancehas previously been implicated in vitro and in vivo (84), wasnot functionally identified. Nevertheless, the critical natureof the H122-H124 region to ß-globin mRNA stabilityis clear.

Among three candidate 3'UTR-binding factors, nucleolin appearsmost likely to play a central role in stabilizing ß-globinmRNA in vivo. Nucleolin displays a relative specificity forssDNAs corresponding to the ß-globin 3'UTR in vitro(Fig. 3) and interacts with full-length ß-globin mRNAboth in intact cultured cells and in primary human erythroidprogenitors (Fig. 5). Moreover, binding is ablated in vivo bymRNA-destabilizing mutations but preserved in ß-globinmRNAs carrying control nondestabilizing mutations, firmly linkingnucleolin binding to its proposed mRNA-stabilizing function(Fig. 6).

Although it is tempting to speculate that nucleolin directlystabilizes ß-globin mRNA, we think it more likelythat this highly abundant factor facilitates functional interactionof other, known globin mRNA-stabilizing factors, such as ${alpha}$ CP.Our structural analyses are consistent with this possibility;nucleolin binds to the right half-stem of a stable 3'UTR stem-loopstructure, directly opposite to the ß-PRE (Fig. 7A).Among several mechanistic possibilities, we favor one in whichnucleolin binding is required to relax a stem-loop structurethat is predicted to interfere with ${alpha}$ CP binding (Fig. 7B). Invitro studies show enhanced ${alpha}$ CP binding to 3'UTRs in which thestem-loop structure is disrupted (Fig. 7C to E), consistentwith the proposed mechanism. A specific role for nucleolin inthis process is suggested by the demonstration that ${alpha}$ CP bindingto the ß-globin 3'UTR can be enhanced either by heatdenaturation or by preincubation with immunopurified nucleolin(Fig. 7F). Though potentially informative, these studies donot resolve the final common pathway through which the combinedactivities of nucleolin and ${alpha}$ CP effect mRNA stabilization, includingpotential effects on ß-globin mRNA polyadenylationand/or translational efficiency. Nevertheless, we find the proposedmodel to be particularly attractive because it accommodatesboth our current data and evidence from previous studies favoringa critical role for ${alpha}$ CP in stabilizing the ß-globinmRNA.

The apparent role that nucleolin plays in stabilizing ß-globinmRNA is consistent with its participation in a wide range ofmolecular processes. In the nucleus, nucleolin is associatedwith ribosome biogenesis (9, 35), chromatin remodeling (23),immunoglobulin isotype switching (30), telomere formatting (33),and posttranscriptional processing of nascent mRNAs (33). Inthe cytoplasm, nucleolin binds to the 5' and 3'UTRs of specificmRNAs, enhancing both their stabilities and their translationalefficiencies (15, 56, 58, 69, 71, 72, 85, 86). This functionaldiversity reflects both the complexity of the nucleolin corestructure and the heterogeneity of isoforms that it can assume.The core structure, which comprises acidic and glycine-richdomains as well as four RNA-binding domains (RBDs) (43), isextensively modified by targeted proteolysis (14, 24), phosphorylation(13, 54, 59, 60, 67), ADP ribosylation (44), and methylation(46), resulting in combinatorial structural complexity thatmay form the basis for its observed functional heterogeneity.

The four centrally positioned RBDs of nucleolin mediate itsinteraction with RNA both in the nucleus (32, 33) and in thecytoplasm (15, 56, 58, 69, 71, 72, 85, 86). These domains, whichare structurally similar to RBDs in protein factors that regulatethe stabilities and translational efficiencies of other mRNAs(22), appear to subserve a parallel spectrum of functions innucleolin. Nucleolin has been reported to stabilize mRNAs encodingamyloid precursor protein (85, 86), renin (58, 72), CD154 (71),and Bcl-2 (56, 69) by binding to structurally distinct cis elementswithin their 3'UTRs. The heterogeneity in its posttranslationalmodification may account for nucleolin's equally heterogeneousmRNA-binding specificities. The nucleolin-binding sites of interleukin2 and amyloid precursor protein mRNAs, which share a common5'CUCUCUUUA3' target sequence (15, 85, 86), differ from theA/U-rich nucleolin-binding site in the 3'UTR of Bcl-2 mRNA (56,69) and from the 5'UCCCGA3' motif mediating its binding to rRNA(1, 27). Nucleolin may also bind to motifs corresponding tosplice acceptor sequences (5'UUAGG3') (33) and to G-quartetand other related nonlinear, thermodynamically favorable nucleicacid structures that are not predicted by common mRNA-foldingalgorithms (83). The ß-globin mRNA nucleolin-bindingdeterminant that we describe (Fig. 2) is dissimilar to eachof these linear elements, possibly reflecting interaction witha subset of nucleolin structural isoforms that carry specificphosphoryl, ADP-ribosyl, or methyl modifications.

The wide variety of molecular processes that require nucleolinsuggests that it may serve a general role—as a molecularscaffold or perhaps a substrate-remodeling factor—actingin concert with other proteins that provide the required functionalspecificity. We suggest that a specific nucleolin-ß-globinmRNP may have to assemble before ${alpha}$ CP can bind, and subsequentlystabilize, the full-length ß-globin mRNA. This hypothesismay explain the difficulties that we and others have encounteredin attempting to demonstrate bimolecular interaction betweenthe ß-globin 3'UTR and ${alpha}$ CP in vitro, despite the clearimportance of the proposed ${alpha}$ CP-binding site to human transgenicß-globin mRNA stability observed in vivo in mice (84).The potential importance of cooperative interactions betweenthese two protein factors is additionally indicated by analysesof renin mRNA, which, like ß-globin mRNA, displaysnucleolin-dependent stability and binds both nucleolin and ${alpha}$ CPto the same 3'UTR region (58, 72). These aspects of nucleolinfunction merit close scrutiny as they may provide opportunitiesfor novel therapeutic approaches to the treatment of commonthalassemias and hemoglobinopathies.

ACKNOWLEDGMENTS

We thank Lorelle Bradley for technical assistance and StephenLiebhaber for critical reading of the manuscript.

This work was supported in part by NIH grants HL-R01-061399and HL-U54-070596.

FOOTNOTES

* Corresponding author. Mailing address: Abramson Research Building, Room 316F, The Children's Hospital of Philadelphia, 34th Street and Civic Center Boulevard, Philadelphia, PA 19104. Phone: (215) 590-3880. Fax: (215) 590-4834. E-mail: jeruss{at}mail.med.upenn.edu.

REFERENCES

Top