![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
,
Justyna A. Janas,1,
Masaru Niki,2
Pier Paolo Pandolfi,2 and
Linda Van Aelst1*
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724,1 Department of Human Genetics, Memorial Sloan Kettering Cancer Center, New York, New York 100212
Received 8 November 2005/ Returned for modification 23 December 2005/ Accepted 16 January 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The SFKs constitute a family of non-receptor tyrosine kinases whose activities are tightly regulated in response to growth factors in vivo (8). They contain SH3 and SH2 domains in their N-terminal regions and a tyrosine kinase domain (SH1) followed by a flexible tyrosine-containing tail at their C termini. The SH3 domain interacts intramolecularly with a short polyproline type II helix located between the SH2 and SH1 domains, while the SH2 domain binds to phosphorylated Tyr-529 (for mouse Src) within the C-terminal tail. These two interactions lock the molecule in a closed, inactive state. The stimulation of growth factor receptors triggers transient dephosphorylation of Tyr-529 and release of the intramolecular interactions, as well as the autophosphorylation of Tyr-418 (for mouse Src) located in the SH1 domain. These events result in the full activation of SFKs. Conversely, phosphorylation of Tyr-529 and dephosphorylation of Tyr-418 inhibit SFK activity (reviewed in references 5, 10, 18, and 51). Several lines of evidence have documented that phosphorylation of Tyr-529, which is executed by the C-terminal Src kinase (Csk), is a key event in the regulation of Src activity in vivo (reviewed in references 10, 16, and 23). For example, substitution of this tyrosine with phenylalanine constitutively activates Src, and this mutant possesses transforming abilities. Moreover, oncogenic v-Src has constitutive kinase activity and is transforming in part because it lacks this tyrosine. Finally, inactivation of the Csk gene in mice elevates SFK activity levels in embryonic tissues, and embryonic development halts between 9 and 10 days of gestation (29, 41). These observations indicate that Csk is instrumental in keeping SFK activity low in vivo.
Dok-1 (also known as p62dok) was initially identified as a tyrosine-phosphorylated, 62-kDa protein associated with p120Ras-GAP in Philadelphia chromosome-positive chronic myeloid leukemia blasts and in v-Abl transformed B cells (11, 57). It later turned out to be the prototype member of a new adaptor protein family, referred to as the Dok (downstream of tyrosine kinases) family. Members of this family become phosphorylated upon activation of many receptor tyrosine kinases and cytoplasmic kinases, including SFKs (17, 30, 31, 37, 61). To date, six Dok proteins (Dok-1 to Dok-6) have been identified (17, 19, 20, 26, 31, 35, 43). They all harbor an N-terminal pleckstrin homology (PH) domain, a central phosphotyrosine binding domain (PTB), and a C-terminal region containing multiple tyrosine residues. When phosphorylated, these tyrosines can serve as docking sites for SH2 domain-containing proteins. For example, Dok-1 has been shown to bind Ras-GAP, Nck, and Csk (45, 49, 61).
Functional studies have revealed that Dok-1, Dok-2, and Dok-3 family members inhibit cell proliferation and down-regulate Ras and MAPK activation triggered by diverse stimuli. Dok-1-deficient mouse cells of different origins show increased DNA synthesis and elevated Ras and MAPK activities in response to growth factors (including PDGF) and antigen receptor agonists compared to their wild-type (WT) counterparts (21, 58, 61). Conversely, ectopic expression of Dok-1 results in suppression of growth factor-induced MAPK activation (61). Overexpression of Dok-2 (or p56dok-2, Dok-R, or FRIP) and Dok-3 (or DokL) also negatively influences cell growth and Ras/MAPK activation in response to various stimuli (17, 25, 30, 43, 53). Additionally, Dok-1, Dok-2, and Dok-3 proteins have been found to interfere with v-Src-, v-Abl-, or p210bcr-abl-induced transformation (17, 21, 46, 52). Strikingly, mice lacking both Dok-1 and Dok-2 spontaneously develop a chronic myeloid leukemia-like myeloproliferative disease (44, 59). Thus, Dok-1, Dok-2, and Dok-3 proteins play prominent roles as negative regulators of mitogenic and oncogenic signaling. In addition to their effects on cell growth, these proteins have been shown to participate in filopodium formation (Dok-1) (56), cell migration (Dok-1 and Dok-2) (40, 45), and cell differentiation (Dok-2) (27).
To date, little is known about the molecular mechanism(s) by which the Dok-1, Dok-2, and Dok-3 proteins exert their inhibitory effects on cell proliferation. We previously demonstrated that Dok-1 translocates to the plasma membrane upon PDGF stimulation through the binding of its PH domain to PI3-K lipid products. This translocation, which likely tethers other signaling components to the membrane, is necessary for Dok-1 to suppress PDGF receptor (PDGFR) signaling (61). A number of Dok-1-interacting proteins, including Ras-GAP, Csk, and Nck, have been identified; yet, it has not been resolved which of these (or other) signaling components or which signaling pathway(s) is important for the negative effect of Dok-1 on growth factor-induced mitogenesis. Here, we show that Dok-1 interferes with the PDGF-induced Ras/MAPK and Src/c-Myc pathways by acting on different partners. We also demonstrate that attenuation of each of these two pathways contributes to the negative effect of Dok-1 on mitogenesis.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell culture and retroviral transduction. WT and Dok-1–/– mouse embryonic fibroblasts (MEFs) were prepared as described previously (21) and cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. NIH 3T3 cells were cultured in DMEM containing 10% calf serum. Retroviral gene transfer was performed as described previously (4). Infected MEF and NIH 3T3 cells were selected for 2 days in medium containing 2 µg/ml and 2.5 µg/ml of puromycin (Sigma), respectively. For stimulations, cells were serum starved for 48 h in DMEM containing 0.1% fetal bovine serum (MEFs) or for 24 h in DMEM containing 0.2% calf serum (NIH 3T3) and then exposed to PDGF (R&D Systems).
Antibodies. Anti-phospho-Y418 Src (pSrc418), anti-phospho-Y529 Src (pSrc529), and polyclonal anti-Src antibodies (Abs) were from Cell Signaling Technology. Monoclonal anti-Src (GD11) Ab was from Upstate Biotechnology. Polyclonal anti-c-Myc (N-262), anti-p42 MAPK (C14), and anti-Csk (C20) Abs were from Santa Cruz Biotechnology. Monoclonal anti-Ras-GAP Ab was from Transduction Laboratories. Phospho-specific p44/p42 MAPK Ab was from New England BioLabs. Monoclonal anti-U2AF65 Ab was a gift from A. Krainer (Cold Spring Harbor Laboratory). Anti-human Dok-1 monoclonal Ab was described previously (61). It recognizes mouse Dok-1 but with much lower affinity.
Cell lysis and immunoblotting. For measurement of c-Myc protein levels, 5 x 105 MEFs were treated as indicated above, washed with phosphate-buffered saline (PBS), lysed in 1x Laemmli buffer (50 mM Tris-HCl [pH 6.8], 3% sodium dodecyl sulfate [SDS], 10% glycerol, 5% ß-mercaptoethanol, 0.002% bromophenol blue), and boiled for 10 min. To determine MAPK and Src phosphorylation states, detergent extracts were resolved by SDS-polyacrylamide gel electrophoresis (PAGE) (61), transferred to Immobilon polyvinylidene difluoride membrane (Millipore), and probed with the indicated Abs. Immune complexes were detected using enhanced chemiluminescence (Amersham Biosciences).
Immunoprecipitation. NIH 3T3 cells transduced with pBabePuro/Flag-His containing Dok-1WT, Dok-1CSK, Dok-1DM, Dok-1GBD, or an empty vector were serum starved and either left unstimulated or stimulated with PDGF (12.5 ng/ml) for 10 min in the presence of 0.5 mM Na3VO4. Ten 10-cm-diameter dishes of cells were lysed at 4°C in lysis buffer (LB) (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% Triton X-100, 10% glycerol, 50 mM NaF, 40 mM ß-glycerophosphate, 2 mM Na3VO4, 2 mM MgCl2, Complete protease inhibitors). Extracts were precleared by incubation with protein A-agarose (Roche) for 1 h at 4°C, protein concentrations were determined using a Micro BCA protein assay (Pierce), and equal amounts of cell lysates were incubated with anti-FLAG M2 affinity gel beads (Sigma) for 8 h. Beads were washed with LB, and immunoprecipitates were eluted with LB containing FLAG peptide (0.2 mg/ml) (Sigma) for 30 min at 4°C. Eluted proteins were resolved by SDS-PAGE and immunoblotted with the indicated Abs.
Src kinase assay.
Serum-starved MEFs were treated with PDGF (12.5 ng/ml) or left untreated. Cells were lysed in modified RIPA buffer (50 mM Tris-HCl [pH 7.2], 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS, 5% glycerol, 2 mM MgCl2, 2 mM dithiothreitol, 50 mM NaF, 40 mM ß-glycerophosphate, 2 mM Na3VO4, Complete protease inhibitors), and equal amounts of cell extracts were incubated with anti-Src (GD11) Ab precoupled to protein G-agarose (Roche) for 1 h at 4°C. Beads were washed three times with Src kinase reaction buffer (100 mM Tris [pH 7.2], 125 mM MgCl2, 5 mM MnCl2, 2 mM EGTA, 250 µM Na3VO4, 2 mM dithiothreitol, Complete protease inhibitors), and immunoprecipitated Src was subjected to an in vitro kinase assay and Western blotting with polyclonal anti-Src Ab. The activity of Src kinase was measured using a Src kinase assay kit (Upstate Biotechnology), which is based on Src-dependent phosphorylation of a substrate peptide (KVEKIGEGTYGVVYK) derived from p34cdc2. The assay was performed according to the manufacturer's recommendations. Background controls containing no Src substrate or substrate alone were also included. The phosphorylated peptide was separated from free [
-32P]ATP by differential binding to P81 phosphocellulose paper, and 32P incorporation was quantified by liquid scintillation counting.
Immunofluorescence. WT or Dok-1–/– MEFs (5 x 104) on glass coverslips were serum starved and either left untreated or treated with PDGF (12.5 ng/ml) for 10 min. Cells were washed twice with PBS and fixed with 3.5% paraformaldehyde in PBS for 15 min at room temperature. Subsequently, cells were permeabilized in 0.2% Triton X-100 in PBS for 10 min, blocked with 5% bovine serum albumin in PBS for 1 h, and stained overnight with anti-Csk monoclonal Ab (Transduction Laboratories). Coverslips were then washed with PBS and incubated with AlexaFluor 488 goat anti-mouse secondary Ab (Molecular Probes), washed with PBS, and mounted with Vectashield (Vector Labs). Images were taken using a Zeiss Axioskop-2 fluorescence microscope and processed with Openlab software.
Quantitative real-time PCR (Q-PCR).
For measurement of c-myc mRNA levels, serum-starved MEFs were treated with PDGF (12.5 ng/ml) or left untreated. When an SFK inhibitor was used, cells were incubated with SU6656 (Calbiochem) or a vehicle, as described in Results. Total RNA was isolated using TRIzol (Invitrogen), and 2 µg of each RNA sample was reverse transcribed in a 100-µl reaction volume by use of a TaqMan kit (Applied Biosystems) and random hexamer primers (Applied Biosystems) according to the manufacturer's recommendations. c-myc and endogenous reference gene ß-actin cDNAs were quantified using SYBR green PCR master mix (Applied Biosystems) and an ABI PRISM 7700 sequence detection system. Briefly, 1.25-µl aliquots of the reverse-transcribed mixtures were amplified in 12.5-µl reaction volumes containing 0.3 µM c-myc forward primer, 5' GACAGCAGCTCGCCCAAAT 3', and reverse primer, 5' AGCAGCGAGTCCGAGGAA 3', or ß-actin forward primer, 5' GGCCAACCGTGAAAAGATGA 3', and reverse primer, 5' TGGATGGCTACGTACATGGCT 3'. Cycling conditions were 50°C for 2 min and 95°C for 10 min, followed by 40 amplification cycles at 95°C for 15 s and 60°C for 1 min. Each experiment was performed with three separate determinations for each amplicon. Relative expression of c-myc mRNA was calculated using the comparative 
method (where CT is cycle threshold) (36). Transcript levels for c-myc were normalized to those of ß-actin. For PDGF-treated cells, the induction (n-fold) of c-myc mRNA was calculated relative to that of the corresponding untreated sample and presented as . The error bar represents an asymmetric range of values reflecting the conversion of an exponential variable into the linear form, which was determined by evaluating the term using 
CT + SD and CT – SD, where SD is a standard deviation of CT.
Thymidine incorporation assay. MEFs (4 x 104 cells per well in 24-well plates) were serum starved, stimulated with PDGF (12.5 ng/ml) for 15 h, and pulse-labeled with 1 µCi [3H]thymidine (Amersham Biosciences) in 0.5 ml of medium for the last 3 h of PDGF treatment. After labeling, cells were washed once with ice-cold PBS and twice with ice-cold 5% (wt/vol) trichloroacetic acid, rinsed with PBS, and lysed in 0.3 N NaOH. Aliquots of solubilized cells were neutralized with 6 N HCl and transferred to scintillation vials for scintillation counting.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Src family kinases mediate the effect of Dok-1 on PDGF-triggered c-myc induction. Several lines of evidence indicate that a signaling pathway involving SFKs, but not the Ras/MAPK pathway, is initiated upon PDGF stimulation to induce c-myc mRNA expression (1, 3, 9, 14, 24). We therefore examined whether the increase in c-myc mRNA levels observed with PDGF-treated Dok-1–/– cells is dependent on SFK activity. Quiescent WT and Dok-1–/– cells were treated with a selective SFK inhibitor, SU6656 (3), or control vehicle for 20 min before the addition of PDGF. Subsequently, levels of c-myc mRNA were measured 1 hour after PDGF treatment by Q-PCR. Consistent with previous data, inhibition of SFKs diminished the PDGF-evoked c-myc induction in WT MEFs in a dose-dependent manner. Importantly, SU6656 treatment also significantly reduced the elevated c-myc mRNA levels observed with Dok-1–/– cells (Fig. 2A). It is important to note that at the concentrations used the SU6656 inhibitor does not inhibit PDGFR tyrosine kinase activity and does not appreciably interfere with PDGF-induced MAPK activation (3; data not shown). Moreover, it has been reported that the MAPK inhibitor PD98059 barely affects c-myc mRNA induction by PDGF (14). Thus, the observation that SFK inhibition suppressed the elevated c-myc mRNA levels in PDGF-stimulated Dok-1–/– cells suggested that Dok-1 affects PDGF-stimulated c-myc induction through an SFK-dependent mechanism.
|
|
Dok-1 negatively regulates the PDGFR/Src/c-Myc pathway through its interaction with Csk. What is the mechanism by which Dok-1 interferes with Src activity and subsequently c-myc mRNA induction in response to PDGF stimulation? Dok-1 becomes translocated to the plasma membrane upon PDGF stimulation and has been reported to interact with Csk, a negative regulator of SFKs (49, 61). Based on these findings and our observation that Dok-1 affects Tyr-529 phosphorylation, we hypothesized that Dok-1 could down-regulate PDGF-initiated Src activation by recruiting Csk to the vicinity of active Src at the membrane. To test this possibility, we checked whether Dok-1 associates with Csk and Src in fibroblasts and whether it influences Csk translocation to the plasma membrane upon PDGF stimulation. Lysates from PDGF-treated or untreated NIH 3T3 cells stably transduced with either a Flag-tagged, Dok-1-expressing retrovirus or an empty control vector were subjected to anti-Flag immunoprecipitation. The immune complexes were then analyzed by Western blotting with anti-Csk and anti-Src Abs. Both Csk and Src proteins were found to associate with Dok-1 in PDGF-treated cells (Fig. 3A). These associations were specific since neither protein was present in immunoprecipitates derived from cells transduced with the control vector. Notably, the interaction between Dok-1 and Csk was detected mainly upon PDGF stimulation. In contrast, Src was found to associate with Dok-1 without stimulation as well. However, more Src was found to associate with Dok-1 upon PDGF stimulation, suggesting that Src can interact with Dok-1 via inducible and constitutive mechanisms (Fig. 3A).
|
To address whether the interaction of Dok-1 with Csk is required for Dok-1 to interfere with PDGF-induced Src activation and c-myc induction, we generated a Dok-1 mutant that is defective in Csk binding. Based on previous studies showing that the binding between mouse Dok-1 and Csk is abolished by mutating Y450 (49), we introduced the corresponding mutation, Y449F, into human Dok-1 (Dok-1CSK) and found that it abrogated the interaction between Dok-1 and Csk (Fig. 3C). We then tested the ability of the Dok-1CSK mutant to suppress the elevated Src activation observed in PDGF-stimulated Dok-1–/– cells. In this set of experiments, we also included a Dok-1 mutant which we previously demonstrated to be defective in Ras-GAP binding (Dok-1GBD) (61) and a Dok-1Y337/341F (Dok-1DM) mutant. Corresponding Y336/340F mutations in mouse Dok-1 have been reported to impair its ability to suppress Ras-MAPK signaling without affecting Ras-GAP binding (50). We confirmed that this mutant binds just as well to Ras-GAP as Dok-1WT does in PDGF-stimulated fibroblasts (data not shown). Selected cell populations stably expressing Dok-1WT, one of the Dok-1 mutants mentioned above, or empty vector were serum starved, stimulated with PDGF, and assessed for Src activity at the indicated time points using Abs against phosphorylated Tyr-418 and Tyr-529.
As shown in Fig. 4, the Dok-1CSK mutant failed to suppress the elevated Tyr-418 phosphorylation seen with PDGF-stimulated Dok-1–/– MEFs. In contrast, expression of Dok-1WT, as well as that of Dok-1GBD or Dok-1DM, significantly diminished the elevated Tyr-418 phosphorylation levels. Furthermore, the Dok-1CSK mutant did not restore the levels of Tyr-529 phosphorylation to those seen with WT MEFs, whereas Dok-1WT, Dok-1GBD, and Dok-1DM did (Fig. 4). The inability of Dok-1CSK to suppress the elevated Src activity levels was not due to levels of Dok-1CSK expression, since all Dok-1 mutant proteins were expressed at similar levels (Fig. 4, right column). Moreover, the Dok-1CSK mutant was still able to diminish the prolonged MAPK activity seen with PDGF-treated Dok-1–/– MEFs (see below). We next examined the ability of the Dok-1CSK mutant to suppress the elevated c-myc mRNA levels in PDGF-stimulated Dok-1–/– MEFs. In contrast to Dok-1WT, the Dok-1CSK mutant failed to suppress the enhanced c-myc mRNA levels in these cells (Fig. 5). These data indicate that the Dok-1/Csk interaction is essential for the inhibitory effect of Dok-1 on PDGF-stimulated Src activation and c-myc induction. Thus, our findings support a model in which Dok-1 recruits Csk to active Src and thereby down-regulates its kinase activity and c-myc induction following PDGF stimulation.
|
|
|
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The transcription factor c-Myc plays a critical role in cell cycle progression in response to growth factors, and numerous studies have documented growth factor-induced accumulation of c-myc mRNA (6, 8). Our data show that Dok-1 acts on Src kinases to suppress the PDGF-triggered induction of c-myc mRNA and its protein product. First, the levels of c-myc mRNA are higher in PDGF-treated Dok-1–/– MEF cells than in WT cells and can be suppressed by the addition of a specific Src inhibitor. Second, the loss of Dok-1 results in elevated Src activation in response to PDGF. Finally, in contrast to the WT protein, a Dok-1 mutant defective in Csk binding and Src kinase inhibition fails to suppress the elevated c-myc mRNA levels seen with PDGF-treated Dok-1–/– cells. Collectively, our results reveal an inhibitory role for Dok-1 in the Src-mediated increase in c-myc mRNA levels.
Several studies suggest that tight regulation of the activity of Src kinases is important for their roles in cell growth (12, 23). A number of signaling molecules have been shown to influence Src activity in response to PDGF (13, 16, 38, 39, 55, 60). A key negative regulator of SFKs is Csk, which selectively phosphorylates a conserved tyrosine residue in their C-terminal tail (Tyr-529 in mouse Src) and thereby suppresses their activities (16). Evidence from our experiments using a Dok-1 mutant selectively deficient in Csk binding (Dok-1CSK) indicates that Dok-1 interferes with PDGF-induced Src activation via its association with Csk. Our data suggest that upon PDGF stimulation Dok-1 recruits Csk to the plasma membrane, where Src kinases predominantly function. Csk is a cytoplasmic tyrosine kinase that lacks membrane-binding sequences. Thus, to modulate the activity of Src kinases, Csk needs to be recruited to the plasma membrane via a membrane-associated protein (34, 42). We previously demonstrated a PH domain-mediated translocation of Dok-1 to the plasma membrane in response to PDGF (61). Here, we show that PDGF stimulation induces Csk binding to Dok-1 and that the recruitment of Csk to the plasma membrane is compromised in PDGF-stimulated Dok-1–/– cells.
Interestingly, in order to suppress Src activation, Dok-1 needs to be tyrosine phosphorylated by Src kinases, suggesting the existence of a negative-feedback signaling loop. Namely, PDGF-induced Src activation triggers the phosphorylation of Dok-1, which in turn recruits Csk to the membrane, thereby decreasing Src activity. This model is supported by a number of findings. Work from Shah and Shokat showed that v-Src directly phosphorylates Dok-1 at tyrosine residue Y449 (for human Dok-1) and that this site is critical for its interaction with Csk (49). We confirmed that mutating the Y449 site abolishes the interaction between Dok-1 and Csk in PDGF-stimulated cells. Moreover, we found that the PDGF-induced tyrosine phosphorylation of Dok-1 depends largely on Src kinases, as treatment of PDGF-stimulated cells with the SFK inhibitor SU6656 significantly reduces the levels of Dok-1 tyrosine phosphorylation (data not shown). These findings, together with our data showing an inhibitory role for Dok-1 in Src activation, support the existence of negative-feedback signaling that modulates Src activity. Our observation that Src also forms a complex with Dok-1 under unstimulated conditions raises the question as to whether Src and Dok-1 are recruited together to the plasma membrane, where Src then becomes further activated and phosphorylates Dok-1 to facilitate Csk recruitment. Additional experiments will be needed to address this issue. Significantly, negative-feedback loops have been described for a number of signaling events, including those initiated by receptor tyrosine kinases and cytokines. They are critical for restraining the intensity and duration of the signal and for improving the fidelity of the cellular response (22, 54).
Our study has also established that Dok-1 uses different effectors to attenuate PDGFR-initiated Src/c-Myc and Ras/MAPK pathways. The observation that the Dok-1CSK mutant is as effective as Dok-1WT in suppressing the prolonged MAPK activity seen with PDGF-treated Dok-1–/– cells demonstrates that Dok-1 does not use Csk to exert its negative effect on Ras/MAPK. This observation appears to be inconsistent with a recent study by Van Slyke et al., which suggested that Dok-2 attenuates epidermal growth factor-induced MAPK activation by inhibiting Src activity (55). However, this conclusion was based largely on the observation that overexpression of a Dok-2 deletion mutant (Dok-2PRR), in contrast to Dok-2WT, failed to attenuate epidermal growth factor-induced Src and MAPK activities in Cos-1 cells. The deletion in the Dok-2PRR mutant removes the entire proline- and tyrosine-rich tail, which harbors binding sites not only for Csk but also for Ras-GAP and Nck (33, 45). Thus, the aforementioned study does not exclude Src-independent mechanisms for the suppression of MAPK activity.
We found that both the Dok-1GBD mutant (which is defective in Ras-GAP binding) and the Dok-1DM mutant (which still binds to Ras-GAP) fail to fully suppress the sustained MAPK activity seen with PDGF-stimulated Dok-1–/– cells, suggesting that Dok-1's association with Ras-GAP and at least one other signaling component (distinct from Nck and Csk) is required for its negative effect on MAPK activation. Our results are consistent with the study of Shinohara et al. and could explain why Ras-GAP-dependent and -independent mechanisms were previously proposed to mediate the negative effect of Dok-1 on the Ras/MAPK pathway (50, 52, 61). Importantly, the Dok-1GBD and Dok-1DM mutants retain the ability to suppress the elevated levels of Src activity seen with Dok-1–/– cells, supporting the idea that Dok-1 utilizes distinct effectors to exert its negative effects on the Ras/MAPK and Src/c-Myc pathways.
It is noteworthy that a recent study has shown that, in addition to the canonical plasma membrane Ras activation pathway, there is a distinct pathway that activates Ras on intracellular membranes of the Golgi complex and the endoplasmic reticulum (ER) in response to growth factors (15). Intriguingly, this pathway involves Src-dependent phosphorylation of phospholipase CI, which in turn causes translocation of RasGRP1 to the Golgi complex and ER, where it activates Ras (2). Ras activation on the Golgi complex and ER has been reported to contribute to sustained p44MAPK activation (60). Our results, however, do not support an inhibitory role for Dok-1 in growth factor-induced Golgi and ER Ras activation, since we found that the levels of MAPK activity in PDGF-treated Dok-1–/– cells expressing Dok-1CSK are comparable to those in WT cells, even though the former cells exhibit elevated levels of Src activity. These observations suggest that Dok-1 modulates select Src-mediated pathways possibly by suppressing Src activities only in specific cellular compartments.
Our findings demonstrate for the first time that both the Src/c-Myc pathway and the Ras/MAPK pathway contribute to Dok-1's negative effect on PDGF-induced mitogenesis. We found that the Dok-1CSK mutant, which is defective in suppressing the Src/c-Myc pathway, fails to fully suppress the enhanced mitogenic response of PDGF-treated Dok-1–/– cells. Moreover, the Dok-1GBD and Dok-1DM mutants, which are impaired in their ability to suppress the MAPK pathway, fail to fully suppress the elevated thymidine incorporation observed with PDGF-treated Dok-1–/– MEFs. At the present time, we cannot exclude the possibility that Dok-1 acts on additional PDGF-triggered signaling pathways to suppress mitogenesis. Among them, the PI3-K pathway would be of particular interest to investigate, given its previously demonstrated contribution to growth factor-induced cell cycle progression.
In conclusion, our studies provide new insights into the molecular mechanisms by which Dok-1 interferes with PDGF-induced mitogenesis in primary cells. It is also likely that Dok-2 and Dok-3 family members act on multiple pathways to exert their negative effect on mitogenesis. A recent study has demonstrated that inactivation of Dok-1 or Dok-2 markedly accelerates leukemia and blastic crisis onset in p210bcr-abl transgenic mice (44). Interestingly, both dominant negative Myc and Ras mutant proteins were found to block transformation induced by p210bcr-abl, indicating that both proteins are important for cellular transformation by p210bcr-abl (47, 48). Furthermore, concomitant loss of Dok-1 and Dok-2 function has been shown to cause aberrant myelopoiesis, and cells from the double knockout mice display an increased proliferation potential in response to growth factors, which exceeds that of individual knockout cells (44, 59). Our data support a possible mechanistic basis for these effects.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant P01 CA64593-10 to L.V.A.
|
FOOTNOTES |
|---|
M.Z. and J.A.J. contributed equally to this work.
Present address: Developmental Genetics, Memorial Sloan Kettering Cancer Center, New York, NY 10021.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bivona, T. G., I. Perez De Castro, I. M. Ahearn, T. M. Grana, V. K. Chiu, P. J. Lockyer, P. J. Cullen, A. Pellicer, A. D. Cox, and M. R. Philips. 2003. Phospholipase Cgamma activates Ras on the Golgi apparatus by means of RasGRP1. Nature 424:694-698.[CrossRef][Medline]
3. Blake, R. A., M. A. Broome, X. Liu, J. Wu, M. Gishizky, L. Sun, and S. A. Courtneidge. 2000. SU6656, a selective Src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell. Biol. 20:9018-9027.
4. Boettner, B., C. Herrmann, and L. Van Aelst. 2001. Ras and Rap1 interaction with AF-6 effector target. Methods Enzymol. 332:151-168.[CrossRef][Medline]
5. Boggon, T. J., and M. J. Eck. 2004. Structure and regulation of Src family kinases. Oncogene 23:7918-7927.[CrossRef][Medline]
6. Bouchard, C., P. Staller, and M. Eilers. 1998. Control of cell proliferation by Myc. Trends Cell Biol. 8:202-206.[CrossRef][Medline]
7. Bowman, T., M. A. Broome, D. Sinibaldi, W. Wharton, W. J. Pledger, J. M. Sedivy, R. Irby, T. Yeatman, S. A. Courtneidge, and R. Jove. 2001. Stat3-mediated Myc expression is required for Src transformation and PDGF-induced mitogenesis. Proc. Natl. Acad. Sci. USA 98:7319-7324.
8. Bromann, P. A., H. Korkaya, and S. A. Courtneidge. 2004. The interplay between Src family kinases and receptor tyrosine kinases. Oncogene 23:7957-7968.[CrossRef][Medline]
9. Bromann, P. A., H. Korkaya, C. P. Webb, J. Miller, T. L. Calvin, and S. A. Courtneidge. 2005. PDGF stimulates Src-dependent mRNA stabilization of specific early genes in fibroblasts. J. Biol. Chem. 280:10253-10263.
10. Brown, M. T., and J. A. Cooper. 1996. Regulation, substrates and functions of src. Biochim. Biophys. Acta 1287:121-149.[Medline]
11. Carpino, N., D. Wisniewski, A. Strife, D. Marshak, R. Kobayashi, B. Stillman, and B. Clarkson. 1997. p62(dok): a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells. Cell 88:197-204.[CrossRef][Medline]
12. Cartwright, C. A., C. A. Coad, and B. M. Egbert. 1994. Elevated c-Src tyrosine kinase activity in premalignant epithelia of ulcerative colitis. J. Clin. Investig. 93:509-515.[Medline]
13. Chang, B. Y., K. B. Conroy, E. M. Machleder, and C. A. Cartwright. 1998. RACK1, a receptor for activated C kinase and a homolog of the ß subunit of G proteins, inhibits activity of Src tyrosine kinases and growth of NIH 3T3 cells. Mol. Cell. Biol. 18:3245-3256.
14. Chiariello, M., M. J. Marinissen, and J. S. Gutkind. 2001. Regulation of c-myc expression by PDGF through Rho GTPases. Nat. Cell Biol. 3:580-586.[CrossRef][Medline]
15. Chiu, V. K., T. Bivona, A. Hach, J. B. Sajous, J. Silletti, H. Wiener, R. L. Johnson II, A. D. Cox, and M. R. Philips. 2002. Ras signalling on the endoplasmic reticulum and the Golgi. Nat. Cell Biol. 4:343-350.[Medline]
16. Cole, P. A., K. Shen, Y. Qiao, and D. Wang. 2003. Protein tyrosine kinases Src and Csk: a tail's tale. Curr. Opin. Chem. Biol. 7:580-585.[CrossRef][Medline]
17. Cong, F., B. Yuan, and S. P. Goff. 1999. Characterization of a novel member of the DOK family that binds and modulates Abl signaling. Mol. Cell. Biol. 19:8314-8325.
18. Cooper, J. A., and B. Howell. 1993. The when and how of Src regulation. Cell 73:1051-1054.[Medline]
19. Crowder, R. J., H. Enomoto, M. Yang, E. M. Johnson, Jr., and J. Milbrandt. 2004. Dok-6, a Novel p62 Dok family member, promotes Ret-mediated neurite outgrowth. J. Biol. Chem. 279:42072-42081.
20. Di Cristofano, A., N. Carpino, N. Dunant, G. Friedland, R. Kobayashi, A. Strife, D. Wisniewski, B. Clarkson, P. P. Pandolfi, and M. D. Resh. 1998. Molecular cloning and characterization of p56dok-2 defines a new family of RasGAP-binding proteins. J. Biol. Chem. 273:4827-4830.
21. Di Cristofano, A., M. Niki, M. Zhao, F. G. Karnell, B. Clarkson, W. S. Pear, L. Van Aelst, and P. P. Pandolfi. 2001. p62(dok), a negative regulator of Ras and mitogen-activated protein kinase (MAPK) activity, opposes leukemogenesis by p210(bcr-abl). J. Exp. Med. 194:275-284.
22. Fiorini, M., M. Alimandi, L. Fiorentino, G. Sala, and O. Segatto. 2001. Negative regulation of receptor tyrosine kinase signals. FEBS Lett. 490:132-141.[CrossRef][Medline]
23. Frame, M. C. 2002. Src in cancer: deregulation and consequences for cell behaviour. Biochim. Biophys. Acta 1602:114-130.[Medline]
24. Furstoss, O., K. Dorey, V. Simon, D. Barila, and S. Roche. 2002. c-Abl is an effector of Src for growth factor-induced c-myc expression and DNA synthesis. EMBO J. 21:514-524.[CrossRef][Medline]
25. Gerard, A., C. Favre, F. Garcon, J. G. Nemorin, P. Duplay, S. Pastor, Y. Collette, D. Olive, and J. A. Nunes. 2004. Functional interaction of RasGAP-binding proteins Dok-1 and Dok-2 with the Tec protein tyrosine kinase. Oncogene 23:1594-1598.[CrossRef][Medline]
26. Grimm, J., M. Sachs, S. Britsch, S. Di Cesare, T. Schwarz-Romond, K. Alitalo, and W. Birchmeier. 2001. Novel p62dok family members, dok-4 and dok-5, are substrates of the c-Ret receptor tyrosine kinase and mediate neuronal differentiation. J. Cell Biol. 154:345-354.
27. Gugasyan, R., C. Quilici, S. T. T. I, D. Grail, A. M. Verhagen, A. Roberts, T. Kitamura, A. R. Dunn, and P. Lock. 2002. Dok-related protein negatively regulates T cell development via its RasGTPase-activating protein and Nck docking sites. J. Cell Biol. 158:115-125.
28. Hu, P., S. Wu, Y. Sun, C. C. Yuan, R. Kobayashi, M. P. Myers, and N. Hernandez. 2002. Characterization of human RNA polymerase III identifies orthologues for Saccharomyces cerevisiae RNA polymerase III subunits. Mol. Cell. Biol. 22:8044-8055.
29. Imamoto, A., and P. Soriano. 1993. Disruption of the csk gene, encoding a negative regulator of Src family tyrosine kinases, leads to neural tube defects and embryonic lethality in mice. Cell 73:1117-1124.[CrossRef][Medline]
30. Jones, N., and D. J. Dumont. 1999. Recruitment of Dok-R to the EGF receptor through its PTB domain is required for attenuation of Erk MAP kinase activation. Curr. Biol. 9:1057-1060.[CrossRef][Medline]
31. Jones, N., and D. J. Dumont. 1998. The Tek/Tie2 receptor signals through a novel Dok-related docking protein, Dok-R. Oncogene 17:1097-1108.[CrossRef][Medline]
32. Jones, S. M., and A. Kazlauskas. 2001. Growth-factor-dependent mitogenesis requires two distinct phases of signalling. Nat. Cell Biol. 3:165-172.[CrossRef][Medline]
33. Kashige, N., N. Carpino, and R. Kobayashi. 2000. Tyrosine phosphorylation of p62dok by p210bcr-abl inhibits RasGAP activity. Proc. Natl. Acad. Sci. USA 97:2093-2098.
34. Kawabuchi, M., Y. Satomi, T. Takao, Y. Shimonishi, S. Nada, K. Nagai, A. Tarakhovsky, and M. Okada. 2000. Transmembrane phosphoprotein Cbp regulates the activities of Src-family tyrosine kinases. Nature 404:999-1003.[CrossRef][Medline]
35. Lemay, S., D. Davidson, S. Latour, and A. Veillette. 2000. Dok-3, a novel adapter molecule involved in the negative regulation of immunoreceptor signaling. Mol. Cell. Biol. 20:2743-2754.
36. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2–Ct method. Methods 25:402-408.[CrossRef][Medline]
37. Lock, P., F. Casagranda, and A. R. Dunn. 1999. Independent SH2-binding sites mediate interaction of Dok-related protein with RasGTPase-activating protein and Nck. J. Biol. Chem. 274:22775-22784.
38. Mamidipudi, V., J. Zhang, K. C. Lee, and C. A. Cartwright. 2004. RACK1 regulates G1/S progression by suppressing Src kinase activity. Mol. Cell. Biol. 24:6788-6798.
39. Manes, G., P. Bello, and S. Roche. 2000. Slap negatively regulates Src mitogenic function but does not revert Src-induced cell morphology changes. Mol. Cell. Biol. 20:3396-3406.
40. Master, Z., N. Jones, J. Tran, J. Jones, R. S. Kerbel, and D. J. Dumont. 2001. Dok-R plays a pivotal role in angiopoietin-1-dependent cell migration through recruitment and activation of Pak. EMBO J. 20:5919-5928.[CrossRef][Medline]
41. Nada, S., T. Yagi, H. Takeda, T. Tokunaga, H. Nakagawa, Y. Ikawa, M. Okada, and S. Aizawa. 1993. Constitutive activation of Src family kinases in mouse embryos that lack Csk. Cell 73:1125-1135.[CrossRef][Medline]
42. Neet, K., and T. Hunter. 1995. The nonreceptor protein-tyrosine kinase CSK complexes directly with the GTPase-activating protein-associated p62 protein in cells expressing v-Src or activated c-Src. Mol. Cell. Biol. 15:4908-4920.[Abstract]
43. Nelms, K., A. L. Snow, J. Hu-Li, and W. E. Paul. 1998. FRIP, a hematopoietic cell-specific rasGAP-interacting protein phosphorylated in response to cytokine stimulation. Immunity 9:13-24.[CrossRef][Medline]
44. Niki, M., A. Di Cristofano, M. Zhao, H. Honda, H. Hirai, L. Van Aelst, C. Cordon-Cardo, and P. P. Pandolfi. 2004. Role of Dok-1 and Dok-2 in leukemia suppression. J. Exp. Med. 200:1689-1695.
45. Noguchi, T., T. Matozaki, K. Inagaki, M. Tsuda, K. Fukunaga, Y. Kitamura, T. Kitamura, K. Shii, Y. Yamanashi, and M. Kasuga. 1999. Tyrosine phosphorylation of p62(Dok) induced by cell adhesion and insulin: possible role in cell migration. EMBO J. 18:1748-1760.[CrossRef][Medline]
46. Oki, S., A. Limnander, P. M. Yao, M. Niki, P. P. Pandolfi, and P. B. Rothman. 2005. Dok1 and SHIP act as negative regulators of v-Abl-induced pre-B cell transformation, proliferation and Ras/Erk activation. Cell Cycle 4:310-314.[Medline]
47. Sawyers, C. L., W. Callahan, and O. N. Witte. 1992. Dominant negative MYC blocks transformation by ABL oncogenes. Cell 70:901-910.[CrossRef][Medline]
48. Sawyers, C. L., J. McLaughlin, and O. N. Witte. 1995. Genetic requirement for Ras in the transformation of fibroblasts and hematopoietic cells by the Bcr-Abl oncogene. J. Exp. Med. 181:307-313.
49. Shah, K., and K. M. Shokat. 2002. A chemical genetic screen for direct v-Src substrates reveals ordered assembly of a retrograde signaling pathway. Chem. Biol. 9:35-47.[CrossRef][Medline]
50. Shinohara, H., T. Yasuda, and Y. Yamanashi. 2004. Dok-1 tyrosine residues at 336 and 340 are essential for the negative regulation of Ras-Erk signalling, but dispensable for rasGAP-binding. Genes Cells 9:601-607.
51. Sicheri, F., and J. Kuriyan. 1997. Structures of Src-family tyrosine kinases. Curr. Opin. Struct. Biol. 7:777-785.[CrossRef][Medline]
52. Songyang, Z., Y. Yamanashi, D. Liu, and D. Baltimore. 2001. Domain-dependent function of the rasGAP-binding protein p62Dok in cell signaling. J. Biol. Chem. 276:2459-2465.
53. Suzu, S., M. Tanaka-Douzono, K. Nomaguchi, M. Yamada, H. Hayasawa, F. Kimura, and K. Motoyoshi. 2000. p56(dok-2) as a cytokine-inducible inhibitor of cell proliferation and signal transduction. EMBO J. 19:5114-5122.[CrossRef][Medline]
54. Tan, J. C., and R. Rabkin. 2005. Suppressors of cytokine signaling in health and disease. Pediatr. Nephrol. 20:567-575.[CrossRef][Medline]
55. Van Slyke, P., M. L. Coll, Z. Master, H. Kim, J. Filmus, and D. J. Dumont. 2005. Dok-R mediates attenuation of epidermal growth factor-dependent mitogen-activated protein kinase and Akt activation through processive recruitment of c-Src and Csk. Mol. Cell. Biol. 25:3831-3841.
56. Woodring, P. J., J. Meisenhelder, S. A. Johnson, G. L. Zhou, J. Field, K. Shah, F. Bladt, T. Pawson, M. Niki, P. P. Pandolfi, J. Y. Wang, and T. Hunter. 2004. c-Abl phosphorylates Dok1 to promote filopodia during cell spreading. J. Cell Biol. 165:493-503.
57. Yamanashi, Y., and D. Baltimore. 1997. Identification of the Abl- and rasGAP-associated 62 kDa protein as a docking protein, Dok. Cell 88:205-211.[CrossRef][Medline]
58. Yamanashi, Y., T. Tamura, T. Kanamori, H. Yamane, H. Nariuchi, T. Yamamoto, and D. Baltimore. 2000. Role of the rasGAP-associated docking protein p62(dok) in negative regulation of B cell receptor-mediated signaling. Genes Dev. 14:11-16.
59. Yasuda, T., M. Shirakata, A. Iwama, A. Ishii, Y. Ebihara, M. Osawa, K. Honda, H. Shinohara, K. Sudo, K. Tsuji, H. Nakauchi, Y. Iwakura, H. Hirai, H. Oda, T. Yamamoto, and Y. Yamanashi. 2004. Role of Dok-1 and Dok-2 in myeloid homeostasis and suppression of leukemia. J. Exp. Med. 200:1681-1687.
60. Zhang, S. Q., W. Yang, M. I. Kontaridis, T. G. Bivona, G. Wen, T. Araki, J. Luo, J. A. Thompson, B. L. Schraven, M. R. Philips, and B. G. Neel. 2004. Shp2 regulates SRC family kinase activity and Ras/Erk activation by controlling Csk recruitment. Mol. Cell 13:341-355.[CrossRef][Medline]
61. Zhao, M., A. A. Schmitz, Y. Qin, A. Di Cristofano, P. P. Pandolfi, and L. Van Aelst. 2001. Phosphoinositide 3-kinase-dependent membrane recruitment of p62(dok) is essential for its negative effect on mitogen-activated protein (MAP) kinase activation. J. Exp. Med. 194:265-274.
This article has been cited by other articles:
| ||||||||
-c-Myc) Ab, and anti-U2AF65 Ab was used as a loading control. The numbers below the panels represent changes (n-fold) in signal intensities of c-Myc normalized to those of U2AF65 and then normalized to the value of 1.0 for untreated WT MEFs. Data shown are representative of three experiments. WB, Western blot. (D) Serum-starved Dok-1–/– MEFs stably transduced with control vector or Dok-1WT were treated with PDGF (12.5 ng/ml). At indicated time points, total RNA was isolated and levels of c-myc mRNA were measured by Q-PCR. The induction (n-fold) of c-myc mRNA in response to PDGF was calculated as described above.
