Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2006, p. 3029-3038, Vol. 26, No. 8
0270-7306/06/$08.00+0 doi:10.1128/MCB.26.8.3029-3038.2006
Copyright © 2006, American
Society for
Microbiology. All Rights Reserved.
Department of Molecular Genetics, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, New York 10461 Department of Biochemistry and Cell Biology, Stony Brook University, Stony Brook, New York 11794-52152
Received 20 December 2005/ Returned for modification 9 January 2006/ Accepted 27 January 2006
|
|
|---|
cells. This
selection identified mutations in SET2, which encodes a
histone methylase that targets lysine 36 of histone H3 and, like
BUR1, has a poorly characterized role during transcription
elongation. This genetic relationship indicates that SET2
activity is required for the growth defect observed in
bur1
strains. This SET2-dependent growth
inhibition occurs via methylation of histone H3 on lysine 36, since a
methylation-defective allele of SET2 or a histone H3 K36R
mutation also suppressed bur1
. We have explored the
relationship between BUR1 and SET2 at the biochemical
level and find that histone H3 is monomethylated, dimethylated, and
trimethylated on lysine 36 in wild-type cells, but trimethylation is
significantly reduced in bur1 and bur2 mutant
strains. A similar methylation pattern is observed in RNA polymerase II
C-terminal domain truncation mutants and in an spt16 mutant
strain. Chromatin immunoprecipitation assays reveal that the
transcription-dependent increase in trimethylated K36 over open reading
frames is significantly reduced in bur2
strains.
These results establish links between a regulatory protein kinase and
histone methylation and lead to a model in which the Bur1-Bur2 complex
counteracts an inhibitory effect of Set2-dependent histone
methylation. |
|
|---|
In recent years a growing number of factors have been implicated in transcription elongation, either genetically or biochemically. Included among these are the Bur1-Bur2 cyclin-dependent kinase (Cdk) complex (59), Set2 (20, 47, 58), Spt16 (FACT subunit)(35), Spt6 (12), and the Spt4-Spt5 complex (also called DSIF) (12, 56). Analysis of mutations in the genes that encode suspected transcription elongation factors in Saccharomyces cerevisiae, both individually and in combination, suggests that they are important; deletion of SPT16 (FACT subunit) (28), SPT5 (DSIF subunit) (53), and SPT6 (7) is lethal. Deletion of other elongation factor genes such as PPR2 (TFIIS) (33), SPT4 (DSIF subunit) (29), CTK1 (24), or SET2 (52) is not lethal, but this is at least partially due to functional redundancy, since combinatorial effects are frequently observed when these deletions are combined. The conservation of these factors from yeast to humans further attests to their biological importance, and their involvement in human diseases (8, 49) emphasizes the necessity for a greater understanding of their roles.
BUR1 (also known as SGV1) was originally
identified in S. cerevisiae as a protein kinase with an
unspecified role in the recovery of yeast from mating pheromone-induced
cell cycle arrest (13).
Its role in the pheromone pathway has never been clarified beyond that
original report, but a breakthrough in understanding this gene came
with its discovery in a genetic selection for mutations that increase
transcription from a promoter that lacks an upstream activating
sequence (UAS) in yeast
(42). The reporter gene
for the selection, SUC2, is required for growth of yeast on
sucrose-containing media; strains that contain the
suc2
uas(1900/390)
allele do not transcribe SUC2, and are therefore unable to
grow on sucrose plates
(46). Selection for
Suc+ revertants of
suc2
uas(1900/390)
identified mutations in a subset of previously characterized
SPT genes and six other genes, designated BUR1
through BUR6 (for bypass UAS
requirement)
(42).
All of the proteins identified using this selection have general roles in transcription, including histones and other chromatin-related regulators, TATA-binding protein (TBP), regulators of TBP, and elongation factors (4, 40, 42, 59). This selection therefore provided a solid genetic link between BUR1 and transcription. In addition, mutations in a second gene identified by the Bur selection caused a spectrum of phenotypes virtually identical to that of bur1 mutations, suggesting that it might serve as a regulator or substrate of the Bur1 kinase. Using a variety of genetic and biochemical approaches, we were able to show that this gene, BUR2, encodes a cyclin that is directly required for Bur1 kinase activity (59). The Bur1-Bur2 complex thus became the fourth cyclin-dependent protein kinase in yeast postulated to have general roles in transcription (39).
Several lines of evidence suggest that the Bur1-Bur2 complex has a role during transcription elongation. First, bur1 and bur2 mutations are synthetically lethal with mutations in CTK1, which encodes a protein kinase that phosphorylates RNA polymerase during elongation, and with mutations in SPT4 and SPT5, which encode subunits of the DSIF elongation factor (31). In addition, synthetic sickness was observed in combination with rpb1 and rpb2 elongation-defective mutations and with mutations in the SPT6 histone chaperone, TFIIS, and the FCP1 C-terminal domain (CTD) phosphatase. The synthetic phenotypes were specific, as no combinatorial defects were observed when bur1 mutations were combined with mutations in KIN28, SRB10, or the genes that encode the Srb4 mediator subunit or histones H2A and H2B. Second, bur1 and bur2 strains are sensitive to 6-azauracil (31), a phenotype that is a frequent indicator of a transcription elongation defect. The conclusion that Bur1 is an elongation factor has been corroborated by recent chromatin immunoprecipitation results showing that Bur1 and Bur2 are recruited to open reading frames of transcribed genes in a transcription-dependent manner and that RNA polymerase II association with open reading frames is defective in bur1 and bur2 mutant strains (17).
Although the
specific role of the Bur1-Bur2 Cdk and its relationship to other
elongation factors remain unknown, the similarity of bur1
phenotypes to spt5, spt6, and spt16
phenotypes, including the ability of bur1 mutations to
suppress snf2
and snf5
(42), suggested that
bur1 affects transcription through a chromatin-mediated
mechanism. To gain further insight into the role of Bur1-Bur2 in vivo,
we selected mutations that suppress the severe growth defect caused by
a bur1 deletion. This selection revealed a new functional link
between the Bur1 kinase and Set2, a histone methylase that was
independently implicated in transcription
elongation.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Yeast
strains
|
1 [pGP59
= CEN URA3 BUR1]) (see Table
1) essentially as
described (3).
Approximately 51,000 Leu+ transformants were
obtained and replica plated to SCLeu-5-FOA plates.
5-FOA-resistant colonies were selected after 3 to 4 days of growth and
used as templates in PCRs using primers diagnostic for the
BUR1 open reading frame. These primers generate an 880-bp PCR
product indicative of BUR1+ and a
1,937-bp PCR product indicative of
bur1
1::TRP1.
5-FOA-resistant candidates that generated only the 1,937-bp band were
pursued further. Candidates were crossed with GY480
(BUR1+) and tetrads were dissected
to determine if viability was linked to the transposon-based
LEU2 marker. Two transposon-linked suppressors tentatively
designated mut3 and mut59 were obtained. The
transposon insertion site was identified by transformation with
pRSQ2-URA3 (3), digestion
of the genomic DNA with EcoRI, ligation under dilute conditions,
recovery in bacteria, and DNA sequencing of the transposon-insert
junction. Gene disruptions were carried out using a kanamycin resistance cassette generated from plasmid pRS400-KanMX4 as the template by a PCR-assisted method (55). PCR products were purified using a PCR purification kit (QIAGEN), and transformed into the diploid yeast strain GY763. Following transformation, yeast cells were grown in liquid YPD for 4 h and spread onto YPD plates containing G418 (200 µg/ml; BRL) to select transformants that had the gene disrupted by the kanamycin cassette via homologous recombination.
Plasmids. A SacI-XhoI fragment from pBM3352 (22) containing SET2 was subcloned into pRS416, generating pCYY23 (CEN URA3 SET2). The SacI-XhoI fragment containing set2C82YD83Q from pBM3354 (22) was subcloned into pRS416 to generate pCYY25 (CEN URA3 set2C82YD83Q).
Western blots. Yeast crude extracts were prepared by growing 30 ml of cells to a concentration of 2 x 107 to 3 x 107 cells per ml. Cells were harvested by centrifugation at 2,000 rpm for 5 min and resuspended in 500 µl of breaking buffer (50 mM Tris [pH 7.5], 10% glycerol, 10 mM MgCl2, 1 mM EDTA, 100 mM NaCl, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, one tablet of protease cocktail [Roche]). Cells were disrupted by vortexing with glass beads, and extracts were clarified by centrifugation at 16,000 x g for 10 min (59). Proteins were separated by 10 to 20% gradient polyacrylamide gel electrophoresis (PAGE) gel (Bio-Rad) and transferred to Immuno-Blot polyvinylidene difluoride membranes using a Bio-Rad Transblot SD transfer cell. Membranes were blocked in 3% bovine serum albumin (or 1% bovine serum albumin for monomethyl K36 antibody) in PBS-Tween for 1 h and incubated overnight at room temperature with primary antibody followed by peroxidase-conjugated anti-rabbit immunoglobulin G secondary antibody.
The antibody complexes were detected using enhanced
chemiluminescence reagents (Pierce) as specified by the manufacturer.
Antibodies that recognize total histone H3 (ab1791), monomethylated
histone H3 K36 (ab9048), and trimethylated histone H3 K36 (ab9050) were
obtained from Abcam, and the antibody that recognizes dimethylated
histone H3 K36 was obtained from Upstate (07-369). Western analysis for
the antibody specificity test was performed as described above except
that peptides were spotted onto polyvinylidene difluoride membranes and
allowed to dry overnight. The membranes were incubated with primary
antibody for 1 hour, followed by a 1 -h incubation with
secondary antibody. For bur1, bur2
, and
ctk1
strains the amount of extract was increased 20
to 50% to adjust for the smaller amount of total histone H3 typically
observed in those extracts.
Chromatin immunoprecipitations. Chromatin immunoprecipitations were performed essentially as described (27). Chromatin was sheared using an Ultrasonics Inc. sonicator at level three with 12 pulses of 20 seconds. Immunoprecipitations (IPs) were performed using 2.5 µl antibody to monomethyl H3 K36, 1.0 µl antibody to trimethyl H3 K36, and 1.0 µl anti-H3 antibody. Inputs and IP samples were analyzed by standard PCRs to which 1 µCi of 32P-labeled dATP had been added. Products were resolved on 1.8% agarose gels and quantified using a Storm 840 scanner and ImageQuant software (Molecular Dynamics). Results are normalized to inputs and expressed as ratios of methylated histone H3 K36 to total histone H3. The results shown are representative of several independent experiments that gave similar results.
Primers for HMRa and the ACT1, PMA1, and GAL10 open reading frames were as follows: HMRa, 5'CAGTTTCCCCGAAAGAACAA and 5'CCATCCGCCGATTTATTT; ACT1, 5'CCAATTGCTCGAGAGATTTC and 5'CATGATACCTTGGTGTCTTG; PMA1, 5'AAGTCGTCCCAGGTGATATTTTGCA and 5'AACGAAAGTGTTGTCACCGGTAGC; and GAL10, 5'GATCTTCCATACAAAGTTACGGand 5'GGCCTCGACACCCC.
|
|
|---|
.
Deletion of BUR1 was reported
to cause lethality or extremely poor growth
(13,
17,
42). In our strain
background, bur1
strains grew extremely slowly, but
revertants that grew significantly better arose readily, prohibiting
propagation of pure bur1
strains. We anticipated that
these viable bur1
revertants contained genomic
suppressor mutations that would be informative for understanding the
roles of BUR1 in vivo. Although revertants of
bur1
arose spontaneously, we utilized a transposon
mutagenesis strategy to identify suppressors of bur1
and to facilitate rapid identification of the mutant genes. A
bur1
strain, covered by a
BUR1+ URA3 CEN plasmid to
maintain viability, was transformed with an
mTn-lacZ-LEU2 integrating-plasmid library
(3), selecting for
transposon insertions that allowed loss of the BUR1 URA3
plasmid.
The entire screening involved three steps. First,
51,000 Leu+ transformants were screened for
5-FOA-resistant colonies, which could include the desired viable
bur1
strains, plasmid-borne ura3 mutations,
or gene conversion of bur1
to
BUR1+ (Fig.
1A). To distinguish between these possibilities, the 5-FOA-resistant
colonies were screened by PCR amplification using primers that
distinguish the presence of bur1
and
BUR1+ (Fig.
1B). Finally, a genetic
cross was utilized to determine whether the mutation responsible for
any viable bur1
strains was linked to the
LEU2+-marked transposon. Through
this process we obtained two bur1
deletion strains in
which there was no detectable source of
BUR1+ and survival of which was
strongly linked to the LEU2-marked transposon.
![]() View larger version (50K): [in a new window] |
FIG. 1. Isolation
of genomic suppressors of bur1 . (A) Strains
with the indicated genotypes were streaked onto a YPD plate and grown
for 4 days. The bur1 colonies are not visible at this
time. Mutants 3 and 59 were subsequently found to contain
transposon-linked suppressors, while the other strains
contained uncharacterized spontaneous genomic suppressors.
(B) PCR screening of revertant strains. Primers that are
diagnostic for the BUR1 locus were used in PCRs on revertant
colonies. The mut3 and mut59 strains contained
bur1 1::TRP1 but not
BUR1+. pGP105 is a control plasmid
that contains
bur1 1::TRP1. Lane M,
AccI-digested DNA size
markers.
|
as efficiently
as the original transposon insertion alleles (Fig.
2A) and that transformation with a
SET2+ CEN plasmid
reversed the suppression phenotype (Fig.
2B).
![]() View larger version (63K): [in a new window] |
FIG. 2. set2
mutations suppress bur1 . (A) Strains with
the indicated genotypes were streaked onto a YPD plate. The
set2 strain suppresses the bur1
inviability as effectively as the original mut3 and
mut59 transposon insertions, indicating that suppression is
due to loss of SET2 function. (B) A
bur1 set2 strain was transformed with empty
vector or a SET2 CEN plasmid. The SET2 CEN
plasmid restored the poor growth indicative of bur1 ,
demonstrating that suppression is due to
set2 .
|
was important because, despite
the widely inferred importance of histone methylation, set2
deletion strains are healthy and display very few phenotypes;
set2
has been reported to cause both
6-azauracil-sensitive and 6-azauracil-resistant phenotypes
(18,
20,
25,
26,
47), and
set2
increases transcription from a
gal4
UAS allele
(22). Although
suppression of gal4
UAS by set2
appears analogous to our Bur selection, which uses
suc2
UAS as a reporter, set2
did not
cause Bur or Spt phenotypes,
which are typically associated with bur1 and bur2
mutations, and bur1-8 did not reverse the
Gal phenotype of gal4
UAS (Fig.
3C and data not
shown). These results suggest that although SET2 and BUR1
have independently been implicated in elongation, their roles are
nonoverlapping, and instead are at least partially
antagonistic.
![]() View larger version (49K): [in a new window] |
FIG. 3. Specificity
of suppression. (A) Strains with the indicated genotypes were
streaked onto a YPD plate. Note that dot1 and
set1 have no effect on bur1 , while
set2 suppresses the bur1 growth
defect. (B) Strains with the indicated genotypes were replica
plated to test for suppression of other bur2
phenotypes. set2 suppresses the formamide sensitivity
(FA) and the cold-sensitive growth phenotype of bur2
but has no effect on the Bur or
Spt phenotype, as judged by growth in YP plus
sucrose or SC histidine plates. (C)
Suppression of bur2 growth defect by
set2 . Fivefold dilutions of the strains listed were
spotted onto YPD plates and photographed after 5
days.
|
inviability by
set2
was quite specific by several criteria. Two
other histone methylases have been identified in yeast; Set1 methylates
histone H3 on lysine 4 (2,
19,
32,
43) and Dot1 methylates
H3 on K79 (34,
54). Deletion of either
SET1 or DOT1 did not suppress bur1
,
either singly or in combination, and set1
and
dot1
also did not strengthen the suppression by
set2
(Fig.
3A and data not shown).
This demonstrates the specificity of the interaction and the lack of
redundancy between the histone methylases, at least with respect to
BUR1.
The specificity of suppression was tested in other
ways. To test for gene specificity, double mutants were created with
set2
and deletions of other genes that are involved
in elongation. set2
reversed the formamide-sensitive
and cold-sensitive phenotypes of bur2
mutants (Fig.
3B), had a modest effect
on the growth of bur2
strains (Fig.
3C), and was unable to
suppress the inviability caused by deletion of SPT5,
SPT6, or SPT16 (data not shown), each of which is
phenotypically related to BUR1 and has a role in elongation.
Although we cannot rule out the possibility that set2
might suppress subtler mutations in these or other genes, suppression
by set2
was specific for the Bur1-Bur2 complex and
did not extend to any other elongation or transcription factors tested
to date. Finally, set2
did not suppress all
bur1 or bur2 mutations; set2
suppressed the temperature-sensitive phenotype of the bur1-8
missense mutant (data not shown), the inviability of
bur1
mutants, and the poor growth,
formamide-sensitive, and Cs phenotype of
bur2
mutants, while other bur1
and
bur2
phenotypes and healthier bur1 or
bur2 alleles were not suppressed. Since set2
suppresses bur1
and bur2
null
alleles, this example of allele specificity is not indicative of any
physical interaction between the two proteins, but likely suggests that
severe defects in the kinase complex are required to observe the
relationship with SET2. Combined, these tests demonstrate the
specificity of the relationship between the Bur1-Bur2 complex and
SET2.
The identification of set2
as a
suppressor of the bur1
growth defect functionally
linked BUR1 to histone methylation. But was suppression due to
defective methylation of histone H3, or could suppression be due to
some other unsuspected role of SET2? Two results clearly
indicated that suppression was due to loss of SET2-dependent
methylation of K36. First, a set2 C82Y missense mutation that
causes defective methylation activity in vitro
(22) suppressed
bur1
as effectively as set2
(Fig.
4A), suggesting that loss of methylation activity was responsible for
suppression. Second, if suppression of bur1
and
bur2
was due to loss of methylation of histone H3
K36, then mutation of K36 should also suppress bur1
.
As predicted, a histone H3 K36R mutation suppressed
bur1
as effectively as set2
,
strongly indicating that suppression of bur1
was
caused by loss of K36 methylation (Fig.
4B).
![]() View larger version (41K): [in a new window] |
FIG. 4. Suppression
is due to loss of methylation of histone H3 on lysine 36. (A)
A bur1 set2 strain was transformed with
empty pRS416 vector or CEN plasmids containing
SET2+ or a methylation-defective
set2 allele (set2C82Y). Growth of the transformed
strain is indicated; transformation with
SET2+ resulted in the nearly
lethal bur1 phenotype, while set2C82Y was
unable to complement the set2 suppression of
bur1 . (B) Strains with the indicated
genotypes were streaked onto a YPD plate. Note that the histone H3 K36R
mutation suppresses bur1 as well as
set2 does. WT, wild
type.
|
![]() View larger version (53K): [in a new window] |
FIG. 5. Trimethylation
of H3 K36 is reduced in bur1-8 and bur2
strains. (A) The methylated and unmethylated histone H3 K36
peptides listed at the top were spotted onto filters and subjected to
Western blotting with the monomethyl-, dimethyl-, and
trimethylation-specific antibodies listed below the panel. The
antibodies used were for total histone H3 (ab1791), monomethylated K36
(ab9048), trimethylated K36 (ab9050), and dimethylated K36 (07-369)
(B) Crude extracts were prepared from yeast strains with the
genotypes shown at the top, and Western blots were performed using
antibodies specific for total H3, monomethylated K36, dimethylated K36,
and trimethylated K36. The strains on the right were shifted to
37°C for 3 h. The prominent lower band of the doublet
in the panel labeled mono is a background band, since it does not
respond to set2 . Note that all methylated forms are
abolished in the set2 strain, while only the
trimethylated form is significantly reduced in the bur1-8
strain relative to total H3. WT, wild type. (C) Time course
after shifting a bur1-8 strain to the nonpermissive
temperature reveals rapid loss of
trimethylation.
|
strain (Fig.
5B). These results suggest
that the Bur1-Bur2 kinase is directly or indirectly required for the
transition from a dimethylated to trimethylated state of histone H3 at
K36. This is analogous to the recently proposed requirement of Bur1 for
the transition of K4 methylation from the dimethylated to the
trimethylated state
(23).
The Western
blots shown in Fig. 5
assay the methylation status of total histone H3 in crude cell
extracts. To analyze the K36 methylation state at specific genes,
chromatin immunoprecipitation assays were performed using the
monomethylated K36- and trimethylated K36-specific antibodies. Previous
chromatin immunoprecipitation assays demonstrated that the K36
dimethylation pattern is unaffected by bur2
(57). At two
constitutively highly expressed genes, ACT1 and PMA1,
the level of monomethylated K36 was essentially unchanged in
BUR2+ versus
bur2
strains, while the level of trimethylated K36
was significantly reduced, consistent with the results obtained in the
crude extracts (Fig.
6A).
![]() View larger version (26K): [in a new window] |
FIG. 6. Assaying
methylation in bur2 mutants by chromatin
immunoprecipitation. Wild-type and bur2 strains were
grown to mid-log phase in YPD (panel A) or YP with glucose (Glu) or
galactose (Gal) (panel B). Cross-linked extracts were
immunoprecipitated with antibodies specific for total histone H3 or
mono- or trimethylated K36. Chromatin immunoprecipitation analysis was
done using primer sets specific for the transcriptionally silenced
HMR locus and the open reading frames of the GAL10,
ACT1, and PMA1 genes. PCR products were quantified
and are presented as the ratio of methylated H3 to total H3 for each
sample. WT, wild
type.
|
mutation. When GAL10 was induced on
galactose-containing medium, the level of trimethylated K36 increased
significantly in a BUR2+ strain,
but not in a bur2
mutant (Fig.
6B). The slight increase
in trimethylated K36 observed in the bur2
strain is
likely due to low levels of Bur2-independent Bur1 kinase activity or
BUR-independent methylation by Set2. Combined, these results reveal
that both at individual genes and in total cell extracts, the Bur1-Bur2
protein kinase is required for the transcription-associated increase in
histone H3 K36 trimethylation, but not for K36 monomethylation or
dimethylation. To determine whether the reduction of trimethylated K36 was observed in other mutant backgrounds, we began by surveying a panel of Spt mutants, which are phenotypically most closely related to BUR1 mutants (Fig. 7A). A variety of patterns were observed; mutations in SPT4 and SPT5 (DSIF subunits) had no effect on K36 methylation, an spt16 mutation selectively reduced trimethylation, although not to the extent observed in bur1 or bur2 strains, and spt6 mutants showed allele-specific effects. An spt6-140 strain displayed wild-type methylation in these crude extracts, while only the monomethylated form of K36 was observed in an spt6-1004 strain. The reason for this allelic difference is currently unknown, but phenotypic differences between these two alleles have been observed previously; both strains display strong Ts, Bur, and Spt phenotypes, but only the spt6-1004 mutation increases initiation from cryptic promoters (15).
![]() View larger version (53K): [in a new window] |
FIG. 7. Methylation
changes in selected transcription factor mutant strains. (A)
A panel of strains containing mutations in genes that cause phenotypes
similar to that of bur1 mutants were grown at 37°C for
3 h, and extracts were prepared and tested for K36
methylation levels by Western blotting with methylation-specific
antibodies. The spt16 strain displays reduced trimethylated
K36, and the spt6-1004 strain displays strong reduction of di-
and trimethylated K36. WT, wild type. (B) A panel of strains
containing mutations in genes responsible for histone modifications or
that contain truncations in the CTD of Rpb1 were tested for methylation
levels as in panel A. The level of total H3 in crude
ctk1 extracts is typically lower than that of
wild-type extracts. Nonetheless, the ctk1 strain has
reduced levels of K36 of all three methylation states, while the three
rpb1 CTD truncations selectively reduce trimethylated K36
levels.
|
, while deletion of SET1, DOT1,
or RAD6, which are responsible for methylation of K4 and K79
of histone H3 and ubiquitylation of histone H2B, respectively, had no
effect on K36 methylation. Finally, three truncations of the Rpb1 CTD
(Fig. 7B) selectively
reduced K36 trimethylation, as in bur1 and bur2
mutants, with the CTD truncations having a more severe effect than the
bur mutations. Combined, these results suggest that the
methylation pattern of K36 is affected by many factors in a complex
manner, with the selective loss of K36 trimethylation being observed in
bur1, bur2, spt16, and rpb1 CTD
truncation strains. More extensive methylation defects that differ from
the pattern observed in bur1 mutants occur in spt6
and ctk1 mutants. Posttranslational modifications of histones have been proposed to affect nucleosome function by two broad mechanisms, either by directly affecting interactions with DNA and the other histones, or by affecting the recruitment of modification-specific histone-binding proteins (10). In particular, methylation marks on histone H3 on lysine 4, lysine 9, and lysine 27 stimulate direct binding of Chd1, HP1, and polycomb (PC), respectively, via recognition of the methylated residues by the Chd1, HP1 and PC chromodomains (1, 5, 9, 21, 38). Based on these precedents, we expected that methylation of K36 recruits a chromodomain-containing protein.
Three chromodomain proteins,
Chd1, Eaf3, and Esa1, have been identified in yeast
(38), and all three have
chromatin-mediated functions in transcription. As CHD1 and
EAF3 are nonessential genes, we tested whether deletion of
either of these genes could also suppress bur1
, and
indeed, chd1
and eaf3
individually suppressed the bur1
growth defect
(Fig. 8A). Unlike set2
-mediated suppression, which reduced all
K36 methylation, the methylation pattern in
bur1
eaf3
and bur1
chd1
strains was unchanged compared to that of
bur1 mutants, with normal levels of mono- and dimethylated K36
but greatly reduced trimethylation (Fig.
8B). We conclude that
eaf3
and chd1
suppress
bur1
differently than set2
does;
while set2
results in loss of methylated K36 marks,
eaf3
and chd1
abolish downstream
effects of K36 mono- or dimethylation. In agreement with these
results, a recent report
(16) demonstrated that
bur1
is suppressed by eaf3
and
chd1
.
![]() View larger version (46K): [in a new window] |
FIG. 8. Suppression
of bur1 by deletion of genes coding for
chromodomain-containing proteins. (A) Strains with the
indicated genotypes were streaked onto YPD plates and grown for 4 days.
The bur1 strain is barely visible at this point.
(B) Crude extracts were prepared from yeast strains with the
genotypes shown at the top, and Western blots were performed using
antibodies specific for total H3, monomethylated K36,
dimethylated K36, and trimethylated K36. The set2 and
bur1 set2 strains have no detectable K36
methylation, while the bur1 eaf3 and
bur1 chd1 strains are selectively reduced
for trimethylated
K36.
|
|
|
|---|
cells;
the severe growth defect of bur1
cells is due to
Set2-dependent methylation of histone H3 on K36; and trimethylated K36
is greatly reduced in bur1 and bur2
mutant
strains. Although previous studies independently linked the Bur1-Bur2
Cdk with chromatin and transcription elongation, and also suggested a
role for Set2-mediated methylation of K36 during elongation, the
importance of our results is that they bridge these two areas of
research and suggest a closer regulatory relationship between Bur1 and
Set2 than had been appreciated.
The ability to isolate suppressor
mutations that restore growth to bur1
strains
indicates that the Bur1-Bur2 Cdk complex is not intrinsically required
for viability, but instead is part of a pathway that is required to
overcome a strong growth-inhibitory effect that occurs through
Set2-dependent methylation of histone H3. Two questions immediately
emerge from this simple genetic result. First, what genes and molecular
events are responsible for the near-lethal phenotype in
bur1
strains, and second, what is the specific role
of the Bur1-Bur2 Cdk complex in overcoming the inhibitory effect?
Although we cannot completely answer these questions, the results
presented here, combined with recent results from other groups, provide
insight into these issues.
With regard to the first question, it
is clear that the growth defect is caused by SET2-dependent
methylation of histone H3 on K36, as a SET2 deletion or a
histone H3 K36R mutation suppresses bur1
equivalently. Since we observed only mono- and dimethylated K36 in
bur1 and bur2
strains, we further infer that
the growth defect is mediated through either mono- or dimethylated K36.
Our interpretation is that set2
suppresses
bur1
because in that mutant background loss of
methylation is less detrimental to the cell than partial or incomplete
methylation.
Histone modifications do not always act in
isolation, but instead are believed to recruit downstream effectors
that recognize specifically modified histones. Our results indicate
that K36 mono or dimethylation is required but is not sufficient for
inhibiting the growth of bur1
strains, as deletion of
either EAF3 or CHD1, both of which encode
chromodomain-containing factors, also suppresses
bur1
, indicating that they are nonredundant
components of the inhibitory pathway.
Importantly, the mechanism
of eaf3
- and chd1
-mediated
suppression of bur1
differs from that of
set2
, as bur1
eaf3
and
bur1
chd1
strains have normal levels of
mono- and dimethylated K36, but no detectable trimethylated K36.
Moreover, deletion of EAF3 or CHD1 does not enhance
suppression of the bur1
growth defect by
set2
(data not shown), suggesting that Eaf3, Chd1,
and methylated K36 are part of the same pathway. We conclude that Eaf3
and Chd1 are downstream effectors of the mono- or dimethylated K36
marks. Consistent with these results, additional mechanistic insight
into the role of EAF3 emerged from recent studies
demonstrating that Eaf3 binds directly to histone H3 peptides through
its chromodomain, and that binding of Eaf3 is modestly
stimulated by dimethylation of K36
(6,
14). A stronger effect of
K36 methylation on recruitment of Eaf3 was observed by using
nucleosomes and the Eaf3-containing Rpd3S complex, suggesting that
other interactions might be involved
(16). SET2-dependent
methylation of K36 thereby results in recruitment of the Rpd3S histone
deacetylase complex to the coding region of transcribed genes,
generating a localized deacetylated template that is proposed to
contribute to restoring transcriptionally active genes to an inactive
state (6).
The
mechanism of suppression by chd1
, however, is less
clear. Chd1 has been reported to bind to dimethylated K4 of histone H3
via the Chd1 CD2 chromodomain
(38), although this
conclusion has been questioned by other authors
(11,
51). This proposed K4
methyl-binding activity of Chd1 does not easily account for the ability
of chd1
to suppress bur1
, however,
as deletion of SET1, which is responsible for methylating K4,
did not suppress bur1
alone or in combination with
set2
(Fig.
3A), and a histone H3 K4R
mutation does not suppress bur1
(16). The detailed role
of CHD1 in suppression of bur1
thus still
remains uncertain at the molecular level, but our results suggest that
it functions at least partially through methylated K36. Since Chd1
contains two chromodomains, it remains possible that Chd1 has dual
specificity for binding methylated K4 and K36.
The second major question arising from this study is how the Bur1-Bur2 kinase stimulates K36 trimethylation. One model is that BUR1 could affect trimethylation by directly phosphorylating and regulating Set2. A second model is that the effects of the bur1 mutations on trimethylation of K36 could simply be an indirect result of altered transcription in these strains. A third model is that Bur1 could indirectly regulate Set2 activity or a functional association of Set2 with polymerase II or other transcription factors.
The first
model is unlikely. Although we found that the purified Bur1-Bur2
complex could directly phosphorylate recombinant Set2 in vitro,
mutation of the phosphorylation sites in Set2 had no effect on the
growth of cells in BUR1+ and
bur1
strains or on the K36 methylation state (data
not shown). For the second model, the finding that K36
trimethylation is only affected in specific transcription
factor mutant strains, not all of them, indicates that the changes in
K36 trimethylation are not merely a result of altered transcription,
but instead suggests a more specific connection between BUR1
and K36 trimethylation. Based on these results and the finding that
rpb1 CTD truncations and an spt16 mutation affect the
di- to trimethyl transition, we currently favor the third model, in
which phosphorylation of an intermediate factor promotes Set2-dependent
trimethylation.
Three in vitro substrates of the Bur1-Bur2 kinase
have been identified to date: Spt5
(36), the polymerase II
CTD (31), and Rad6
(57). These substrates
might not be responsible for promoting K36 trimethylation, since
set2
does not suppress spt5
and
spt5-194 does not affect the K36 methylation profile, CTD
phosphorylation is reported to be unaffected in bur1 mutants
(17), and
rad6
does not affect the K36 methylation profile.
Based on their phenotypes, possible targets include Spt16, Eaf3, and
Chd1, while a hypothetical K36-specific demethylase and histone H3
itself remain reasonable candidates.
During the process of testing whether other mutations cause effects similar to those of bur1 and bur2 mutations on the histone H3K36 methylation state, it became apparent that effects on the K36 methylation state are complex. Although several proteins have already been described as being required for methylation of K36, including Ctk1 and a phosphorylated polymerase II CTD (20, 25, 26, 58), those studies only examined effects on dimethyl K36. We expanded on these results and found that deletion of SET2 and CTK1 uniformly reduced all forms of methylated K36; mutations in SPT4, SPT5, SET1, DOT1, and RAD6 had no detectable effect on K36 methylation; while bur1, bur2, and spt16 mutants and rpb1 CTD truncations primarily reduced K36 trimethylation. In addition, spt6 mutations caused allele-specific effects on the K36 methylation state, with the spt6-140 strain displaying nearly wild-type methylation, and the spt6-1004 strain only containing detectable monomethylated K36. It will be interesting and informative to determine whether mutations that affect other relatively general transcription factors show widespread effects on K36 methylation, but such an issue will be best addressed using large-scale systematic screening methods, such as the global proteomicsystem that was utilized to identify factors involved in H2B ubiquitylation and K4 methylation (48).
The
functional relevance of K36 methylation for transcriptional regulation
remains an open issue, largely resting upon the association of di- and
trimethylated K36 with the 3' end of open reading frames in
chromatin IP assays (20,
37,
52). The importance of
this K36 methylation pattern is not immediately obvious, however, since
set2
and histone H3 K36R mutants are relatively
healthy in an otherwise wild-type background. Our results and the
recent report from Keogh et al.
(16) point to a
functional importance of K36 methylation. More specifically, the
identification of factors that are required for the transition from di-
to trimethylated K36 implies regulatory events and a functional
significance for this step.
Precedents for functional distinctions based on the number of methyl groups have been described for Set1-mediated methylation at K4 of histone H3, in which trimethylated K4 is specifically associated with actively transcribed genes in yeast (45), and the Lsd1 demethylase is active on dimethylated but not on trimethylated K4 (50), but functional distinctions based on the number of methyl groups at K36 in S. cerevisiae are only beginning to emerge (30). The results presented here further expand our view of the role and regulation of histone methylation.
We thank Thomas Jenuwein for peptides, Danielle DePeralta for excellent technical assistance, and Karen Arndt for reading the manuscript.
|
|
|---|
homolog that has both positive and
negative roles in transcription in vivo. Mol. Cell.
Biol.
17:2057-2065.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»