Evidence Suggesting that Pif1 Helicase Functions in DNA Replication with the Dna2 Helicase/Nuclease and DNA Polymerase {delta}

The precise machineries required for two aspects of eukaryoticDNA replication, Okazaki fragment processing (OFP) and telomeremaintenance, are poorly understood. In this work, we presentevidence that Saccharomyces cerevisiae Pif1 helicase plays awider role in DNA replication than previously appreciated andthat it likely functions in conjunction with Dna2 helicase/nucleaseas a component of the OFP machinery. In addition, we show thatDna2, which is known to associate with telomeres in a cell-cycle-specificmanner, may be a new component of the telomere replication apparatus.Specifically, we show that deletion of PIF1 suppresses the lethalityof a DNA2-null mutant. The pif1 ${Delta}$ dna2 ${Delta}$ strain remains methylmethanesulfonate sensitive and temperature sensitive; however, thesephenotypes can be suppressed by further deletion of a subunitof pol ${delta}$ , POL32. Deletion of PIF1 also suppresses the cold-sensitivelethality and hydroxyurea sensitivity of the pol32 ${Delta}$ strain. Dna2is thought to function by cleaving long flaps that arise duringOFP due to excessive strand displacement by pol ${delta}$ and/or by anas yet unidentified helicase. Thus, suppression of dna2 ${Delta}$ canbe rationalized if deletion of POL32 and/or PIF1 results ina reduction in long flaps that require Dna2 for processing.We further show that deletion of DNA2 suppresses the long-telomerephenotype and the high rate of formation of gross chromosomalrearrangements in pif1 ${Delta}$ mutants, suggesting a role for Dna2 intelomere elongation in the absence of Pif1.

INTRODUCTION

Top

Introduction

Yeast Pif1 is the founding member of the Pif1 subfamily of superfamily1 DNA helicases (3). While other organisms, such as Caenorhabditiselegans and Homo sapiens, have only one identified Pif1 familymember, in yeast, there is a second, closely related, protein,Rrm3p (3). In yeast, neither of these helicases is essentialand mutants lacking both are viable and repair proficient. Bothyeast proteins have 5'-to-3' DNA helicase activity (21, 30,31). The region of similarity between Pif1 and Rrm3 is limitedto the seven helicase motifs, which exhibit 40% identity and60% similarity (3). This may indicate that the two helicaseshave structurally similar DNA substrates. Nevertheless, thetwo helicases differ in their biological functions, and thesedifferences are likely mediated not only by the helicase domainbut also by the divergent N termini, which are not requiredfor helicase activity (4). To date, it has been impossible todetermine which helicase, Rrm3 or Pif1, is the functional homologof the single ortholog in other eukaryotes.

One difference between Rrm3 and Pif1 is in their function atthe rRNA gene. In rrm3 mutants, there is an increase in replisomepausing at the Fob1 protein-bound replication fork barrier (RFB)in the rRNA gene (22). The hypothesis is that Rrm3 is requiredto remove proteins that block the fork at that point, sinceRrm3 is required for promoting fork movement at over 1,400 lociin the yeast genome, in addition to the RFB. In contrast toRrm3, Pif1 seems to be required for pausing at the rRNA geneRFB, since pif1 ${Delta}$ mutants show a threefold-reduced number of forksaccumulating at the RFB. Pif1 could itself be an inhibitor offork movement, or it could be required for Fob1p to exert itsblocking action (22, 50).

Pif1 and Rrm3 also appear to have different roles at telomeres.Two-dimensional gel analysis of telomere replication in rrm3 ${Delta}$ mutants suggests that Rrm3 is required for replication throughY' elements and telomeric repeats, and similar experiments inrrm3 ${Delta}$ rap1 strains further suggest that Rrm3 specifically removesRap1 protein, or proteins that associate with telomeres in theabsence of Rap1, to allow progression of the telomere-proximalreplication fork (21, 35). Pif1, on the other hand, is thoughtto be an inhibitor of telomerase, since pif1 ${Delta}$ mutants have longtelomeres, 160 to 240 bp longer than normal telomeres, becauseoverproduction of Pif1 shortens telomeres and since Pif1 decreasesthe processivity of telomerase in vitro (5). pif1 ${Delta}$ mutants alsoshow a 200-fold increase in the de novo addition of telomeresat HO-endonuclease-induced double-strand breaks (DSBs) and ahigh level of gross chromosomal rearrangements (GCRs) in whichthere is excessive telomere addition to nontelomeric sequencesat sites of intrachromosomal DNA damage, presumably primarilyDSBs (36, 42, 50). By analogy with Rrm3, it has been proposedthat Pif1 might remove a protein such as telomerase from thechromosome ends. pif1 ${Delta}$ mutants also have decreased silencingin the subtelomeric repeats.

A third possible difference between Pif1 and Rrm3 is that Pif1,but not Rrm3, is required for mitochondrial DNA recombinationand genome maintenance (30, 31, 42). The pif1 ${Delta}$ mutant grows slowlyon nonfermentable carbon sources and loses functional mitochondriarapidly (42). RRM3 does contain a mitochondrial import signal;however, it has not yet been shown to function in mitochondria(1, 3, 18, 23).

In this work, we report an additional difference between Pif1and Rrm3. The rrm3 ${Delta}$ mutant is synthetically lethal with a mutationin the Dna2 helicase/nuclease, required for Okazaki fragmentprocessing (OFP), telomere stability, and DNA repair (6-10,14, 17, 47, 48). In contrast, we show here that pif1 ${Delta}$ suppressesboth the DNA replication and repair defects of dna2 mutantsand even the lethality of deletion of DNA2. The dna2 ${Delta}$ pif1 ${Delta}$ mutantretains some defects in replication and repair, but these arefurther suppressed by deletion of the POL32 subunit of polymerase ${delta}$ (pol ${delta}$ ). Conversely, deletion of DNA2 suppresses the telomerephenotype of pif1 ${Delta}$ mutants. We describe and characterize heregenetic interactions between PIF1, DNA2, and POL32 that presentnew insights into the functions of each gene in OFP, telomerefunction, and chromatin modification and into the evolutionarilyconserved functions of Pif1 helicase.

MATERIALS AND METHODS

Top

Materials and Methods

Strains. The strains used in this study were derived either from BY4741,in which the yeast deletion collection is housed (Invitrogen,Carlsbad, Calif.), or from W303 RAD5⁺. Individual experimentscompared only isogenic strains in either background. The fullstrain list is shown in Table 1. Standard genetic techniqueswere used for tetrad analysis. Gene disruptions were carriedout by standard PCR-based methods and verified by PCR. Sequencesof primers not shown below are available on request.

View this table:
[in this window]
[in a new window]
TABLE 1. Strains used in this study

Oligonucleotides. The following oligonucleotides were used for gene disruptionby standard genetic techniques (34): dna2N ${Delta}$ (CAAGTGAGTACTCATTTTGTGCAAGCAAACACTGACAATTGAAGAGATCGTCAGGCGGATCCCCGGGTTAATTAA),dna2C ${Delta}$ (TATTTTATGCTGTGATAGCTTTCCTGTTATGGAGAAGCTCTTCTTATTCCCCCTGGAATTCGAGCTCGTTTAAAC),dna2Nseq (CAATAAAGCAATTCCGTGCGGCAGA), pif1N ${Delta}$ (ATTTTGATATATTATCCATTGAGCGATTAGCTTACTTGTATCAATCAATTTTACCGGATCCCCGGGTTAATTAA),pif1C ${Delta}$ (GATTATTATAGCAGTTTGTATTCTATATAACTATGTGTATTAATATGTTACGAATTCGAGCTCGTTTAAAC),pTEF kan (CTCGCAGGTCTGCAGCGAGGAGCCG), pif1-95 (GGCCAGACATTGAAACTGG),and dna2-seq (CAATAATGCAATTCCGTGCGGCAGA).

Verification of deletions of PIF1 or DNA2. We verified our earlier results and those of others that DNA2is essential (6, 8, 17, 43). For the studies reported here,a heterozygous dna2 ${Delta}$ strain was obtained from Research Geneticsas clone 22858, and dissection after sporulation shows thatin the strain, DNA2 is essential. Complementation with a plasmidcontaining a functional DNA2 gene rescues the deletion, andtransformation with constructs containing nonfunctional dna2genes, dna2K1080E, dna2E675A, dna2E657A, and dna2E693A, doesnot rescue the deletion (10; unpublished data). Therefore, thedna2 ${Delta}$ pif1 ${Delta}$ mutant derived from a haploid segregant of clone 22858is unlikely to contain any aberrant mutations, rearrangements,or unknown suppressors which are linked to DNA2. The DNA2 geneis also essential in Schizosaccharomyces pombe (26). All constructscontaining deletions of these genes were checked in multipleways. For physical analysis of strains used in Fig. 1B, colonyPCR was used, permitting application to large numbers of transformantsin a single experiment. The oligonucleotides used in PCR areavailable on request. The pif1 ${Delta}$ strain was confirmed using oligonucleotidespTEF kan and pif1-95. The resulting PCR product was 350 bp.The dna2 ${Delta}$ strains were confirmed using the oligonucleotides pTEFkan and dna2-seq. The resulting PCR product was 450 bp. Allstrains used in the subsequent experiments presented were confirmedin this way.

View larger version (58K):
[in this window]
[in a new window]
FIG. 1. Suppression of dna2 mutant phenotypes by deletion of PIF1. (A) Serial dilutions of identical numbers of cells were carried out at the temperatures indicated. The following strains were used: W303, WT; MB90-7A, dna2-1; MB91, dna2-1 pif1 ${Delta}$ . (B) Serial dilutions of identical numbers of each strain were plated on medium containing the indicated amounts of MMS. Relevant genotypes are indicated. The following strains were used: BY4741, WT; 10509, pif1 ${Delta}$ ; 4741dna2-2, dna2-2; MB208, dna2-2 pif1 ${Delta}$ ; and MB203, dna2 ${Delta}$ pif1 ${Delta}$ (Table 1).

For verification of strains used in generating and in analyzingthe genotype of strain MB504 (the double heterozygote used inthe Results section to test lethality of dna2 ${Delta}$ and its suppressionby deletion of PIF1), colony PCR was used; the primers are availableon request.

Five strains were obtained from Richard Kolodner: 3615 (PIF1),4393 (pifm1), 4344 (pifm2), 5030 (pif1m2), and 4400 (pif1 ${Delta}$ ).The PCR product used to delete the DNA2 gene contained the HIS3gene flanked by 55 bp of DNA homologous to DNA2 on the N- andC-terminal regions. The His⁺ transformants were picked and testedfor temperature sensitivity, growth on glycerol, and methylmethanesulfonate (MMS) sensitivity. The temperature-sensitive (recessive,ts; dominant, TS) transformants were further tested by eithercolony PCR for the dna2 ${Delta}$ ::HIS3 deletion or complementation usinga dna2 strain. Strain 4400 (pif1 ${Delta}$ ) had 26 transformants: 7 tsand 19 TS⁺. All ts transformants were dna2 ${Delta}$ . 4344 (pif1m2) had31 transformants: 20 ts and 11 TS⁺. All ts transformants weredna2 ${Delta}$ . 5030 (pif1m2) had 32 transformants: 24 ts and 8 TS⁺. Allts transformants were dna2 ${Delta}$ . 4393 (pif1m1) had 32 transformants:0 ts and 32 TS⁺. 3615 had 12 transformants: 0 ts and 12 TS⁺.None of these were dna2 ${Delta}$ . The PCR product is quite efficientin deleting the Dna2 gene in the pif1 ${Delta}$ or pif1m2 background,but not the PIF1⁺ or pif1m1 background. dna2 ${Delta}$ pif1-m2 transformantswere also checked by complementation. The dna2 ${Delta}$ ::G418 pif1-m2strain was mated to a dna2-1 LEU2 strain, and G418^R Leu⁺ diploidswere selected. A dna2-1/dna2 ${Delta}$ PIF1/pif1-m2 strain fails to growat 37°C, while a dna2-1/DNA2 PIF1/pif1-m2 diploid does growat 37°C.

Additional phenotypic analysis of mutant constructs is describedin the text where appropriate.

Determination of telomere length. Chromosomal DNA was cleaved with XhoI, loaded onto a 1% agarosegel, and electrophoresed for 6 h at 60 V. The gel was blottedonto Gene Screen Plus and hybridized using a 300-bp double-strandedGT probe as described previously (14). Since telomere lengthis clonal, three independent isolates were analyzed for eachstrain. The hybridization "smear" at about 1.3 kb representsthe terminal fragment of Y' telomeres cut by XhoI and is indicativeof telomere length in each strain.

RESULTS

Top

Results

Suppression of dna2-1 by pif1 ${Delta}$ . We have reported that dna2-2 is synthetically lethal with rrm3 ${Delta}$ (47). RRM3 is highly homologous to PIF1, and they affect tosome extent similar regions of the genome. To further understandthe rrm3 ${Delta}$ dna2-2 synthetic lethality, we wished to examine dna2-2pif1 ${Delta}$ double mutant strains. dna2-2 mutants (R1235Q) have a mutationin the helicase domain and are expected to have a substantialdefect only in the helicase activity, although the dna2-2 proteinhas never been directly studied (17). When we constructed adna2-2 pif ${Delta}$ double mutant, instead of the expected syntheticlethality, we found that dna2-2 pif1 ${Delta}$ double mutants were viable.dna2-2 cells are viable but grow slowly, and when grown on platesmost of the cells are budded, often with large buds, consistentwith a previously established G₂/M delay (17; unpublished observations).We noticed that dna2-2 pif1 ${Delta}$ had the same morphology as wild-type(WT) cells, small and unbudded (not shown), suggesting thatpif1 ${Delta}$ might suppress the dna2-2 G₂/M delay.

To further test the proposed suppression, we investigated theeffect of deletion of PIF1 on a dna2 mutant with a more definedphenotype, the dna2-1 strain. dna2-1 is a temperature-sensitiveallele (P504S) that maps in the nuclease domain of DNA2 anddrastically reduces the nuclease activity of the Dna2 protein(10). Given that pif1 ${Delta}$ reduces pausing at the rRNA gene RFB,we expected pif1 ${Delta}$ mutants might show some suppression of dna2-1,since fob1 ${Delta}$ , which also decreases pausing at the RFB, suppressesthe DNA damage sensitivity in dna2 mutants (47, 48). The PIF1gene was deleted by PCR-mediated mutagenesis in a W303 dna2-1strain, which was confirmed as described in Materials and Methods.As expected, deletion of PIF1 suppressed the growth defect ofdna2-1 strains at 23°C and the lethality of dna2-1 strainsat 34°C (Fig. 1A). Unexpectedly, the dna2-1 pif1 ${Delta}$ strainwas even viable at 37°C, although the wild-type growth ratewas not completely restored at 37°C (Fig. 1A). (The dna2-1strain grows slowly even at 23°C, and plates at 23°Cwere photographed before they were fully grown so that the otherstrains would not be overgrown, accounting for the appearanceof Fig. 1A. Further incubation verified that the dna2-1 cellswere fully viable [data not shown]).

Since dna2-2 cells are sensitive to MMS and bleomycin (14, 17,19), we next tested the ability of pif1 ${Delta}$ to suppress the repairdefect. The pif1 ${Delta}$ efficiently suppressed the MMS sensitivityof dna2-2 (Fig. 1B).

In sum, the phenotypes of the dna2-1 pif1 ${Delta}$ and dna2-2 pif1 ${Delta}$ showthat deletion of PIF1 can suppress DNA replication and repairdefects due to lesions in either the nuclease or the helicasedomain of DNA2.

Deletion of PIF1 suppresses the lethality of a dna2 ${Delta}$ strain. The suppression of temperature-sensitive growth of dna2-1 andof the DNA damage sensitivity of dna2-2 by deletion of PIF1suggested that pif1 ${Delta}$ might suppress the inviability of a deletionof DNA2. PIF1 was disrupted in a dna2 ${Delta}$ strain containing a DNA2-complementingplasmid, pSEY18GALDna2 (7). Potential dna2 ${Delta}$ pif1 ${Delta}$ /pDNA2 doublemutants were screened by testing for inability to grow on glycerol,since pif1 ${Delta}$ strains form petites at a high frequency. Deletionof PIF1 was then confirmed by PCR and by complementation asdescribed in Materials and Methods. dna2 ${Delta}$ PIF1/pDNA2 and dna2 ${Delta}$ pif1 ${Delta}$ /pDNA2 strains were then streaked on 5-fluoroorotic acid(5-FOA) plates to evict the Dna2-complementing plasmid, whichcarries URA3. The dna2 ${Delta}$ pif1 ${Delta}$ strain grew on the 5-FOA plates,whereas dna2 ${Delta}$ PIF1 transformants did not. Serial dilutions ofdna2 ${Delta}$ pif1 ${Delta}$ cells growing at 30°C are shown in Fig. 1B. Analysisof the dna2 ${Delta}$ strain in numerous crosses and tetrad dissections,as well as passage of the dna2 ${Delta}$ pif1 ${Delta}$ strain through genetic crossesdescribed in the following experiments have never revealed anindependently segregating suppressor. Therefore, deletion ofPIF1 suppresses the inviability of a deletion of DNA2.

Since suppression of a deletion of DNA2 was unexpected, we usedan alternative approach to confirm our results. A PIF1/pif1 ${Delta}$ heterozygote was transformed with a kanMX PCR product designedto disrupt the dna2 gene (the kanMX gene flanked by 55 bp Nterminal to the ATG and 55 bp C terminal to the stop codon ofthe DNA2 gene) (34). DNA2/dna2 ${Delta}$ ::kanMX heterozygotes were detectedby PCR. The double heterozygote, ++/pif1 ${Delta}$ dna2 ${Delta}$ (MB504), was sporulated,and 36 tetrads were dissected. Thirty of the 94 viable sporesrecovered were pif1 ${Delta}$ dna2 ${Delta}$ , and none were dna2 ${Delta}$ . This is the expectednumber of spores if DNA2 is essential and if pif1 ${Delta}$ suppressesthe lethality of dna2 ${Delta}$ .

To test the efficiency of suppression, the doubling time ofthe dna2 ${Delta}$ pif1 ${Delta}$ double mutant was compared to that of a wild-typeyeast. The doubling time at 30°C was 2.5 h, compared to2 h for pif1 ${Delta}$ , suggesting that suppression was not due to completebypass of the need for Dna2 (not shown). We also analyzed theability of the dna2 ${Delta}$ pif1 ${Delta}$ mutant to grow at 37°C. The doublemutant failed to form colonies at 37°C (data not shown here,but see Fig. 4 below), and cells arrested with dumbbell morphologycharacteristic of an S phase or G₂/M checkpoint (not shown).Therefore, deletion of PIF1 suppresses the essential functionof DNA2 at 30°C but not at 37°C. We conclude that thereis not complete bypass of Dna2 function, but suppression isnevertheless very strong.

View larger version (26K):
[in this window]
[in a new window]
FIG. 4. Suppression of the temperature sensitivity of the dna2 ${Delta}$ pif1 ${Delta}$ strain by pol32 ${Delta}$ . The following strains were incubated on a YPD plate at 37°C for 3 days: MB202, pif1 ${Delta}$ ; MB203.6, dna2 ${Delta}$ pif1 ${Delta}$ ; MB206, pif1 ${Delta}$ pol32 ${Delta}$ ; and MB207, dna2 ${Delta}$ pif1 ${Delta}$ pol32 ${Delta}$ .

Disruption of the nuclear, but not the mitochondrial function of PIF1 suppresses dna2 ${Delta}$ . We wished to know whether it was disruption of the nuclear functionand/or of the mitochondrial function of PIF1 that allowed cellsto grow in the absence of DNA2. Two alleles of pif1, pif1-m1,and pif1-m2, separate the nuclear and mitochondrial functionof PIF1 (50). pif1-m1 has a mutation in the first ATG, so theprotein is missing the mitochondrial import function and thestrain is petite. pif1-m1 appears to have its nuclear functionintact, however, as evidenced by wild-type-length telomeres.pif1-m2 has a mutation in the second ATG. The pif1-m2 strainhas its mitochondrial function intact but is deficient in itsnuclear functions, leading to long telomeres. pif1-m2 mutantsalso show increases in the rate of gross chromosomal rearrangements(GCRs) involving de novo telomere addition (36). DNA2 was deletedfrom a set of isogenic strains containing mutations in pif1:3615 (WT), 4400 (pif1 ${Delta}$ ), 4393 (pif1-m1), 4344 (pif1-m2), and5030 (pif1-m2) (36) by transforming each strain with a PCR productcontaining the HIS3 gene and 55 bp N terminal to the ATG and55 bp C terminal to the stop codon of the DNA2 gene. The PCRproduct is expected to delete the DNA2 gene in strains thatdo not require Dna2 for viability. No viable dna2 ${Delta}$ pif1-m1 ordna2 ${Delta}$ PIF1 transformants were recovered. Thus, disruption ofthe mitochondrial function of Pif1 does not suppress dna2 ${Delta}$ lethality.Conversely, dna2 ${Delta}$ pif1 ${Delta}$ and dna2 ${Delta}$ pif1-m2 transformants, lackingthe nuclear function of Pif1, were obtained and grew well, suggestingthat it is the nuclear function of PIF1 that creates a requirementfor DNA2 (Fig. 2A).

View larger version (41K):
[in this window]
[in a new window]
FIG. 2. Suppression of dna2 ${Delta}$ lethality by inactivation of Pif1 nuclear function but not by inactivation of Pif1 mitochondrial function. The following strains were used: 4344, pif1-m2; and 4344dna2 ${Delta}$ , pif1-m2 dna2 ${Delta}$ . (A and B) Growth on glucose-containing medium. (C) Growth on nonfermentable glycerol medium.

In order to evaluate the fitness of the dna2 ${Delta}$ pif1-m2 mutant,its survival was tested at 37°C. As shown, the mutant wastemperature sensitive, similar to the dna2 ${Delta}$ pif1 ${Delta}$ strain (Fig.2B). The mutant was also replica plated to media containing0.005% MMS, and the strain is also sensitive to MMS at 30°C(not shown). Thus, there is not total bypass of the requirementfor Dna2 in the pif1-m2 mutant in DNA replication or in repair.

Both the dna2 ${Delta}$ pif1-m2 and the dna2 ${Delta}$ pif1 ${Delta}$ mutants grew more slowlythan the pif1-m2 mutant at 30°C. In studying the slow growth,50 to 100 of the dna2 ${Delta}$ pif-m2 transformants were replica platedto glycerol medium to determine if Dna2 deficiency led to productionof petites. In fact, although the pif1-m2 mutant grows normallyon glycerol, the dna2 ${Delta}$ pif1-m2 double mutants failed to growon glycerol (Fig. 2C). This result may uncover a previouslyundiscovered role for Dna2 in mitochondrial maintenance, althoughfurther work is required to demonstrate that this is a directeffect. When a dna2 ${Delta}$ pif1-m2 petite mutant was crossed with DNA2PIF1 grande, the diploids were all grande, suggesting that thedna2 ${Delta}$ pif1-m2 mutant carried either defective (but not suppressive)mitochondrial genomes or lacked mitochondrial DNA entirely.

Failure of Rad53 checkpoint kinase activation in the dna2-1 pif1 ${Delta}$ double mutant. To investigate the extent to which pif1 ${Delta}$ removed the requirementfor Dna2 in the cell, we indirectly measured in vivo DNA damagein dna2 mutants in the presence and absence of Pif1 by determiningthe level of Rad53 phosphorylation. Rad53 is a protein kinasethat is phosphorylated and activated in response to DNA damageand replication stress. In both dna2-2 and in dna2-1 mutantsat permissive and nonpermissive temperatures, Rad53 is indeedphosphorylated (Fig. 3A and B), consistent with dna2 mutantssuffering endogenous DNA damage. The phosphorylation, and impliedDNA damage, seen at 23°C in the dna2-1 mutant was not surprisingsince dna2-1 mutants are sick even at this temperature. We havepreviously shown that the upstream master checkpoint kinaseMec1 is not essential for viability of dna2-1 cells at the permissivetemperature, and that dna2-2 mec1 ${Delta}$ sml1-1 mutants grow more rapidlythan dna2-2 mutants (11). (Note that the sml1-1 strain is includedin the strains because it is required for mec1 ${Delta}$ viability.) Wewere therefore interested in whether MEC1 was required for Rad53phosphorylation in the dna2-1 and dna2-2 mutants. As shown inFig. 3A and B, full Rad53 phosphorylation in the mutants isdependent on checkpoint induction by Mec1, since Rad53-P isdrastically reduced in a dna2-1 mec1 ${Delta}$ sml1-1 strain and absentin a dna2-2 mec1 ${Delta}$ sml1-1 strain.

View larger version (49K):
[in this window]
[in a new window]
FIG. 3. Reduced DNA damage in dna2-1 pif1 ${Delta}$ . The strains used are isogenic derivatives of strain W303—MB90-7A, MB91, U953-61, MB92-M, SPY40, MB92-31C, MB92-35A, and U960-5C (Table 1)—with one exception, the pif1 ${Delta}$ strain MB509. The relevant genotypes are indicated in the figure. Strains were grown to approximately 1 x 10⁷ per ml. Extracts were prepared and Western blots performed using antibody against Rad53 (gift of John Diffley, Clare Hall, England) as described previously (16). Wild-type W303 was also treated with 0.02% MMS where indicated to show phosphorylated Rad53. (A) Rad53 is phosphorylated in dna2-1 and dna2-2 strains at 23°C in a MEC1-dependent and TEL1-independent fashion. The 100-kDa marker runs with fully phosphorylated Rad53 and is indicated by the arrow in the figure. The asterisk denotes a nonspecific, cross-reacting species. (B) Rad53 is phosphorylated in dna2-1 and dna2-2 strains at 37°C in a MEC1-dependent and TEL1-independent manner. (C) pif1 ${Delta}$ suppresses Rad53 phosphorylation in the dna2-1 strain.

We have also previously shown that dna2-2 mutants grow poorlyin the absence of TEL1, a kinase related to MEC1 (11). It istherefore interesting that Rad53 phosphorylation in dna2-1 anddna2-2 mutants is relatively independent of TEL1, compared todependence on MEC1 (Fig. 3A and B).

To see if there is less damage in a dna2-1 pif1 ${Delta}$ mutant, we measuredRad53 phosphorylation in the double mutant. As shown in Fig.3C, the dna2-1 mutant allele did not lead to induction of Rad53phosphorylation, at either 23°C or 37°C, when PIF1 wasdeleted. (The weaker, but clear signals in the dna2-1 controlsare due to loading less protein than in adjacent lanes, as indicatedby the nonspecific protein indicated by the asterisk. Equivalentcontrols are also shown in Fig. 3A and B.) Since deletion ofPIF1 suppresses Rad53 phosphorylation in dna2-1 mutants, wetentatively propose that there is less replication fork failurein the dna2-1 pif1 ${Delta}$ mutant than in the dna2-1 mutant or thatthe checkpoint signal is somehow masked in the double mutant.

Suppression of the residual temperature sensitivity and MMS sensitivity in the dna2 ${Delta}$ pif1 ${Delta}$ mutant by pol32 ${Delta}$ . If Pif1 helicase creates 5' flaps via its 5'-to-3' helicaseactivity, then deletion of Pif1 should lead to reduced occurrenceof 5' flaps in the cell, which might, in part, account for thereduced requirement for the 5' flap helicase/nuclease activityof Dna2 in a pif1 ${Delta}$ mutant. POL32 is a subunit of pol ${delta}$ that leadsto decreased 5' flap strand displacement by pol ${delta}$ when mutated(25). Since deletion of POL32 also suppresses dna2-1 temperaturesensitivity (11), we asked whether deleting POL32 could suppressthe residual temperature-sensitive growth of the dna2 ${Delta}$ pif1 ${Delta}$ doublemutant. Suppression was efficient, since the triple mutant nowgrew at 37°C (Fig. 4).

Genetic interaction between PIF1 and POL32. In the course of these studies, we also obtained a pif ${Delta}$ pol32 ${Delta}$ strain. Although the slow growth of the pif1 ${Delta}$ strain has alwaysbeen attributed exclusively to the generation of petites, wenoticed that the slow growth of the pif1 ${Delta}$ strain was suppressedby pol32 ${Delta}$ (Fig. 4; note colony sizes, for instance). While thepif1 ${Delta}$ strain grows more slowly than the pol32 ${Delta}$ strain, pif1 ${Delta}$ pol32 ${Delta}$ double mutants appear to have an intermediate growth rate betweenthe pol32 ${Delta}$ strain, which grows like the wild type, and pif1 ${Delta}$ strains(Fig. 5, top, left). The putative suppression of pif1 ${Delta}$ strainslow growth by pol32 ${Delta}$ suggested that the pif1 ${Delta}$ mutation affectsa nuclear function involving pol ${delta}$ in addition to its mitochondrialdefect. To further investigate the possible functional interactionbetween Pif1 and pol ${delta}$ and to determine if it was related tothe replication function of POL32, we tested if deletion ofPIF1 affects the cold-sensitive lethality and/or the hydroxyurea(HU; an inhibitor of DNA replication) sensitivity of pol32 ${Delta}$ strains.As shown in Fig. 5, the pol32 ${Delta}$ strain grows normally at 30°C.At 16°C, the pol32 ${Delta}$ strain is inviable, but viability isrestored by deletion of PIF1 (Fig. 5, top right). In addition,the pol32 ${Delta}$ strain is sensitive to inhibition of DNA replicationby 38 mM HU, while the pif1 ${Delta}$ pol32 ${Delta}$ strain is resistant (Fig.5, bottom). The suppression of the cold sensitivity and HU sensitivityof the pol32 ${Delta}$ strain by deletion of PIF1 provides further evidencethat Pif1 interacts with pol ${delta}$ , most likely during chromosomalDNA replication.

View larger version (54K):
[in this window]
[in a new window]
FIG. 5. Suppression of the cold sensitivity and HU sensitivity of the pol32 ${Delta}$ strain by pif1 ${Delta}$ . The following BY4741 isogenic strains were used: BY4741, WT; MB205, pol32 ${Delta}$ ; MB201, pif1 ${Delta}$ ; and MB206, pol32 ${Delta}$ pif1 ${Delta}$ . YPD plates were spotted with these strains and incubated at 30°C for 2 days (top, left panel) or at 16°C for 7 days (top right panel) as indicated. YPD plates were spotted with the same strains in the absence (lower left) or presence (lower right) of 38 mM HU and incubated at 23°C.

Does Pif1 act through Dna2 to inhibit telomerase? While pif1 ${Delta}$ suppresses the requirement for Dna2, we also addressedthe question of whether deletion of DNA2 suppressed the requirementfor Pif1. pif1 mutants have long telomeres, overproduction ofPif1 results in short telomeres, and in vitro Pif1 reduces theprocessivity of telomerase, suggesting Pif1 acts as an inhibitorof telomerase (5, 50). Dna2 affects telomere metabolism in severalways. Dna2 is localized to telomeres in the G₁ and G₂ phasesof the cell cycle but relocalizes during S phase to internalsites in the chromosomes, including but not limited to the rRNAgene (14). In addition, Dna2 is mobilized from telomeres upontreatment of cells with genotoxic agents such as bleomycin (14).Suggesting that telomeric localization implies a telomeric functionfor Dna2, we have shown that dna2-2 est1 ${Delta}$ mutants, lacking telomeraseactivity, senesce much more rapidly than est1 ${Delta}$ mutants, and dna2-2est1 ${Delta}$ mutants show altered pathways of telomerase-independentsurvival (14). dna2 mutants have normal or slightly long telomeres,but overproduction of DNA2 leads to increased occurrence ofsingle-stranded regions at telomeres (17, 39). Figure 6 comparestelomere length in wild-type, pif1 ${Delta}$ , and dna2 ${Delta}$ pif1 ${Delta}$ strains. Thepif1 ${Delta}$ telomere is longer than the wild-type telomere, as previouslydemonstrated (50). Interestingly, the pif1 ${Delta}$ dna2 ${Delta}$ telomere isdramatically shorter than the pif1 ${Delta}$ telomere and similar in sizeto the wild-type telomere. This suggests that the long telomerephenotype of pif1 ${Delta}$ is dependent on Dna2.

View larger version (98K):
[in this window]
[in a new window]
FIG. 6. Deletion of DNA2 reduces telomere length in pif1 ${Delta}$ strains. Lanes 1, 2, and 3, WT strains 47421, BY4741, and BY4742, respectively. Lanes 4, 5, and 6, three colonies of pif1 ${Delta}$ strain 10509. Lanes 7, 8, and 9, dna2 ${Delta}$ pif1 ${Delta}$ strains MB203.3, MB203.5, and MB203.6, respectively. MB203.3, MB203.5, and MB203.6 are three independent pif1 ${Delta}$ transformants of MB110.

Given that dna2-2 est1 ${Delta}$ and dna2-2 est2 ${Delta}$ strains show increasedrates of senescence compared to either single mutant, and giventhe reduction in telomere length in the pif1 ${Delta}$ dna2 ${Delta}$ mutant, wehypothesized that Dna2 might somehow aid telomerase in its function.If so, then we would expect dna2 ${Delta}$ to reduce the frequency ofGCRs in a pif1 ${Delta}$ strain. We therefore investigated the effectof deletion of DNA2 on the increased frequency of GCRs observedin pif1-m2 mutants. The assay measures the rate of deletionof a region of chromosome V that is nonessential and that containsCAN1 and URA3, by scoring the simultaneous appearance of canavanine-resistant(Can^R) 5-FOA^R cells. The pif1-m2 mutant shows a 137-fold increaseover wild-type strains in appearance of GCRs characterized primarilyby the addition of new telomeres to internal chromosomal sequences(Table 2) (36). The rate of GCR formation was reduced to a 70-foldincrease over the wild type in the dna2 ${Delta}$ pif1-m2 strain (Table2). This result is also consistent with an interaction betweenPif1 and Dna2 in telomere biogenesis.

View this table:
[in this window]
[in a new window]
TABLE 2. Frequency of GCRs

Mutations in genes that function to suppress GCRs usually leadto a greater than 100-fold increase in GCR frequency comparedto the wild type (13, 36). Interestingly, dna2-1 (a nucleasemutation), dna2-2, or dna2 K1080A (two different helicase mutations)caused only a 2- to 20-fold increase in GCRs compared to thewild type.

Interaction of DNA2 and PIF1 with other DNA2-interacting genes. We have recently completed a synthetic lethality screen withdna2-1 and dna2-2 and found that DNA2 interacts with 56 genesaffecting at least seven different genome maintenance pathways(11). We next tested whether the pif1 ${Delta}$ suppressed the syntheticeffects previously observed between dna2-1 and 27 of the 44nonessential genes identified in the screen (Table 3). The geneschosen are representatives of each of the pathways identified.Deletion of PIF1 failed to suppress the lethality of dna2 withmany genes involved in OFP, with other helicases, and with genesgoverning chromatin dynamics. The lethality of the triple mutantsrules out a potentially trivial explanation of the syntheticlethality of these genes with dna2-1, namely, that transcriptionof dna2-1 was reduced by the mutations. The lethality of thetriple mutants also is consistent with other results presentedhere that indicate that pif1 ${Delta}$ does not fully bypass the needfor Dna2.

View this table:
[in this window]
[in a new window]
TABLE 3. Growth of various triple mutants in the absence of Dna2 and Pif1^a

Usefulness of dna2 ${Delta}$ pif1 ${Delta}$ : synthetic lethality of rtf1 ${Delta}$ but not of paf1 ${Delta}$ with dna2 ${Delta}$ pif1 ${Delta}$ . Recently, we reported that dna2-1 was synthetically lethal withmembers of the Rad6 epistasis group specifically involved inhistone modification. dna2-1 was synthetically lethal with rtf1,a gene encoding a member of the PAF1 transcription factor/histonemodification complex (11). dna2 ${Delta}$ pif1 ${Delta}$ rtf1 ${Delta}$ mutations are alsosynthetically lethal (Table 3). To try to distinguish whetherthe effect was indirect and due to reduced transcription ofanother replication gene, we tested whether dna2 ${Delta}$ pif1 ${Delta}$ was syntheticlethal with another member of the pathway, paf1 ${Delta}$ . We had previouslyfound that dna2-1 paf1 ${Delta}$ mutant was viable, but were concernedthat the viability might result from residual Dna2 protein activityin the dna2-1 strain. Indeed, dna2 ${Delta}$ pif1 ${Delta}$ paf1 ${Delta}$ triple mutantswere viable. The difference between the effects of deletionPAF1 and RTF1 shows that synthetic sickness with one memberof a pathway does not imply synthetic sickness with additionalmembers, likely due to the participation of individual componentsin multiple, nonoverlapping pathways. The difference betweenthe effect of paf1 and rtf1 correlates, not with an effect ontranscription, but with their quantitative effect on methylation.paf1 mutants reduce dimethylation of histone H3 by 75%, whiledimethylation is nearly completely eliminated in the rtf1 mutant.Therefore, the synthetic lethality of rtf1 with dna2 is morelikely due to a histone methylation defect than to a transcriptiondefect. This interpretation is also supported by recent evidencethat Rtf1 has an additional role in methylation in a processother than transcription elongation (38). Because dna2 ${Delta}$ pif1 ${Delta}$ is synthetically lethal with several other histone modificationgene deletions (Table 2) (11), we propose that the syntheticlethality of dna2 ${Delta}$ pif1 ${Delta}$ rtf1 ${Delta}$ is due to failure of dimethylationof histone H3 K4.

DISCUSSION

Top

Discussion

We have shown that deletion of PIF1 or inactivation of its nuclearfunction suppresses the temperature-sensitive phenotype of dna2-1mutants, the MMS sensitivity of dna2-2 mutants, and even theinviability of dna2 ${Delta}$ mutants. Our main conclusions are summarizedin Fig. 7, namely that Pif1 is involved in OFP and that Dna2is involved, along with Pif1, in regulating telomere length.We will discuss three primary insights underlying these conclusions.First, the suppression of the lethality of the dna2 ${Delta}$ mutationby pif1 ${Delta}$ shows that the nuclear function of Pif1 creates theessential requirement for Dna2, a helicase/nuclease involvedin Okazaki fragment processing. In molecular terms, this firstsuggests that the Pif1 helicase generates structures that arelethal to the cell if Dna2 is not present. Similarly, the absenceof Dna2 may lead to structures that are lethal if processedby Pif1. Second, the genetic interaction between PIF1 and DNA2implies that the nuclear form of Pif1 may play a more generalrole in chromosomal replication than previously thought. Therelated observation that pif1 ${Delta}$ also suppresses the cold sensitivityand the HU sensitivity of pol32 ${Delta}$ , a subunit of pol ${delta}$ , a majorDNA polymerase at the replication fork, supports this interpretation.Third, the suppression of the major pif1 ${Delta}$ phenotype, long telomeres,by dna2 ${Delta}$ shows that the long telomeres in pif ${Delta}$ mutants requireDna2 for synthesis.

View larger version (14K):
[in this window]
[in a new window]
FIG. 7. Interpretation of genetic interactions between PIF1 and DNA2. (A) Pif1 may help to make a flap during RNA removal by Dna2 during OFP. (B) Dna2 may be required for optimum elongation of telomeres by telomerase, whereas Pif1 has been shown to inhibit telomerase processivity (5). Pif1 may have a second role at telomeres in which it aids Dna2 in removal of RNA from the Okazaki fragments at the telomere. The last Okazaki fragment might have a special requirement for Pif1 helicase as there is no pol ${delta}$ /PCNA present to strand displace and to recruit FEN1.

PIF1 creates a requirement for DNA2. Dna2 is thought to participate in primer removal from Okazakifragments, but only in cases where pol ${delta}$ strand displaces morethan 30 bases of the downstream Okazaki fragment before ligation(2, 24, 28, 29). Dna2 is a 5'-to-3' helicase and a nucleasethat requires a single-stranded DNA end for activity (29). Dna2appears to load onto a single-stranded terminus and to translocateby a threading mechanism (27). Thus, Dna2 has evolved to becompatible with processing displaced flaps but not to cleavesingle-stranded regions endonucleolytically. In addition tothe biochemical properties of Dna2, genetic interactions withother genes that function on 5' flaps, such as those codingfor FEN1, Exo1, and Yen1, and with genes involved in removingRNA, such as that coding for RNase H2, strengthen the notionthat Dna2 is required for OFP (8, 11). Thus, although Okazakifragments have not formally been demonstrated to accumulatein dna2 mutants, there is overwhelming biochemical and geneticevidence that the essential function of Dna2 lies in some aspectof OFP. Taking that as our assumption, our new results suggestthat one substrate of Pif1 is an Okazaki fragment. There areseveral ways in which Pif1 might function: either through amechanism intrinsic to Okazaki fragment formation and maturationor, more indirectly, in repairing faulty synthesis or processing.In OFP, reconstitution of reaction mixtures containing pol ${delta}$ ,replication protein A (RPA), Dna2, FEN1, DNA ligase, and modelsubstrates representing intermediates in OFP, suggests thatDna2 is required for OFP only when there is excessive (greaterthan 30 nucleotides) strand displacement of a 5' flap on thepreviously synthesized Okazaki fragment by the pol ${delta}$ extendingthe nascent fragment. The role of Dna2 helicase/nuclease isto participate in removal of the flap. This situation probablydoes not arise at every Okazaki fragment, however, since pol ${delta}$ and FEN1 normally act in concerted fashion producing only transientflaps shorter than 4 nucleotides in vitro (18). Furthermore,Dna2 is not essential in vitro even to remove long flaps inthe presence of FEN1, but is only stimulatory to FEN1, whichappears to be the major nuclease. Our studies suggest that inthis strand displacement pathway for OFP, there may be an additionalparticipant, Pif1 helicase. Pif1 might assist pol ${delta}$ in stranddisplacement, and a pif1 mutation may reduce requirement forDna2 by reducing levels of strand displacement.

We have previously shown that dna2 mutants grow better in theabsence of MEC1 but have increased growth defects in the absenceof TEL1 (11). This implies that there is sufficient damage toinduce the Mec1-dependent checkpoint in dna2 cells, but thatthe checkpoint is not necessary for viability. Instead, thecheckpoint slows growth, perhaps to allow repair. We verifythat result here with physical evidence that Rad53 becomes phosphorylatedin dna2-1 and dna2-2 mutants and that Rad53 phosphorylationis dependent on Mec1 kinase but not on Tel1 kinase. However,in the dna2-1 mec1 ${Delta}$ sml1-1 strain (Fig. 3A), there is still somephosphorylation, unlike in the dna2-2 mec1 ${Delta}$ sml1-1 strain. Thetwo different mutations could generate different types of DNAdamage. In any case, deletion of PIF1 resulted in drastic reductionof the Rad53 phosphorylation, which we propose would be dueto a reduction in extended flaps below the threshold requiredto activate the checkpoint, also suggesting a tight connectionbetween Pif1 and Dna2 function in DNA replication.

It remains possible that Pif1 is only required for repair, althoughwe think it less likely. In this scenario, Pif1 would createa DNA structure at sites where DNA replication forks on thelagging strand are blocked by endogenous DNA damage, and thisstructure is lethal if not resolved. Dna2 helicase/nucleasewould then be required for removal of this structure.

Genetic interactions between PIF1, DNA2, and POL32 suggest a general (but not universal) role for PIF1 in replication fork progression. Several of our recent results support the model just presentedin which Dna2 acts on flaps produced by both pol ${delta}$ and Pif1.First, the temperature sensitivity of dna2-1 mutants and theDNA damage sensitivity of dna2-2 mutants, but not the lethalityof dna2 ${Delta}$ , are suppressed by the deletion of POL32 (11). The POL32gene encodes a subunit of pol ${delta}$ that is required for optimumprocessivity, and its deletion can be expected to reduce stranddisplacement in vivo as it has been demonstrated to do in vitro(12, 25). This would explain the reduced requirement for DNA2.Second, the dna2-1 mutation is synthetically lethal with pol3-01(11), a pol ${delta}$ mutation expected to increase strand displacement(18). This would explain the synthetic lethality. Third, theobservation presented in this work of the suppression of residualdefects in the dna2 ${Delta}$ pif1 ${Delta}$ strain by deletion of POL32 is consistentwith a model in which deletion of Pif1 reduces but does notabolish strand displacement, while further deletion of POL32eliminates strand displacement and shifts the course of Okazakifragment processing to a pathway that is Dna2 independent, suchas an RNase H/FEN1-alone pathway (33). As would be anticipatedin such a model, dna2-1 and dna2 ${Delta}$ pif1 ${Delta}$ are synthetically lethalwith genes encoding RNase H2 subunits (rnh35 ${Delta}$ and rnh202 ${Delta}$ ) (11)(Table 2). This putative Dna2-independent pathway might be inhibitedby flap production by Pif1, since we have shown here that deletionof PIF1 also suppresses the cold-sensitive lethality of pol32 ${Delta}$ ,which in itself might favor the alternative Dna2-independentpathway. Finally, suppression of the slow growth of pif1 ${Delta}$ bydeletion of a purely nuclear function, POL32, suggests thatPIF1 is required for optimal nuclear replication and not justfor mitochondrial DNA stability, as previously proposed. Ina more general sense, the nature of the genetic interactionsbetween PIF1, POL32, and DNA2 suggest that a delicate balanceof these three activities is required for maintaining chromosomalstability in a range consistent with viability. Since such arole in nuclear replication for PIF1 has been overlooked todate, further biochemical reconstitution experiments incorporatingPif1 helicase and pol ${delta}$ lacking Pol32 will be required to fullyunderstand this pathway.

Although it is widely held that Pif1 functions in chromosomalDNA replication primarily at telomeres, the genetic interactionswe report, if indeed they do imply nontelomeric activities,are not the first evidence that PIF1 does not function solelyat telomeres in S. cerevisiae. Ivessa et al. showed clearlythat Pif1 is required for replication fork pausing at the Fob1-dependentreplication fork barrier in the rRNA gene (22). Dna2, in contrast,is required to prevent pausing, and in its absence, there isnot only increased pausing but also an increased frequency ofDSBs at the RFB (47, 48). Thus, Dna2 and Pif1 may have opposingfunctions at the RFB, just as they appear to have at telomeres(Fig. 6).

DNA2 in chromosomal, mitochondrial, and telomere replication. Although deletion of PIF1 suppresses the lethality of a dna2 ${Delta}$ mutation and the DNA damage/replication stress-induced Rad53phosphorylation seen in dna2 mutants, mutants retain defectsin DNA replication and repair since they are temperature sensitiveand sensitive to MMS. We have begun to explore the residualDNA damage in the dna2 ${Delta}$ pif1 ${Delta}$ double mutant. Analysis of cellcycle progression and DNA replication in synchronized cellsafter ectopic expression of PIF1 in a dna2 ${Delta}$ pif1 ${Delta}$ background revealedthat cells arrested within the first cell cycle as dumbbells,a G₂/M arrest (data not shown). Further work should allow amore sensitive evaluation of the precise steps in DNA replicationthat require Dna2 than were possible with conditional alleles,which are by definition leaky.

The DNA2 gene can be deleted in the pif1-m2 strain, which hasa mutated nuclear and functional mitochondrial Pif1, but cannotbe deleted in a pif1-m1 strain, which has a functional nuclearand mutated mitochondrial Pif1. We noticed, however, that allof the dna2 ${Delta}$ pif1-m2 strains are petite. Since pif1-m2 is notdeficient in mitochondrial DNA functions, Dna2 might be requiredfor mitochondrial DNA stability. The mechanism of yeast mitochondrialDNA replication is not well enough understood, however, to speculateon whether the effect is due to a direct role for Dna2 in mitochondrialDNA metabolism or if it is indirect.

Pif1 has been proposed to inhibit telomerase, since pif1 ${Delta}$ mutantshave long telomeres and show increased frequency of de novotelomere synthesis at internal DSBs (50). DSBs give rise toa high frequency of GCRs in pif1-m2 strains (36). Although Pif1inhibits telomerase in vitro (5), the mechanism of telomeraseinhibition in vivo is not fully understood. The fact that weshow that deletion of DNA2 in a pif1 ${Delta}$ strain restores nearlynormal telomere length suggests that Dna2 may need to be functionalin order to observe long telomeres in the absence of Pif1. Dna2may function at telomeres to stimulate telomerase-dependenttelomere lengthening (Fig. 4 and 7). This interpretation isconsistent with our previous work (see the introduction andreference 14), but the putative activation role of Dna2 on telomerasesynthesis is more directly unmasked by deletion of PIF1, asshown here. The reduction in GCR rate from a 137-fold increaseover wild type in the pif1-m2 strain to a 70-fold increase inthe pif1-m2 dna2 ${Delta}$ double mutants also is consistent with thisinterpretation.

The dna2 ${Delta}$ pif1 ${Delta}$ telomere phenotype is similar to that of rrm3 ${Delta}$ pif1 ${Delta}$ . The long telomeres of the pif1 ${Delta}$ mutant and the frequencyof telomere addition to DSBs in pif1 ${Delta}$ cells require RRM3 (20).Also, the GCR rate of pif1 ${Delta}$ is reduced by deletion of RRM3 (20).The dna2 ${Delta}$ rrm3 ${Delta}$ pif1 ${Delta}$ triple mutant is inviable (Table 2), obviatingan experiment to test if telomeres are even shorter or the GCRrate is further reduced than in either double mutant. Outsideof rrm3 ${Delta}$ and mutations that reduce telomerase activity (e.g.,est2 ${Delta}$ and stn1-13), very few mutations have been found that reducethe GCR rate in pif1-m2 strains (36, 37). These comprise spindlecheckpoint genes (mad2, mad3, and bub3), a mitotic exit networkgene (bub2), and sister chromatid cohesion genes (ctf8, ctf18,and dcc1) (37). These genes may be involved in allowing cellswith pre-GCR lesions to survive and generate GCRs. dna2 ${Delta}$ is notknown to affect the spindle checkpoint. Thus, Dna2 suppressionof GCRs in the pif1-m2 strain is more similar to suppressionby rrm3 ${Delta}$ , stn1-13, and est2 ${Delta}$ . A further connection between Dna2and telomerase-dependent telomere elongation is provided bythe fact that dna2 ${Delta}$ pif1 ${Delta}$ est2 ${Delta}$ cells form small colonies and senescemore rapidly than est2 ${Delta}$ mutants (Table 2).

Diede and Gottschling (15) have shown that telomerase does notsynthesize telomeres de novo in the absence of Okazaki fragmentsynthesis. The effects of Dna2 and/or Pif1 on telomere synthesismay be a consequence of a role in OFP (Fig. 7). If Pif1 inhibitstelomerase indirectly as well as directly, it might do so byfunctioning on the lagging strand during telomere maturation.Pif1 may displace the strand on the Okazaki fragment at theend of the telomere, exposing G-rich DNA, which may potentiallyform a G-quartet structure that inhibits telomerase. These G-quartetsmight not hybridize to the telomerase RNA, for instance. Theabsence of Pif1 may minimize formation of such structures. IfPif1 functions as an inhibitor of telomerase independently ofDna2, then a telomerase lacking Pif1 inhibition still requiresDna2 for optimal function, since telomeres are shortened inthe dna2 ${Delta}$ pif1 ${Delta}$ mutant. If a major role of Dna2 is at telomeres,this might explain some puzzling observations in C. elegans.All fungal versions of DNA2 are essential. C. elegans dna2 mutantsshow a more complex phenotype. They appear deficient in DNAreplication but show 90% embryonic viability in F₁. However,they are embryonic lethal in F₂ (32). Late-generation lethalityis a phenotype of telomere deficiency in other organisms.

In S. pombe, pfh1⁺ is an essential helicase whose helicase domainis closely related to both the nonessential S. cerevisiae Pif1and Rrm3 proteins, but which diverges from both in the N terminus.It has been difficult to make a one-to-one comparison with respectto function between pfh1⁺ and either RRM3 or PIF1 to date. Ourdemonstration that S. cerevisiae PIF1 shows genetic interactionwith DNA2 and POL32 may shed light on the conserved functionsof PIF1, since S. pombe pfh1⁺, dna2⁺, and cdc27⁺ (the orthologof POL32) also interact genetically. A mutant allele of pfh1⁺,pfh1-R20, affecting the ATPase domain, suppresses the temperature-sensitivegrowth of the dna2-C2 mutant, which has a mutation affectingthe Dna2 helicase domain of the S. pombe dna2⁺ strain (41, 45).Whether the pfh1 mutant suppresses nuclease-deficient S. pombedna2 strains, as pif1 ${Delta}$ suppresses the dna2 ${Delta}$ and dna2-1 (a lesionin the nuclease) mutants of S. cerevisiae, has not been reported.Nor has it been shown that deletion of pfh1 bypasses the essentialfunction of DNA2, as no nuclease-deficient dna2 alleles havebeen described in S. pombe. Therefore, a direct interactionbetween the two is less well established in S. pombe. S. pombepfh1⁺ and cdc27⁺ also interact. In contrast to the suppressionof S. cerevisiae pol32 ${Delta}$ by pif1 ${Delta}$ that we observe, however, inS. pombe, cdc27 conditional mutants are synthetically lethalwith pfh1-R20 and pfh1-R23 mutations (44). The pfh1 mutationsmay affect a function performed in S. cerevisiae by RRM3 ratherthan by PIF1, accounting for the difference between the twoorganisms. Another difference between the two organisms is thatan additional essential gene, cdc24⁺, which has not been identifiedin S. cerevisiae, appears to interact with these genes in S.pombe. Despite the differences in alleles tested to date inthe two organisms, it is clear that the essential pfh1⁺ genein S. pombe shows similar genetic interactions to PIF1, andtherefore it appears that it is S. cerevisiae PIF1, and notRRM3, as previously believed, that conserves the putative essentialrole of pfh1⁺ in interactions with DNA2 and with pol ${delta}$ in OFP.

ACKNOWLEDGMENTS

The work done by K. Myung's laboratory was supported by theIntramural Research Program of the National Human Genome ResearchInstitute, National Institutes of Health. The work carried outin J. L. Campbell's laboratory was supported by GM25508, a grantfrom the Research Management Group, and a predoctoral fellowshipfrom Fundacao para a Ciencia e Technologia (SFRH/BD/9612/2002),Portugal, to C.C.R.

FOOTNOTES

* Corresponding author. Mailing address: Braun Laboratories, 147-75, California Institute of Technology, Pasadena, CA 91125. Phone: (626) 395-6053. Fax: (626) 449-0756. E-mail: jcampbel{at}caltech.edu.

REFERENCES

Top