MCB
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chu, Y.
Right arrow Articles by Prelich, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chu, Y.
Right arrow Articles by Prelich, G.
Molecular and Cellular Biology, April 2006, p. 3029-3038, Vol. 26, No. 8
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.8.3029-3038.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

The Bur1 Cyclin-Dependent Protein Kinase Is Required for the Normal Pattern of Histone Methylation by Set2

Yaya Chu,1 Ann Sutton,2 Rolf Sternglanz,2 and Gregory Prelich1*

Department of Molecular Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461 Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, New York 11794-52152

Received 20 December 2005/ Returned for modification 9 January 2006/ Accepted 27 January 2006


   ABSTRACT
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
BUR1 and BUR2 encode the catalytic and regulatory subunits of a cyclin-dependent protein kinase complex that is essential for normal growth and has a general role in transcription elongation. To gain insight into its specific role in vivo, we identified mutations that reverse the severe growth defect of bur1{Delta} cells. This selection identified mutations in SET2, which encodes a histone methylase that targets lysine 36 of histone H3 and, like BUR1, has a poorly characterized role during transcription elongation. This genetic relationship indicates that SET2 activity is required for the growth defect observed in bur1{Delta} strains. This SET2-dependent growth inhibition occurs via methylation of histone H3 on lysine 36, since a methylation-defective allele of SET2 or a histone H3 K36R mutation also suppressed bur1{Delta}. We have explored the relationship between BUR1 and SET2 at the biochemical level and find that histone H3 is monomethylated, dimethylated, and trimethylated on lysine 36 in wild-type cells, but trimethylation is significantly reduced in bur1 and bur2 mutant strains. A similar methylation pattern is observed in RNA polymerase II C-terminal domain truncation mutants and in an spt16 mutant strain. Chromatin immunoprecipitation assays reveal that the transcription-dependent increase in trimethylated K36 over open reading frames is significantly reduced in bur2{Delta} strains. These results establish links between a regulatory protein kinase and histone methylation and lead to a model in which the Bur1-Bur2 complex counteracts an inhibitory effect of Set2-dependent histone methylation.


   INTRODUCTION
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Generation of a mature mRNA requires successful completion of a series of steps, including promoter recognition, assembly of a preinitiation complex, initiation of pre-mRNA synthesis, promoter clearance, elongation, termination, capping, 3'-end formation, and splicing. Each of these steps can have regulatory roles at subsets of genes, and therefore it is important to identify the global and gene-specific factors required for each of these steps and their mechanism of action.

In recent years a growing number of factors have been implicated in transcription elongation, either genetically or biochemically. Included among these are the Bur1-Bur2 cyclin-dependent kinase (Cdk) complex (59), Set2 (20, 47, 58), Spt16 (FACT subunit)(35), Spt6 (12), and the Spt4-Spt5 complex (also called DSIF) (12, 56). Analysis of mutations in the genes that encode suspected transcription elongation factors in Saccharomyces cerevisiae, both individually and in combination, suggests that they are important; deletion of SPT16 (FACT subunit) (28), SPT5 (DSIF subunit) (53), and SPT6 (7) is lethal. Deletion of other elongation factor genes such as PPR2 (TFIIS) (33), SPT4 (DSIF subunit) (29), CTK1 (24), or SET2 (52) is not lethal, but this is at least partially due to functional redundancy, since combinatorial effects are frequently observed when these deletions are combined. The conservation of these factors from yeast to humans further attests to their biological importance, and their involvement in human diseases (8, 49) emphasizes the necessity for a greater understanding of their roles.

BUR1 (also known as SGV1) was originally identified in S. cerevisiae as a protein kinase with an unspecified role in the recovery of yeast from mating pheromone-induced cell cycle arrest (13). Its role in the pheromone pathway has never been clarified beyond that original report, but a breakthrough in understanding this gene came with its discovery in a genetic selection for mutations that increase transcription from a promoter that lacks an upstream activating sequence (UAS) in yeast (42). The reporter gene for the selection, SUC2, is required for growth of yeast on sucrose-containing media; strains that contain the suc2{Delta}uas(–1900/–390) allele do not transcribe SUC2, and are therefore unable to grow on sucrose plates (46). Selection for Suc+ revertants of suc2{Delta}uas(–1900/–390) identified mutations in a subset of previously characterized SPT genes and six other genes, designated BUR1 through BUR6 (for bypass UAS requirement) (42).

All of the proteins identified using this selection have general roles in transcription, including histones and other chromatin-related regulators, TATA-binding protein (TBP), regulators of TBP, and elongation factors (4, 40, 42, 59). This selection therefore provided a solid genetic link between BUR1 and transcription. In addition, mutations in a second gene identified by the Bur selection caused a spectrum of phenotypes virtually identical to that of bur1 mutations, suggesting that it might serve as a regulator or substrate of the Bur1 kinase. Using a variety of genetic and biochemical approaches, we were able to show that this gene, BUR2, encodes a cyclin that is directly required for Bur1 kinase activity (59). The Bur1-Bur2 complex thus became the fourth cyclin-dependent protein kinase in yeast postulated to have general roles in transcription (39).

Several lines of evidence suggest that the Bur1-Bur2 complex has a role during transcription elongation. First, bur1 and bur2 mutations are synthetically lethal with mutations in CTK1, which encodes a protein kinase that phosphorylates RNA polymerase during elongation, and with mutations in SPT4 and SPT5, which encode subunits of the DSIF elongation factor (31). In addition, synthetic sickness was observed in combination with rpb1 and rpb2 elongation-defective mutations and with mutations in the SPT6 histone chaperone, TFIIS, and the FCP1 C-terminal domain (CTD) phosphatase. The synthetic phenotypes were specific, as no combinatorial defects were observed when bur1 mutations were combined with mutations in KIN28, SRB10, or the genes that encode the Srb4 mediator subunit or histones H2A and H2B. Second, bur1 and bur2 strains are sensitive to 6-azauracil (31), a phenotype that is a frequent indicator of a transcription elongation defect. The conclusion that Bur1 is an elongation factor has been corroborated by recent chromatin immunoprecipitation results showing that Bur1 and Bur2 are recruited to open reading frames of transcribed genes in a transcription-dependent manner and that RNA polymerase II association with open reading frames is defective in bur1 and bur2 mutant strains (17).

Although the specific role of the Bur1-Bur2 Cdk and its relationship to other elongation factors remain unknown, the similarity of bur1 phenotypes to spt5, spt6, and spt16 phenotypes, including the ability of bur1 mutations to suppress snf2{Delta} and snf5{Delta} (42), suggested that bur1 affects transcription through a chromatin-mediated mechanism. To gain further insight into the role of Bur1-Bur2 in vivo, we selected mutations that suppress the severe growth defect caused by a bur1 deletion. This selection revealed a new functional link between the Bur1 kinase and Set2, a histone methylase that was independently implicated in transcription elongation.


   MATERIALS AND METHODS
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Strains and media. The S. cerevisiae strains used in this study are listed in Table 1. All media, including yeast-peptone-dextrose (YPD), synthetic complete drop-out medium (e.g., SC–Ura), and minimal and sporulation media were made as described previously (44). 5-Fluoroorotic acid (5-FOA) sensitivity was assayed on media that contained 1 g/liter 5-FOA, and medium containing 2% formamide was used to assay formamide sensitivity. Standard genetic methods for mating, sporulation, transformation, and tetrad analysis were used throughout this study (44).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Yeast strains

 
Genetic methods. A yeast genomic library containing mTn-LEU2/lacZ insertions, provided by P. Ross-Macdonald and M. Snyder (Yale University, New Haven, CT), was used to mutagenize SY54 (bur1{Delta}1 [pGP59 = CEN URA3 BUR1]) (see Table 1) essentially as described (3). Approximately 51,000 Leu+ transformants were obtained and replica plated to SC–Leu-5-FOA plates. 5-FOA-resistant colonies were selected after 3 to 4 days of growth and used as templates in PCRs using primers diagnostic for the BUR1 open reading frame. These primers generate an 880-bp PCR product indicative of BUR1+ and a 1,937-bp PCR product indicative of bur1{Delta}1::TRP1. 5-FOA-resistant candidates that generated only the 1,937-bp band were pursued further. Candidates were crossed with GY480 (BUR1+) and tetrads were dissected to determine if viability was linked to the transposon-based LEU2 marker. Two transposon-linked suppressors tentatively designated mut3 and mut59 were obtained. The transposon insertion site was identified by transformation with pRSQ2-URA3 (3), digestion of the genomic DNA with EcoRI, ligation under dilute conditions, recovery in bacteria, and DNA sequencing of the transposon-insert junction.

Gene disruptions were carried out using a kanamycin resistance cassette generated from plasmid pRS400-KanMX4 as the template by a PCR-assisted method (55). PCR products were purified using a PCR purification kit (QIAGEN), and transformed into the diploid yeast strain GY763. Following transformation, yeast cells were grown in liquid YPD for 4 h and spread onto YPD plates containing G418 (200 µg/ml; BRL) to select transformants that had the gene disrupted by the kanamycin cassette via homologous recombination.

Plasmids. A SacI-XhoI fragment from pBM3352 (22) containing SET2 was subcloned into pRS416, generating pCYY23 (CEN URA3 SET2). The SacI-XhoI fragment containing set2C82YD83Q from pBM3354 (22) was subcloned into pRS416 to generate pCYY25 (CEN URA3 set2C82YD83Q).

Western blots. Yeast crude extracts were prepared by growing 30 ml of cells to a concentration of 2 x 107 to 3 x 107 cells per ml. Cells were harvested by centrifugation at 2,000 rpm for 5 min and resuspended in 500 µl of breaking buffer (50 mM Tris [pH 7.5], 10% glycerol, 10 mM MgCl2, 1 mM EDTA, 100 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, one tablet of protease cocktail [Roche]). Cells were disrupted by vortexing with glass beads, and extracts were clarified by centrifugation at 16,000 x g for 10 min (59). Proteins were separated by 10 to 20% gradient polyacrylamide gel electrophoresis (PAGE) gel (Bio-Rad) and transferred to Immuno-Blot polyvinylidene difluoride membranes using a Bio-Rad Transblot SD transfer cell. Membranes were blocked in 3% bovine serum albumin (or 1% bovine serum albumin for monomethyl K36 antibody) in PBS-Tween for 1 h and incubated overnight at room temperature with primary antibody followed by peroxidase-conjugated anti-rabbit immunoglobulin G secondary antibody.

The antibody complexes were detected using enhanced chemiluminescence reagents (Pierce) as specified by the manufacturer. Antibodies that recognize total histone H3 (ab1791), monomethylated histone H3 K36 (ab9048), and trimethylated histone H3 K36 (ab9050) were obtained from Abcam, and the antibody that recognizes dimethylated histone H3 K36 was obtained from Upstate (07-369). Western analysis for the antibody specificity test was performed as described above except that peptides were spotted onto polyvinylidene difluoride membranes and allowed to dry overnight. The membranes were incubated with primary antibody for 1 hour, followed by a 1 -h incubation with secondary antibody. For bur1, bur2{Delta}, and ctk1{Delta} strains the amount of extract was increased 20 to 50% to adjust for the smaller amount of total histone H3 typically observed in those extracts.

Chromatin immunoprecipitations. Chromatin immunoprecipitations were performed essentially as described (27). Chromatin was sheared using an Ultrasonics Inc. sonicator at level three with 12 pulses of 20 seconds. Immunoprecipitations (IPs) were performed using 2.5 µl antibody to monomethyl H3 K36, 1.0 µl antibody to trimethyl H3 K36, and 1.0 µl anti-H3 antibody. Inputs and IP samples were analyzed by standard PCRs to which 1 µCi of 32P-labeled dATP had been added. Products were resolved on 1.8% agarose gels and quantified using a Storm 840 scanner and ImageQuant software (Molecular Dynamics). Results are normalized to inputs and expressed as ratios of methylated histone H3 K36 to total histone H3. The results shown are representative of several independent experiments that gave similar results.

Primers for HMRa and the ACT1, PMA1, and GAL10 open reading frames were as follows: HMRa, 5'CAGTTTCCCCGAAAGAACAA and 5'CCATCCGCCGATTTATTT; ACT1, 5'CCAATTGCTCGAGAGATTTC and 5'CATGATACCTTGGTGTCTTG; PMA1, 5'AAGTCGTCCCAGGTGATATTTTGCA and 5'AACGAAAGTGTTGTCACCGGTAGC; and GAL10, 5'GATCTTCCATACAAAGTTACGGand 5'GGCCTCGACACCCC.


   RESULTS
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Genomic suppressors of bur1{Delta}. Deletion of BUR1 was reported to cause lethality or extremely poor growth (13, 17, 42). In our strain background, bur1{Delta} strains grew extremely slowly, but revertants that grew significantly better arose readily, prohibiting propagation of pure bur1{Delta} strains. We anticipated that these viable bur1{Delta} revertants contained genomic suppressor mutations that would be informative for understanding the roles of BUR1 in vivo. Although revertants of bur1{Delta} arose spontaneously, we utilized a transposon mutagenesis strategy to identify suppressors of bur1{Delta} and to facilitate rapid identification of the mutant genes. A bur1{Delta} strain, covered by a BUR1+ URA3 CEN plasmid to maintain viability, was transformed with an mTn-lacZ-LEU2 integrating-plasmid library (3), selecting for transposon insertions that allowed loss of the BUR1 URA3 plasmid.

The entire screening involved three steps. First, ~51,000 Leu+ transformants were screened for 5-FOA-resistant colonies, which could include the desired viable bur1{Delta} strains, plasmid-borne ura3 mutations, or gene conversion of bur1{Delta} to BUR1+ (Fig. 1A). To distinguish between these possibilities, the 5-FOA-resistant colonies were screened by PCR amplification using primers that distinguish the presence of bur1{Delta} and BUR1+ (Fig. 1B). Finally, a genetic cross was utilized to determine whether the mutation responsible for any viable bur1{Delta} strains was linked to the LEU2+-marked transposon. Through this process we obtained two bur1{Delta} deletion strains in which there was no detectable source of BUR1+ and survival of which was strongly linked to the LEU2-marked transposon.


Figure 1
View larger version (50K):
[in this window]
[in a new window]
  		FIG. 1. Isolation of genomic suppressors of bur1{Delta}. (A) Strains with the indicated genotypes were streaked onto a YPD plate and grown for 4 days. The bur1{Delta} colonies are not visible at this time. Mutants 3 and 59 were subsequently found to contain transposon-linked suppressors, while the other strains contained uncharacterized spontaneous genomic suppressors. (B) PCR screening of revertant strains. Primers that are diagnostic for the BUR1 locus were used in PCRs on revertant colonies. The mut3 and mut59 strains contained bur1{Delta}1::TRP1 but not BUR1+. pGP105 is a control plasmid that contains bur1{Delta}1::TRP1. Lane M, AccI-digested {lambda} DNA size markers.

 
The insertion site was identified for both suppressors by rescuing the transposon and DNA sequencing of the transposon-insertion junction. Interestingly, both suppressors were due to insertions into SET2, which encodes a histone methylase that targets lysine 36 of histone H3 (22, 52). One insertion occurred after amino acid 136 in the SET domain that is required for methylase activity, while the other insertion was after amino acid 495 in the WW domain, suggesting that suppression was due to loss of SET2 function. This conclusion was confirmed by showing that a set2 deletion suppressed bur1{Delta} as efficiently as the original transposon insertion alleles (Fig. 2A) and that transformation with a SET2+ CEN plasmid reversed the suppression phenotype (Fig. 2B).


Figure 2
View larger version (63K):
[in this window]
[in a new window]
  		FIG. 2. set2 mutations suppress bur1{Delta}. (A) Strains with the indicated genotypes were streaked onto a YPD plate. The set2{Delta} strain suppresses the bur1{Delta} inviability as effectively as the original mut3 and mut59 transposon insertions, indicating that suppression is due to loss of SET2 function. (B) A bur1{Delta} set2{Delta} strain was transformed with empty vector or a SET2 CEN plasmid. The SET2 CEN plasmid restored the poor growth indicative of bur1{Delta}, demonstrating that suppression is due to set2{Delta}.

 
The identification of set2 mutations as suppressing the severe growth defect of bur1{Delta} was important because, despite the widely inferred importance of histone methylation, set2 deletion strains are healthy and display very few phenotypes; set2{Delta} has been reported to cause both 6-azauracil-sensitive and 6-azauracil-resistant phenotypes (18, 20, 25, 26, 47), and set2{Delta} increases transcription from a gal4{Delta}UAS allele (22). Although suppression of gal4{Delta}UAS by set2{Delta} appears analogous to our Bur– selection, which uses suc2{Delta}UAS as a reporter, set2{Delta} did not cause Bur– or Spt– phenotypes, which are typically associated with bur1 and bur2 mutations, and bur1-8 did not reverse the Gal– phenotype of gal4{Delta}UAS (Fig. 3C and data not shown). These results suggest that although SET2 and BUR1 have independently been implicated in elongation, their roles are nonoverlapping, and instead are at least partially antagonistic.


Figure 3
View larger version (49K):
[in this window]
[in a new window]
  		FIG. 3. Specificity of suppression. (A) Strains with the indicated genotypes were streaked onto a YPD plate. Note that dot1{Delta} and set1{Delta} have no effect on bur1{Delta}, while set2{Delta} suppresses the bur1{Delta} growth defect. (B) Strains with the indicated genotypes were replica plated to test for suppression of other bur2{Delta} phenotypes. set2{Delta} suppresses the formamide sensitivity (FA) and the cold-sensitive growth phenotype of bur2{Delta} but has no effect on the Bur– or Spt– phenotype, as judged by growth in YP plus sucrose or SC – histidine plates. (C) Suppression of bur2{Delta} growth defect by set2{Delta}. Fivefold dilutions of the strains listed were spotted onto YPD plates and photographed after 5 days.

 
Genetic analysis of the Bur1-Set2 relationship. A critical test for any suppressor is the specificity of the suppression phenotype (41), and the suppression of bur1{Delta} inviability by set2{Delta} was quite specific by several criteria. Two other histone methylases have been identified in yeast; Set1 methylates histone H3 on lysine 4 (2, 19, 32, 43) and Dot1 methylates H3 on K79 (34, 54). Deletion of either SET1 or DOT1 did not suppress bur1{Delta}, either singly or in combination, and set1{Delta} and dot1{Delta} also did not strengthen the suppression by set2{Delta} (Fig. 3A and data not shown). This demonstrates the specificity of the interaction and the lack of redundancy between the histone methylases, at least with respect to BUR1.

The specificity of suppression was tested in other ways. To test for gene specificity, double mutants were created with set2{Delta} and deletions of other genes that are involved in elongation. set2{Delta} reversed the formamide-sensitive and cold-sensitive phenotypes of bur2{Delta} mutants (Fig. 3B), had a modest effect on the growth of bur2{Delta} strains (Fig. 3C), and was unable to suppress the inviability caused by deletion of SPT5, SPT6, or SPT16 (data not shown), each of which is phenotypically related to BUR1 and has a role in elongation. Although we cannot rule out the possibility that set2{Delta} might suppress subtler mutations in these or other genes, suppression by set2{Delta} was specific for the Bur1-Bur2 complex and did not extend to any other elongation or transcription factors tested to date. Finally, set2{Delta} did not suppress all bur1 or bur2 mutations; set2{Delta} suppressed the temperature-sensitive phenotype of the bur1-8 missense mutant (data not shown), the inviability of bur1{Delta} mutants, and the poor growth, formamide-sensitive, and Cs– phenotype of bur2{Delta} mutants, while other bur1{Delta} and bur2{Delta} phenotypes and healthier bur1 or bur2 alleles were not suppressed. Since set2{Delta} suppresses bur1{Delta} and bur2{Delta} null alleles, this example of allele specificity is not indicative of any physical interaction between the two proteins, but likely suggests that severe defects in the kinase complex are required to observe the relationship with SET2. Combined, these tests demonstrate the specificity of the relationship between the Bur1-Bur2 complex and SET2.

The identification of set2{Delta} as a suppressor of the bur1{Delta} growth defect functionally linked BUR1 to histone methylation. But was suppression due to defective methylation of histone H3, or could suppression be due to some other unsuspected role of SET2? Two results clearly indicated that suppression was due to loss of SET2-dependent methylation of K36. First, a set2 C82Y missense mutation that causes defective methylation activity in vitro (22) suppressed bur1{Delta} as effectively as set2{Delta} (Fig. 4A), suggesting that loss of methylation activity was responsible for suppression. Second, if suppression of bur1{Delta} and bur2{Delta} was due to loss of methylation of histone H3 K36, then mutation of K36 should also suppress bur1{Delta}. As predicted, a histone H3 K36R mutation suppressed bur1{Delta} as effectively as set2{Delta}, strongly indicating that suppression of bur1{Delta} was caused by loss of K36 methylation (Fig. 4B).


Figure 4
View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4. Suppression is due to loss of methylation of histone H3 on lysine 36. (A) A bur1{Delta} set2{Delta} strain was transformed with empty pRS416 vector or CEN plasmids containing SET2+ or a methylation-defective set2 allele (set2C82Y). Growth of the transformed strain is indicated; transformation with SET2+ resulted in the nearly lethal bur1{Delta} phenotype, while set2C82Y was unable to complement the set2{Delta} suppression of bur1{Delta}. (B) Strains with the indicated genotypes were streaked onto a YPD plate. Note that the histone H3 K36R mutation suppresses bur1{Delta} as well as set2{Delta} does. WT, wild type.

 
Molecular analysis of the Bur1-Set2 relationship. To gain a better understanding of the relationship between BUR1 and SET2, we investigated the effect of bur1 mutations on the methylation status of histone H3 in vivo using antibodies that specifically recognize monomethylated, dimethylated, and trimethylated lysine 36 of histone H3. The specificity of the antibodies was first tested by assaying for whether the antibodies cross-reacted with unmodified or methylated histone H3 peptides, and as shown in Fig. 5A, each antibody was highly specific for the appropriate methylated peptide.


Figure 5
View larger version (53K):
[in this window]
[in a new window]
  		FIG. 5. Trimethylation of H3 K36 is reduced in bur1-8 and bur2{Delta} strains. (A) The methylated and unmethylated histone H3 K36 peptides listed at the top were spotted onto filters and subjected to Western blotting with the monomethyl-, dimethyl-, and trimethylation-specific antibodies listed below the panel. The antibodies used were for total histone H3 (ab1791), monomethylated K36 (ab9048), trimethylated K36 (ab9050), and dimethylated K36 (07-369) (B) Crude extracts were prepared from yeast strains with the genotypes shown at the top, and Western blots were performed using antibodies specific for total H3, monomethylated K36, dimethylated K36, and trimethylated K36. The strains on the right were shifted to 37°C for 3 h. The prominent lower band of the doublet in the panel labeled mono is a background band, since it does not respond to set2{Delta}. Note that all methylated forms are abolished in the set2{Delta} strain, while only the trimethylated form is significantly reduced in the bur1-8 strain relative to total H3. WT, wild type. (C) Time course after shifting a bur1-8 strain to the nonpermissive temperature reveals rapid loss of trimethylation.

 
Using these antibodies in Western blots of crude cell extracts, we found that a combination of monomethylated, dimethylated, and trimethylated forms of lysine 36 was detected in wild-type strains, and as expected, all methylation was SET2 dependent (Fig. 5B). In a temperature-sensitive bur1-8 mutant strain, the levels of trimethylated K36 were significantly reduced, while monomethylated and dimethylated K36 persisted longer than in the BUR1+ strain, with the monomethylated K36 levels decreasing after prolonged incubation at the nonpermissive temperature (Fig. 5B and C). This specific reduction of trimethylated K36 could be detected at the permissive temperature in the bur1-8 strain and was exacerbated at 37oC, while methylation of K36 was unaffected in a wild-type strain at either temperature. A similar reduction of trimethylated K36 was also observed in a bur2{Delta} strain (Fig. 5B). These results suggest that the Bur1-Bur2 kinase is directly or indirectly required for the transition from a dimethylated to trimethylated state of histone H3 at K36. This is analogous to the recently proposed requirement of Bur1 for the transition of K4 methylation from the dimethylated to the trimethylated state (23).

The Western blots shown in Fig. 5 assay the methylation status of total histone H3 in crude cell extracts. To analyze the K36 methylation state at specific genes, chromatin immunoprecipitation assays were performed using the monomethylated K36- and trimethylated K36-specific antibodies. Previous chromatin immunoprecipitation assays demonstrated that the K36 dimethylation pattern is unaffected by bur2{Delta} (57). At two constitutively highly expressed genes, ACT1 and PMA1, the level of monomethylated K36 was essentially unchanged in BUR2+ versus bur2{Delta} strains, while the level of trimethylated K36 was significantly reduced, consistent with the results obtained in the crude extracts (Fig. 6A).


Figure 6
View larger version (26K):
[in this window]
[in a new window]
  		FIG. 6. Assaying methylation in bur2{Delta} mutants by chromatin immunoprecipitation. Wild-type and bur2{Delta} strains were grown to mid-log phase in YPD (panel A) or YP with glucose (Glu) or galactose (Gal) (panel B). Cross-linked extracts were immunoprecipitated with antibodies specific for total histone H3 or mono- or trimethylated K36. Chromatin immunoprecipitation analysis was done using primer sets specific for the transcriptionally silenced HMR locus and the open reading frames of the GAL10, ACT1, and PMA1 genes. PCR products were quantified and are presented as the ratio of methylated H3 to total H3 for each sample. WT, wild type.

 
At two genes that are transcriptionally inactive under the growth conditions used, HMR and GAL10, the levels of trimethylated K36 were low and largely unaffected by the bur2{Delta} mutation. When GAL10 was induced on galactose-containing medium, the level of trimethylated K36 increased significantly in a BUR2+ strain, but not in a bur2{Delta} mutant (Fig. 6B). The slight increase in trimethylated K36 observed in the bur2{Delta} strain is likely due to low levels of Bur2-independent Bur1 kinase activity or BUR-independent methylation by Set2. Combined, these results reveal that both at individual genes and in total cell extracts, the Bur1-Bur2 protein kinase is required for the transcription-associated increase in histone H3 K36 trimethylation, but not for K36 monomethylation or dimethylation.

To determine whether the reduction of trimethylated K36 was observed in other mutant backgrounds, we began by surveying a panel of Spt– mutants, which are phenotypically most closely related to BUR1 mutants (Fig. 7A). A variety of patterns were observed; mutations in SPT4 and SPT5 (DSIF subunits) had no effect on K36 methylation, an spt16 mutation selectively reduced trimethylation, although not to the extent observed in bur1 or bur2 strains, and spt6 mutants showed allele-specific effects. An spt6-140 strain displayed wild-type methylation in these crude extracts, while only the monomethylated form of K36 was observed in an spt6-1004 strain. The reason for this allelic difference is currently unknown, but phenotypic differences between these two alleles have been observed previously; both strains display strong Ts–, Bur–, and Spt– phenotypes, but only the spt6-1004 mutation increases initiation from cryptic promoters (15).


Figure 7
View larger version (53K):
[in this window]
[in a new window]
  		FIG. 7. Methylation changes in selected transcription factor mutant strains. (A) A panel of strains containing mutations in genes that cause phenotypes similar to that of bur1 mutants were grown at 37°C for 3 h, and extracts were prepared and tested for K36 methylation levels by Western blotting with methylation-specific antibodies. The spt16 strain displays reduced trimethylated K36, and the spt6-1004 strain displays strong reduction of di- and trimethylated K36. WT, wild type. (B) A panel of strains containing mutations in genes responsible for histone modifications or that contain truncations in the CTD of Rpb1 were tested for methylation levels as in panel A. The level of total H3 in crude ctk1{Delta} extracts is typically lower than that of wild-type extracts. Nonetheless, the ctk1{Delta} strain has reduced levels of K36 of all three methylation states, while the three rpb1 CTD truncations selectively reduce trimethylated K36 levels.

 
Strains containing mutations in genes related to SET2 were examined next (Fig. 7B). Three patterns were observed again; a deletion of CTK1, which encodes a protein kinase previously reported to be required for K36 dimethylation (58), completely abolished all methylation of K36, similar to set2{Delta}, while deletion of SET1, DOT1, or RAD6, which are responsible for methylation of K4 and K79 of histone H3 and ubiquitylation of histone H2B, respectively, had no effect on K36 methylation. Finally, three truncations of the Rpb1 CTD (Fig. 7B) selectively reduced K36 trimethylation, as in bur1 and bur2 mutants, with the CTD truncations having a more severe effect than the bur mutations. Combined, these results suggest that the methylation pattern of K36 is affected by many factors in a complex manner, with the selective loss of K36 trimethylation being observed in bur1, bur2, spt16, and rpb1 CTD truncation strains. More extensive methylation defects that differ from the pattern observed in bur1 mutants occur in spt6 and ctk1 mutants.

Posttranslational modifications of histones have been proposed to affect nucleosome function by two broad mechanisms, either by directly affecting interactions with DNA and the other histones, or by affecting the recruitment of modification-specific histone-binding proteins (10). In particular, methylation marks on histone H3 on lysine 4, lysine 9, and lysine 27 stimulate direct binding of Chd1, HP1, and polycomb (PC), respectively, via recognition of the methylated residues by the Chd1, HP1 and PC chromodomains (1, 5, 9, 21, 38). Based on these precedents, we expected that methylation of K36 recruits a chromodomain-containing protein.

Three chromodomain proteins, Chd1, Eaf3, and Esa1, have been identified in yeast (38), and all three have chromatin-mediated functions in transcription. As CHD1 and EAF3 are nonessential genes, we tested whether deletion of either of these genes could also suppress bur1{Delta}, and indeed, chd1{Delta} and eaf3{Delta} individually suppressed the bur1{Delta} growth defect (Fig. 8A). Unlike set2{Delta}-mediated suppression, which reduced all K36 methylation, the methylation pattern in bur1{Delta} eaf3{Delta} and bur1{Delta} chd1{Delta} strains was unchanged compared to that of bur1 mutants, with normal levels of mono- and dimethylated K36 but greatly reduced trimethylation (Fig. 8B). We conclude that eaf3{Delta} and chd1{Delta} suppress bur1{Delta} differently than set2{Delta} does; while set2{Delta} results in loss of methylated K36 marks, eaf3{Delta} and chd1{Delta} abolish downstream effects of K36 mono- or dimethylation. In agreement with these results, a recent report (16) demonstrated that bur1{Delta} is suppressed by eaf3{Delta} and chd1{Delta}.


Figure 8
View larger version (46K):
[in this window]
[in a new window]
  		FIG. 8. Suppression of bur1{Delta} by deletion of genes coding for chromodomain-containing proteins. (A) Strains with the indicated genotypes were streaked onto YPD plates and grown for 4 days. The bur1{Delta} strain is barely visible at this point. (B) Crude extracts were prepared from yeast strains with the genotypes shown at the top, and Western blots were performed using antibodies specific for total H3, monomethylated K36, dimethylated K36, and trimethylated K36. The set2{Delta} and bur1{Delta} set2{Delta} strains have no detectable K36 methylation, while the bur1{Delta} eaf3{Delta} and bur1{Delta} chd1{Delta} strains are selectively reduced for trimethylated K36.

 

   DISCUSSION
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The major conclusion from this study is that a functional connection exists between Bur1 and histone methylation in vivo, based on the following evidence: deletion of SET2, which encodes the histone H3 K36 methylase, reverses the poor growth of bur1{Delta} cells; the severe growth defect of bur1{Delta} cells is due to Set2-dependent methylation of histone H3 on K36; and trimethylated K36 is greatly reduced in bur1 and bur2{Delta} mutant strains. Although previous studies independently linked the Bur1-Bur2 Cdk with chromatin and transcription elongation, and also suggested a role for Set2-mediated methylation of K36 during elongation, the importance of our results is that they bridge these two areas of research and suggest a closer regulatory relationship between Bur1 and Set2 than had been appreciated.

The ability to isolate suppressor mutations that restore growth to bur1{Delta} strains indicates that the Bur1-Bur2 Cdk complex is not intrinsically required for viability, but instead is part of a pathway that is required to overcome a strong growth-inhibitory effect that occurs through Set2-dependent methylation of histone H3. Two questions immediately emerge from this simple genetic result. First, what genes and molecular events are responsible for the near-lethal phenotype in bur1{Delta} strains, and second, what is the specific role of the Bur1-Bur2 Cdk complex in overcoming the inhibitory effect? Although we cannot completely answer these questions, the results presented here, combined with recent results from other groups, provide insight into these issues.

With regard to the first question, it is clear that the growth defect is caused by SET2-dependent methylation of histone H3 on K36, as a SET2 deletion or a histone H3 K36R mutation suppresses bur1{Delta} equivalently. Since we observed only mono- and dimethylated K36 in bur1 and bur2{Delta} strains, we further infer that the growth defect is mediated through either mono- or dimethylated K36. Our interpretation is that set2{Delta} suppresses bur1{Delta} because in that mutant background loss of methylation is less detrimental to the cell than partial or incomplete methylation.

Histone modifications do not always act in isolation, but instead are believed to recruit downstream effectors that recognize specifically modified histones. Our results indicate that K36 mono or dimethylation is required but is not sufficient for inhibiting the growth of bur1{Delta} strains, as deletion of either EAF3 or CHD1, both of which encode chromodomain-containing factors, also suppresses bur1{Delta}, indicating that they are nonredundant components of the inhibitory pathway.

Importantly, the mechanism of eaf3{Delta}- and chd1{Delta}-mediated suppression of bur1{Delta} differs from that of set2{Delta}, as bur1{Delta} eaf3{Delta} and bur1{Delta} chd1{Delta} strains have normal levels of mono- and dimethylated K36, but no detectable trimethylated K36. Moreover, deletion of EAF3 or CHD1 does not enhance suppression of the bur1{Delta} growth defect by set2{Delta} (data not shown), suggesting that Eaf3, Chd1, and methylated K36 are part of the same pathway. We conclude that Eaf3 and Chd1 are downstream effectors of the mono- or dimethylated K36 marks. Consistent with these results, additional mechanistic insight into the role of EAF3 emerged from recent studies demonstrating that Eaf3 binds directly to histone H3 peptides through its chromodomain, and that binding of Eaf3 is modestly stimulated by dimethylation of K36 (6, 14). A stronger effect of K36 methylation on recruitment of Eaf3 was observed by using nucleosomes and the Eaf3-containing Rpd3S complex, suggesting that other interactions might be involved (16). SET2-dependent methylation of K36 thereby results in recruitment of the Rpd3S histone deacetylase complex to the coding region of transcribed genes, generating a localized deacetylated template that is proposed to contribute to restoring transcriptionally active genes to an inactive state (6).

The mechanism of suppression by chd1{Delta}, however, is less clear. Chd1 has been reported to bind to dimethylated K4 of histone H3 via the Chd1 CD2 chromodomain (38), although this conclusion has been questioned by other authors (11, 51). This proposed K4 methyl-binding activity of Chd1 does not easily account for the ability of chd1{Delta} to suppress bur1{Delta}, however, as deletion of SET1, which is responsible for methylating K4, did not suppress bur1{Delta} alone or in combination with set2{Delta} (Fig. 3A), and a histone H3 K4R mutation does not suppress bur1{Delta} (16). The detailed role of CHD1 in suppression of bur1{Delta} thus still remains uncertain at the molecular level, but our results suggest that it functions at least partially through methylated K36. Since Chd1 contains two chromodomains, it remains possible that Chd1 has dual specificity for binding methylated K4 and K36.

The second major question arising from this study is how the Bur1-Bur2 kinase stimulates K36 trimethylation. One model is that BUR1 could affect trimethylation by directly phosphorylating and regulating Set2. A second model is that the effects of the bur1 mutations on trimethylation of K36 could simply be an indirect result of altered transcription in these strains. A third model is that Bur1 could indirectly regulate Set2 activity or a functional association of Set2 with polymerase II or other transcription factors.

The first model is unlikely. Although we found that the purified Bur1-Bur2 complex could directly phosphorylate recombinant Set2 in vitro, mutation of the phosphorylation sites in Set2 had no effect on the growth of cells in BUR1+ and bur1{Delta} strains or on the K36 methylation state (data not shown). For the second model, the finding that K36 trimethylation is only affected in specific transcription factor mutant strains, not all of them, indicates that the changes in K36 trimethylation are not merely a result of altered transcription, but instead suggests a more specific connection between BUR1 and K36 trimethylation. Based on these results and the finding that rpb1 CTD truncations and an spt16 mutation affect the di- to trimethyl transition, we currently favor the third model, in which phosphorylation of an intermediate factor promotes Set2-dependent trimethylation.

Three in vitro substrates of the Bur1-Bur2 kinase have been identified to date: Spt5 (36), the polymerase II CTD (31), and Rad6 (57). These substrates might not be responsible for promoting K36 trimethylation, since set2{Delta} does not suppress spt5{Delta} and spt5-194 does not affect the K36 methylation profile, CTD phosphorylation is reported to be unaffected in bur1 mutants (17), and rad6{Delta} does not affect the K36 methylation profile. Based on their phenotypes, possible targets include Spt16, Eaf3, and Chd1, while a hypothetical K36-specific demethylase and histone H3 itself remain reasonable candidates.

During the process of testing whether other mutations cause effects similar to those of bur1 and bur2 mutations on the histone H3K36 methylation state, it became apparent that effects on the K36 methylation state are complex. Although several proteins have already been described as being required for methylation of K36, including Ctk1 and a phosphorylated polymerase II CTD (20, 25, 26, 58), those studies only examined effects on dimethyl K36. We expanded on these results and found that deletion of SET2 and CTK1 uniformly reduced all forms of methylated K36; mutations in SPT4, SPT5, SET1, DOT1, and RAD6 had no detectable effect on K36 methylation; while bur1, bur2, and spt16 mutants and rpb1 CTD truncations primarily reduced K36 trimethylation. In addition, spt6 mutations caused allele-specific effects on the K36 methylation state, with the spt6-140 strain displaying nearly wild-type methylation, and the spt6-1004 strain only containing detectable monomethylated K36. It will be interesting and informative to determine whether mutations that affect other relatively general transcription factors show widespread effects on K36 methylation, but such an issue will be best addressed using large-scale systematic screening methods, such as the global proteomicsystem that was utilized to identify factors involved in H2B ubiquitylation and K4 methylation (48).

The functional relevance of K36 methylation for transcriptional regulation remains an open issue, largely resting upon the association of di- and trimethylated K36 with the 3' end of open reading frames in chromatin IP assays (20, 37, 52). The importance of this K36 methylation pattern is not immediately obvious, however, since set2{Delta} and histone H3 K36R mutants are relatively healthy in an otherwise wild-type background. Our results and the recent report from Keogh et al. (16) point to a functional importance of K36 methylation. More specifically, the identification of factors that are required for the transition from di- to trimethylated K36 implies regulatory events and a functional significance for this step.

Precedents for functional distinctions based on the number of methyl groups have been described for Set1-mediated methylation at K4 of histone H3, in which trimethylated K4 is specifically associated with actively transcribed genes in yeast (45), and the Lsd1 demethylase is active on dimethylated but not on trimethylated K4 (50), but functional distinctions based on the number of methyl groups at K36 in S. cerevisiae are only beginning to emerge (30). The results presented here further expand our view of the role and regulation of histone methylation.


   ACKNOWLEDGMENTS
 
This work was supported by National Institutes of Health grants GM52486 to G.P. and GM55641 to R.S.

We thank Thomas Jenuwein for peptides, Danielle DePeralta for excellent technical assistance, and Karen Arndt for reading the manuscript.


   FOOTNOTES
 
* Corresponding author. Mailing address: Department of Molecular Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461. Phone: (718) 430-2181. Fax: (718) 430-8778. E-mail: prelich{at}aecom.yu.edu. Back


   REFERENCES
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1. Bannister, A. J., P. Zegerman, J. F. Partridge, E. A. Miska, J. O. Thomas, R. C. Allshire, and T. Kouzarides. 2001. Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410:120-124.[CrossRef][Medline]

2. Briggs, S. D., M. Bryk, B. D. Strahl, W. L. Cheung, J. K. Davie, S. Y. Dent, F. Winston, and C. D. Allis. 2001. Histone H3 lysine 4 methylation is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Genes Dev. 15:3286-3295.[Abstract/Free Full Text]

3. Burns, N., B. Grimwade, P. B. Ross-Macdonald, E. Y. Choi, K. Finberg, G. S. Roeder, and M. Snyder.1994 . Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.Genes Dev. 8:1087-1105.[Abstract/Free Full Text]

4. Cang, Y., D. T. Auble, and G. Prelich. 1999. A new regulatory domain on the TATA-binding protein. EMBO J. 18:6662-6671.[CrossRef][Medline]

5. Cao, R., L. Wang, H. Wang, L. Xia, H. Erdjument-Bromage, P. Tempst, R. S. Jones, and Y. Zhang. 2002. Role of histone H3 lysine 27 methylation in Polycomb-group silencing.Science 298:1039-1043.[Abstract/Free Full Text]

6. Carrozza, M. J., B. Li, L. Florens, T. Suganuma, S. K. Swanson, K. K. Lee, W. J. Shia, S. Anderson, J. Yates, M. P. Washburn, and J. L. Workman.2005 . Histone H3 methylation by Set2 directs deacetylation of coding regions by Rpd3S to suppress spurious intragenic transcription. Cell 123:581-592.[CrossRef][Medline]

7. Clark-Adams, C. D., and F. Winston. 1987. The SPT6 gene is essential for growth and is required for delta-mediated transcription in Saccharomyces cerevisiae.Mol. Cell. Biol. 7:679-686.[Abstract/Free Full Text]

8. Conaway, J. W., and R. C. Conaway. 1999. Transcription elongation and human disease. Annu. Rev. Biochem. 68:301-319.[CrossRef][Medline]

9. Czermin, B., R. Melfi, D. McCabe, V. Seitz, A. Imhof, and V. Pirrotta.2002 . Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111:185-196.[CrossRef][Medline]

10. Fischle, W., Y. Wang, and C. D. Allis. 2003. Histone and chromatin cross-talk. Curr. Opin. Cell Biol. 15:172-183.[CrossRef][Medline]

11. Flanagan, J. F., L. Z. Mi, M. Chruszcz, M. Cymborowski, K. L. Clines, Y. Kim, W. Minor, F. Rastinejad, and S. Khorasanizadeh. 2005. Double chromodomains cooperate to recognize the methylated histone H3 tail.Nature 438:1181-1185.[CrossRef][Medline]

12. Hartzog, G. A., T. Wada, H. Handa, and F. Winston.1998 . Evidence that Spt4, Spt5, and Spt6 control transcription elongation by RNA polymerase II in Saccharomyces cerevisiae. Genes Dev. 12:357-369.[Abstract/Free Full Text]

13. Irie, K., S. Nomoto, I. Miyajima, and K. Matsumoto. 1991. SGV1 encodes a CDC28/cdc2-related kinase required for a G alpha subunit-mediated adaptive response to pheromone in S. cerevisiae. Cell 65:785-795.[CrossRef][Medline]

14. Joshi, A. A., and K. Struhl. 2005. Eaf3 chromodomain interaction with methylated H3-K36 links histone deacetylation to Pol II elongation. Mol. Cell 20:971-978.[CrossRef][Medline]

15. Kaplan, C. D., L. Laprade, and F. Winston. 2003. Transcription elongation factors repress transcription initiation from cryptic sites. Science 301:1096-1099.[Abstract/Free Full Text]

16. Keogh, M. C., S. K. Kurdistani, S. A. Morris, S. H. Ahn, V. Podolny, S. R. Collins, M. Schuldiner, K. Chin, T. Punna, N. J. Thompson, C. Boone, A. Emili, J. S. Weissman, T. R. Hughes, B. D. Strahl, M. Grunstein, J. F. Greenblatt, S. Buratowski, and N. J. Krogan. 2005. Cotranscriptional Set2 methylation of histone H3 lysine 36 recruits a repressive Rpd3 complex.Cell 123:593-605.[CrossRef][Medline]

17. Keogh, M. C., V. Podolny, and S. Buratowski. 2003. Bur1 kinase is required for efficient transcription elongation by RNA polymerase II. Mol. Cell. Biol. 23:7005-7018.[Abstract/Free Full Text]

18. Kizer, K. O., H. P. Phatnani, Y. Shibata, H. Hall, A. L. Greenleaf, and B. D. Strahl.2005 . A novel domain in Set2 mediates RNA polymerase II interaction and couples histone H3 K36 methylation with transcript elongation. Mol. Cell. Biol. 25:3305-3316.[Abstract/Free Full Text]

19. Krogan, N. J., J. Dover, S. Khorrami, J. F. Greenblatt, J. Schneider, M. Johnston, and A. Shilatifard. 2002. COMPASS, a histone H3 (Lysine 4) methyltransferase required for telomeric silencing of gene expression. J. Biol. Chem. 277:10753-10755.[Abstract/Free Full Text]

20. Krogan, N. J., M. Kim, A. Tong, A. Golshani, G. Cagney, V. Canadien, D. P. Richards, B. K. Beattie, A. Emili, C. Boone, A. Shilatifard, S. Buratowski, and J. Greenblatt.2003 . Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Mol. Cell. Biol. 23:4207-4218.[Abstract/Free Full Text]

21. Lachner, M., D. O'Carroll, S. Rea, K. Mechtler, and T. Jenuwein.2001 . Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410:116-120.[CrossRef][Medline]

22. Landry, J., A. Sutton, T. Hesman, J. Min, R. M. Xu, M. Johnston, and R. Sternglanz. 2003. Set2-catalyzed methylation of histone H3 represses basal expression of GAL4 in Saccharomyces cerevisiae. Mol. Cell. Biol. 23:5972-5978.[Abstract/Free Full Text]

23. Laribee, R. N., N. J. Krogan, T. Xiao, Y. Shibata, T. R. Hughes, J. F. Greenblatt, and B. D. Strahl. 2005. BUR kinase selectively regulates H3 K4 trimethylation and H2B ubiquitylation through recruitment of the PAF elongation complex. Curr. Biol. 15:1487-1493.[CrossRef][Medline]

24. Lee, J. M., and A. L. Greenleaf. 1991. CTD kinase large subunit is encoded by CTK1, a gene required for normal growth of Saccharomyces cerevisiae. Gene Expr. 1:149-167.[Medline]

25. Li, B., L. Howe, S. Anderson, J. R. Yates III, and J. L. Workman. 2003. The Set2 histone methyltransferase functions through the phosphorylated carboxyl-terminal domain of RNA polymerase II.J. Biol. Chem. 278:8897-8903.[Abstract/Free Full Text]

26. Li, J., D. Moazed, and S. P. Gygi. 2002. Association of the histone methyltransferase Set2 with RNA polymerase II plays a role in transcription elongation. J. Biol. Chem. 277:49383-49388.[Abstract/Free Full Text]

27. Lieb, J. D., X. Liu, D. Botstein, and P. O. Brown.2001 . Promoter-specific binding of Rap1 revealed by genome-wide maps of protein-DNA association. Nat. Genet. 28:327-334.[CrossRef][Medline]

28. Malone, E. A., C. D. Clark, A. Chiang, and F. Winston.1991 . Mutations in SPT16/CDC68 suppress cis- and trans-acting mutations that affect promoter function in Saccharomyces cerevisiae. Mol. Cell. Biol. 11:5710-5717.[Abstract/Free Full Text]

29. Malone, E. A., J. S. Fassler, and F. Winston.1993 . Molecular and genetic characterization of SPT4, a gene important for transcription initiation in Saccharomyces cerevisiae. Mol. Gen. Genet. 237:449-459.[Medline]

30. Morillon, A., N. Karabetsou, A. Nair, and J. Mellor. 2005. Dynamic lysine methylation on histone H3 defines the regulatory phase of gene transcription. Mol. Cell 18:723-734.[CrossRef][Medline]

31. Murray, S., R. Udupa, S. Yao, G. Hartzog, and G. Prelich.2001 . Phosphorylation of the RNA polymerase II carboxy-terminal domain by the Bur1 cyclin-dependent kinase.Mol. Cell. Biol. 21:4089-4096.[Abstract/Free Full Text]

32. Nagy, P. L., J. Griesenbeck, R. D. Kornberg, and M. L. Cleary. 2002. A trithorax-group complex purified from Saccharomyces cerevisiae is required for methylation of histone H3. Proc. Natl. Acad. Sci. USA 99:90-94.[Abstract/Free Full Text]

33. Nakanishi, T., A. Nakano, K. Nomura, K. Sekimizu, and S. Natori.1992 . Purification, gene cloning, and gene disruption of the transcription elongation factor S-II in Saccharomyces cerevisiae. J. Biol. Chem. 267:13200-13204.[Abstract/Free Full Text]

34. Ng, H. H., D. N. Ciccone, K. B. Morshead, M. A. Oettinger, and K. Struhl. 2003. Lysine-79 of histone H3 is hypomethylated at silenced loci in yeast and mammalian cells: a potential mechanism for position-effect variegation.Proc. Natl. Acad. Sci. USA 100:1820-1825.[Abstract/Free Full Text]

35. Orphanides, G., W. H. Wu, W. S. Lane, M. Hampsey, and D. Reinberg. 1999. The chromatin-specific transcription elongation factor FACT comprises human SPT16 and SSRP1 proteins.Nature 400:284-288.[CrossRef][Medline]

36. Pei, Y., and S. Shuman. 2003. Characterization of the Schizosaccharomyces pombe Cdk9/Pch1 protein kinase: Spt5 phosphorylation, autophosphorylation, and mutational analysis.J. Biol. Chem. 278:43346-43356.[Abstract/Free Full Text]

37. Pokholok, D. K., C. T. Harbison, S. Levine, M. Cole, N. M. Hannett, T. I. Lee, G. W. Bell, K. Walker, P. A. Rolfe, E. Herbolsheimer, J. Zeitlinger, F. Lewitter, D. K. Gifford, and R. A. Young.2005 . Genome-wide map of nucleosome acetylation and methylation in yeast. Cell 122:517-527.[CrossRef][Medline]

38. Pray-Grant, M. G., J. A. Daniel, D. Schieltz, J. R. Yates III, and P. A. Grant. 2005. Chd1 chromodomain links histone H3 methylation with SAGA- and SLIK-dependent acetylation. Nature 433:434-438.[CrossRef][Medline]

39. Prelich, G. 2002. RNA polymerase II carboxy-terminal domain kinases: emerging clues to their function. Eukaryot. Cell 1:153-162.[Free Full Text]

40. Prelich, G. 1997. Saccharomyces cerevisiae BUR6 encodes a DRAP1/NC2{alpha} homolog that has both positive and negative roles in transcription in vivo. Mol. Cell. Biol. 17:2057-2065.[Abstract]

41. Prelich, G. 1999. Suppression mechanisms: themes from variations. Trends Genet. 15:261-266.[CrossRef][Medline]

42. Prelich, G., and F. Winston. 1993. Mutations that suppress the deletion of an upstream activating sequence in yeast: involvement of a protein kinase and histone H3 in repressing transcription in vivo.Genetics 135:665-676.[Abstract]

43. Roguev, A., D. Schaft, A. Shevchenko, W. W. Pijnappel, M. Wilm, R. Aasland, and A. F. Stewart. 2001. The Saccharomyces cerevisiae Set1 complex includes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J. 20:7137-7148.[CrossRef][Medline]

44. Rose, M. D., F. Winston, and P. Hieter. 1990. Methods in yeast genetics: a laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

45. Santos-Rosa, H., R. Schneider, A. J. Bannister, J. Sherriff, B. E. Bernstein, N. C. Emre, S. L. Schreiber, J. Mellor, and T. Kouzarides. 2002. Active genes are tri-methylated at K4 of histone H3. Nature 419:407-411.[CrossRef][Medline]

46. Sarokin, L., and M. Carlson. 1984. Upstream region required for regulated expression of the glucose-repressible SUC2 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 4:2750-2757.[Abstract/Free Full Text]

47. Schaft, D., A. Roguev, K. M. Kotovic, A. Shevchenko, M. Sarov, A. Shevchenko, K. M. Neugebauer, and A. F. Stewart. 2003. The histone 3 lysine 36 methyltransferase, SET2, is involved in transcriptional elongation.Nucleic Acids Res. 31:2475-2482.[Abstract/Free Full Text]

48. Schneider, J., J. Dover, M. Johnston, and A. Shilatifard. 2004. Global proteomic analysis of S. cerevisiae (GPS) to identify proteins required for histone modifications. Methods Enzymol. 377:227-234.[CrossRef][Medline]

49. Schneider, R., A. J. Bannister, and T. Kouzarides.2002 . Unsafe SETs: histone lysine methyltransferases and cancer. Trends Biochem. Sci. 27:396-402.[CrossRef][Medline]

50. Shi, Y., F. Lan, C. Matson, P. Mulligan, J. R. Whetstine, P. A. Cole, R. A. Casero, and Y. Shi.2004 . Histone demethylation mediated by the nuclear amine oxidase homolog LSD1. Cell 119:941-953.[CrossRef][Medline]

51. Sims, R. J., III, C. F. Chen, H. Santos-Rosa, T. Kouzarides, S. S. Patel, and D. Reinberg.2005 . Human but not yeast CHD1 binds directly and selectively to histone H3 methylated at lysine 4 via its tandem chromodomains. J. Biol. Chem. 280:41789-41792.[Abstract/Free Full Text]

52. Strahl, B. D., P. A. Grant, S. D. Briggs, Z. W. Sun, J. R. Bone, J. A. Caldwell, S. Mollah, R. G. Cook, J. Shabanowitz, D. F. Hunt, and C. D. Allis. 2002. Set2 is a nucleosomal histone H3-selective methyltransferase that mediates transcriptional repression. Mol. Cell. Biol. 22:1298-1306.[Abstract/Free Full Text]

53. Swanson, M. S., E. A. Malone, and F. Winston.1991 . SPT5, an essential gene important for normal transcription in Saccharomyces cerevisiae, encodes an acidic nuclear protein with a carboxy-terminal repeat. Mol. Cell. Biol. 11:3009-3019.[Abstract/Free Full Text]

54. van Leeuwen, F., P. R. Gafken, and D. E. Gottschling. 2002. Dot1p modulates silencing in yeast by methylation of the nucleosome core. Cell 109:745-756.[CrossRef][Medline]

55. Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808.[CrossRef][Medline]

56. Wada, T., T. Takagi, Y. Yamaguchi, A. Ferdous, T. Imai, S. Hirose, S. Sugimoto, K. Yano, G. A. Hartzog, F. Winston, S. Buratowski, and H. Handa. 1998. DSIF, a novel transcription elongation factor that regulates RNA polymerase II processivity, is composed of human Spt4 and Spt5 homologs. Genes Dev. 12:343-356.[Abstract/Free Full Text]

57. Wood, A., J. Schneider, J. Dover, M. Johnston, and A. Shilatifard.2005 . The Bur1/Bur2 complex is required for histone H2B monoubiquitination by Rad6/Bre1 and histone methylation by COMPASS.Mol. Cell 20:589-599.[CrossRef][Medline]

58. Xiao, T., H. Hall, K. O. Kizer, Y. Shibata, M. C. Hall, C. H. Borchers, and B. D. Strahl.2003 . Phosphorylation of RNA polymerase II CTD regulates H3 methylation in yeast. Genes Dev. 17:654-663.[Abstract/Free Full Text]

59. Yao, S., A. Neiman, and G. Prelich. 2000. BUR1 and BUR2 encode a divergent cyclin-dependent kinase-cyclin complex important for transcription in vivo. Mol. Cell. Biol. 20:7080-7087.[Abstract/Free Full Text]

Molecular and Cellular Biology, April 2006, p. 3029-3038, Vol. 26, No. 8
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.8.3029-3038.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services