Previous Article | Next Article ![]()
Molecular and Cellular Biology, April 2006, p. 3135-3148, Vol. 26, No. 8
0270-7306/06/$08.00+0 doi:10.1128/MCB.26.8.3135-3148.2006
Laboratory of Gene Regulation and Development, National Institute of Child Health and Human Development, Bethesda, Maryland 20892
Received 8 December 2005/ Accepted 12 January 2006
|
|
|---|
does not reduce levels of Pol II at ARG1, Ser5 phosphorylation, or Paf1C expression, it appears that Spt4p (or its partner in DSIF, Spt5p) provides a platform on Pol II for recruiting Paf1C following Ser5 phosphorylation and promoter clearance. spt4
reduces trimethylation of Lys4 on histone H3, demonstrating a new role for yeast DSIF in promoting a Paf1C-dependent function in elongation. |
|
|---|
CTD phosphorylation is also required for methylation of histones in the coding sequences. Set1p complex (COMPASS) methylates Lys4 in histone H3 (H3-K4) near the 5' ends of transcribed genes (27, 37). Set1p associates with Ser5-phosphorylated Pol II and is recruited to the 5' ends of transcribed genes dependent on Kin28p (27). Set2p methylates H3-K36 throughout the open reading frame (ORF) (16, 52), and CTD Ser2 phosphorylation stimulates recruitment of Set2p (16, 18, 52). Interactions of Set1p and Set2p with phosphorylated Pol II and the attendant methylation events also depend on Paf1 complex (Paf1C) (14, 16, 27, 51). Paf1C further stimulates Set1p function by promoting H2B ubiquitylation by Rad6p/Bre1p complex (7, 26, 49, 51), a prerequisite for H3-K4 methylation (4, 44).
Paf1C was first identified in yeast as a group of proteins associated with unphosphorylated Pol II (47) and consists of five core subunits: Paf1p, Cdc73p, Rtf1p, Leo1p, and Ctr9p (12, 15, 24, 39, 40, 43). Paf1C forms a stoichiometric complex with Pol II (39), and deletion of Rtf1p or Cdc73p dissociates the remaining Paf1C subunits from chromatin (25). Unlike the Pol II-associated mediator, which is restricted to promoters, Paf1C is often detected at equivalent or higher levels in coding regions (10, 15, 25, 31, 41). It is unclear whether the apparent association of Paf1C with promoters represents an interaction with the PIC or with Pol II in the early stages of elongation.
Paf1C mutants show reduced expression of diverse mRNAs (29, 32, 45), but the impaired Paf1C-dependent step(s) are generally unknown. Genetic data suggest that Paf1C has functions overlapping that of elongation factors Spt4p/Spt5p (DSIF), Ppr2p (TFIIS), and Spt16p/Pob3p (FACT) (3, 43), and paf1
and cdc73
extracts show transcription elongation defects (36). However, essentially wild-type (WT) occupancy of Pol II in the CLN1 ORF was observed in cdc73
and rtf1
mutants (25), and these mutations did not reduce the rate or processivity of elongation during transcription of a Gal4p-induced gene (23). Moreover, recent findings suggest that Paf1C is critically required for 3'-end processing during termination. Thus, rtf1
and paf1
mutants show defects in recruitment of cleavage/polyadenylation factor and exhibit shorter poly(A) tails (25), and paf1
can reduce mRNA stability by allowing aberrant utilization of downstream poly(A) sites (29).
The mechanism of Paf1C recruitment to transcribed genes is not well understood. Based on the original method of purification, it was surmised that Paf1C interacts with Pol II independently of CTD phosphorylation (47). Consistent with this, recruitment of Paf1C to transcribing Pol II in vivo is independent of Ser2 phosphorylation by Ctk1p (1). However, the role of Kin28p and Ser5 phosphorylation in Paf1C recruitment has not been examined. The copurification of Paf1C with initiation factors TFIIB and TFIIF (39) and elongation factors Spt5p (43) and Pob3p/Spt16p (15, 43) could indicate that Paf1C is tethered to Pol II indirectly by one of these factors. While this work was in progress, it was shown that cells lacking Bur2p, the cyclin partner of cyclin-dependent protein kinase Bur1p, exhibit decreased recruitment of Paf1C to Pol II in the PMA1 ORF and reduced H2B-K123 ubiquitylation of bulk histones (17, 50). The defect in ubiquitylation seems to stem from impaired Paf1C recruitment and loss of Rad6p phosphorylation on Ser120 by Bur1p/Bur2p (50). However, it is not understood how Bur1p/Bur2p kinase activity promotes Paf1C association with Pol II.
In this report, we show that deletion of the Spt4p subunit of elongation factor DSIF impairs Paf1C recruitment by activator Gcn4p without reducing Pol II occupancy in the ARG1 ORF, consistent with a direct role for Spt4p in recruiting Paf1C to elongating Pol II. Supporting this idea, we found that Paf1C is preferentially associated with Pol II phosphorylated on Ser5 in cell extracts in a manner dependent on Spt4p and that inactivation of Kin28p impairs both Paf1C recruitment to ARG1 and Paf1C-Spt4p association in cell extracts. Since Spt4p is recruited to the ARG1 ORF independently of Paf1C, we propose that DSIF provides a platform on elongating Pol II for Paf1C recruitment, thereby enhancing Paf1C functions during transcription elongation.
|
|
|---|
TATA (34). To construct kin28
::kanMX strains harboring episomal KIN28-HA or kin28-HA-ts16, the parent strains were first transformed with URA3 plasmid pHQ1429 carrying KIN28-HA. The resulting strains were transformed with a PCR fragment containing kin28
::kanMX4, synthesized using DNA from the heterozygous kin28
::kanMX/KIN28 diploid as a template, and selected on G418 medium. Deletion of chromosomal KIN28 was indicated by the conferred sensitivity to 5-fluoro-orotic acid and confirmed by PCR analysis. pHQ1429 in the confirmed kin28::kanMX strain was replaced by LEU2 plasmids carrying KIN28-HA (pHQ1430) or kin28-HA-ts16 (pHQ1431) by plasmid shuffling. |
View this table: [in a new window] |
TABLE 1. Yeast strains used in this study
|
Biochemical methods. The chromatin immunoprecipitation (ChIP) experiments were conducted as described previously (45) using the primers and antibodies described below, except that sulfometuron induction was carried out for 30 min, the time of maximal Gcn4p binding at ARG1 (5). The ARG1 upstream activation sequence (UAS) and TATA primer pairs used for ChIP analysis were described previously (34, 45). The following additional primer pairs were used to amplify the indicated ARG1 sequences: (i) 5'ORF, 5' TGGCTTATTCTGGTGGTTTAG 3' (nucleotide positions +23 to +43) and 5' ATCCACACAAACGAACTTGCA 3' (+186 to +166); (ii) middle ORF, 5' ACATTTCTTACG AGGCAGGTA 3' (+557 to +577) and 5' CTTGTTGTCGGTGTAGGTCA 3' (+720 to +701); (iii) 3'ORF, 5' TTCTGGGCAGATCTACAA AGA 3' (+1091 to +1111) and 5' AAGTCAACT CTTCACCTTTGG 3' (+1258 to +1238); (iv) down1, 5' CTTCATGAGAACAGAACATTG 3' (+1489 to +1509) and 5' TTCCTTATCAGTCAATTGAGG 3' (+1643 to +1623); (v) down2, 5' GTTTATTCCTCGTTGTGAGGT 3' (+1880 to +1900) and 5' TACCAATATCAATTAGCTCA TTG 3' (+2040 to +2018). The primer pairs used to amplify PMA1 and PYK1 sequences are as follows: (i) PMA1 TATA, 5' CGATTATATAAAAAGGCCAAATAT 3' (341 to 318) and 5' TATCAACG AGGTTGATAGAAAAA 3' (171 to 193); (ii) PMA1 5'ORF, 5' CGACGACGAAGACAGTG ATA 3' (+168 to +187) and 5' ATTCTTTTTCGTCAGCCATTTG 3' (+331 to +310); (iii) PYK1 TATA, 5' CATCAAAACGATATTCGT TGG 3' (235 to 215) and 5' AACCAAAGGATGAA AAAGAATG 3' (80 to 101); (iv) PYK1 5'ORF, 5' ACAAGTCTGTCATTGACAACG 3' (+179 to +199) and 5' CAT CGG TGG TGA AGA TCA TTT 3' (+343 to +323). The primer pair used for an internal control amplifies a nontranscribed intergenic sequence from chromosome V: 5' CCGATTTGTGAGATTCTTCCT 3' and 5' GAACAAGGTTACAAATCC TGA T 3'.
Northern analysis was carried out as described previously (34). Western analysis of whole-cell extracts (WCEs) was conducted using WCEs prepared by trichloroacetic acid precipitation (35), and coimmunoprecipitation assays were conducted as described previously (53), using the antibodies described below.
Antibodies. The following antibodies were employed: monoclonal anti-Myc and anti-hemagglutinin (HA) (Roche), anti-Rpb3p (Neoclone), anti-phospho-Ser5 (H14; Covance), anti-Rpb1p (8WG16; Covance) and anti-histone H3 (05-499; Upstate); polyclonal anti-Gcd6p (2), anti-Spt4 and anti-Spt5 (gifts from G. Hartzog), anti-Rtf1p (gift from K. Arndt), anti-trimethyl-histone H3 (Lys4) (abcam, ab8580), and anti-dimethyl-histone H3 (Lys79) (07-366; Upstate).
|
|
|---|
6-fold higher levels of Myc-Paf1p cross-linked to the 5' and 3' ends of the ARG1 ORF than in isogenic PAF1-myc cells lacking Gcn4p (Fig. 1A and B). The ratio of Myc-Paf1p occupancy in GCN4 versus gcn4
cells is plotted in Fig. 1C for different locations at ARG1. The results show that Gcn4p-dependent Paf1p binding occurred at much lower levels in the UAS and TATA regions and immediately downstream of ARG1 compared to that in the ORF sequences (Fig. 1C). The distribution of Paf1p across ARG1 is similar to that described for other yeast genes (9, 10). As expected, Gcn4p showed high-level binding to the UAS and TATA regions but was detected in the ORF at levels only slightly above the nonspecific background levels of gcn4
cells (Fig. 1E). (Because the UAS and TATA elements are separated by <200 bp and the sheared chromatin fragments are
500 bp, most fragments containing the TATA element also contain the UAS, likely accounting for the apparent binding of Gcn4p to the TATA region.)
![]() View larger version (50K): [in a new window] |
FIG. 1. Induction of Gcn4p increases Paf1p occupancy in the transcribed regions of ARG1. (A) Diagram depicting the ARG1 ORF, TATA element (open box), and Gcn4p binding sites in the UAS (gray boxes). Dashed lines depict the intergenic region between ARG1 and the adjacent gene, YOL057w. Names and positions (relative to the start codon) of fragments PCR amplified in ChIP analyses are given below. (B-E) ChIP analysis of Myc-Paf1p, Rpb3, and Gcn4p binding at ARG1 following induction of Gcn4p. PAF1-myc strains HQY397 (gcn4 ), HQY389 (WT), and HQY855 ( TATA) were cultured in synthetic complete medium lacking Ile and Val and treated with sulfometuron for 30 min to induce Gcn4p and then were subjected to ChIP analysis with anti-Myc (panel C), anti-Rpb3p (panel D), or anti-Gcn4p (panel E) antibodies. DNA was extracted from the immunoprecipitates (IP) and input chromatin (Inp) samples and subjected to PCR in the presence of [33P]dATP to amplify the radiolabeled fragments described in panel A and a control (C) fragment from an intergenic region on chromosome V. PCR products were resolved by polyacrylamide gel electrophoresis and visualized by autoradiography, with representative results shown in panel B. PCR products were quantified with a phosphorimager, and the ratios of ARG1 to control signals in IP samples were normalized for the corresponding ratios for Inp samples. The resulting values measured for the GCN4 strains were normalized to the corresponding values for gcn4 cells to yield the percent IP (GCN4/gcn4 ) values plotted in histograms. (F) Northern analysis of gcn4 (249), WT (BY4741), and TATA (HQY700) strains cultured under the conditions described above, probing for transcripts of Gcn4p target genes ARG1, ARG4, and SNZ1 and for Pol III transcript SCR1 analyzed as a loading control.
|
TATA mutation also decreased the size of ARG1 transcripts, most likely reflecting aberrant initiation downstream of the normal start site (Fig. 1F). Importantly, the
TATA mutation greatly reduced Paf1p occupancy at ARG1 (Fig. 1C), suggesting that Paf1C recruitment is dependent on PIC assembly and transcription. The small amount of shorter ARG1 transcripts produced in the
TATA strain (Fig. 1F) probably explains the residual occupancy of Pol II and Paf1p in the ARG1 ORF in the
TATA mutant (Fig. 1C and D). The ratio of Paf1p to Pol II occupancy is lower in the TATA region and downstream from the ORF (Down1) than in the 5' and 3' ORF sequences at ARG1 (cf. Fig. 1C and D and also WT results in Fig. 2A and B). The relatively low Paf1p occupancy downstream of the ORF is consistent with the finding that Paf1C is released from Pol II at the polyadenylation site (10). The comparatively low Paf1p occupancy in the TATA region suggests that Paf1C associates with Pol II only after the transition from PIC to elongation complex, as discussed further below.
![]() View larger version (35K): [in a new window] |
FIG. 2. Recruitment of Paf1p, but not Pol II, by Gcn4p requires the Paf1C subunits Cdc73p and Rtf1p. PAF1-myc (panel A) and RPB3-myc (panel B) strains containing no mutations (WT) or the indicated deletions were subjected to ChIP analysis using anti-Myc antibodies as described in the legend to Fig. 1. PAF1-myc gcn4 strain HQY397 and RPB3-myc gcn4 strain HQY422 were analyzed in each experiment as a negative control. Down1, region downstream of the ORF, as shown in Fig. 1A.
|
and rtf1
cells but unaffected by deletion of Leo1p (Fig. 2A). Pol II occupancy was unaffected in the cdc73
and rtf1
strains (Fig. 2B), suggesting that high-level recruitment of Paf1p is not required for a WT level of elongating Pol II in the ARG1 ORF (see also Fig. 6B). These last results fit with our finding that cdc73
and rtf1
mutants do not exhibit Gcn phenotypes (45) and with previous data indicating that cdc73
and rtf1
did not reduce Pol II occupancy at CLN1, TEL1, or TEF1 (25) nor decrease the rate or processivity of elongation during transcription of a Gal4p-induced gene (23).
![]() View larger version (38K): [in a new window] |
FIG. 6. Spt4p recruitment to ARG1 is independent of Paf1C and Ser5 CTD phosphorylation. (A-B) SPT4-myc strains containing deletions of RTF1, CDC73, or the ARG1 TATA were subjected to ChIP analysis using Myc (A) or Rpb3p (B) antibodies, with strain HQY975 (gcn4D) analyzed as a negative control. (C and D) SPT4-myc strains containing KIN28 (WT) (HQY987) or kin28-ts16 (HQY988) were subjected to ChIP analysis using H14 (C) or Myc (D) antibodies, analyzing HQY989 (gcn4D) as negative control. (E) The ratio percent immunoprecipitation (GCN4/gcn4 ) values for Myc-Spt4p in panel D were normalized to the ratio percent immunoprecipitation (GCN4/gcn4 ) values for Rpb3p in Fig. 3C. (F) Hypothetical model summarizing the role of Spt4p/Spt5p in bridging interaction between Paf1C and elongating Pol II phosphorylated on Ser5. Paf1C is shown interacting directly with Pol II based on the observed Cdc73p-Pol II interaction (39). Spt4p/Spt5p are shown bridging Paf1C and Pol II based on our findings on the role of Spt4p in promoting Paf1C-Pol II interaction. Paf1C is shown interacting with the Ser5-phosphorylated Pol II to reflect our finding of preferential association of Paf1p with Ser5-hyperphosphorylated versus hypophosphorylated Rpb1p. Paf1C may interact directly with the phosphorylated CTD (30), but this is conjectural, as is the suggestion that Spt4p and Spt5p each interact directly with both Paf1C and Pol II. Bur1p/Bur2p is shown stimulating the association of Paf1C with Spt4p/Spt5p and Ser5-phosphorylated Pol II based on our findings shown in Fig. 7A and previously published results (17).
|
We first measured the occupancy of Rpb1p hyperphosphorylated on Ser5 (Ser5P) across the ARG1 gene and found that Ser5P occupancy in WT cells was highest in the TATA region and declined from 5' to 3' across the ORF (Fig. 3A), in accordance with previous findings (13). In kin28-ts16 cells at 37°C, by contrast, nearly background levels of Ser5P were found at all locations tested at ARG1 (Fig. 3A). Western analysis of WCEs showed that the cellular level of Ser5P was reduced but not abolished in kin28-ts16 cells at 37°C and that the level of Kin28p itself was decreased by the ts16 mutation (Fig. 3B). We observed reduced Pol II occupancy in the 5' and 3' regions of the ARG1 ORF in kin28-ts16 cells at 37°C but no reduction in Pol II occupancy of the TATA region (Fig. 3C), consistent with a defect in promoter clearance. As expected from the WT level of Pol II binding to the promoter, there was no reduction in Gcn4p occupancy of the UAS in the kin28-ts16 mutant (Fig. 3D). Together, the results in Fig. 3A to D indicate that inactivation of the kin28-ts16 product had the expected effects at ARG1 of reducing the level of Ser5P with attendant reductions in promoter clearance by Pol II. The fact that occupancy in the ORF was reduced less for Rpb3p than for Ser5P by kin28-ts16 suggests that promoter clearance at ARG1 can be achieved, albeit inefficiently, by Pol II molecules hypophosphorylated on Ser5. Similar results were reported previously for this (27) and other kin28 alleles (13, 21). The presence of hypophosphorylated Pol II in the ARG1 ORF in kin28-ts16 cells could be attributed to the residual Ser5 phosphorylation (Fig. 3B) produced by either the kin28-ts16 product or Srb10p (21) that is below the detection limit of the ChIP assay or to lack of an absolute requirement for Ser5 phosphorylation in promoter clearance (22, 38).
![]() View larger version (49K): [in a new window] |
FIG. 3. Optimal Paf1p recruitment to ARG1 requires Kin28p-dependent phosphorylation of the Pol II CTD on Ser5. (A-E) Isogenic PAF1-myc strains HQY963 (KIN28 [WT]), HQY964 (kin28-ts16), and HQY965 (gcn4 ) were grown at 25°C to an optical density at 600 of 0.6, transferred to 37°C for 30 min, and treated with sulfometuron for an additional 30 min at 37°C. (A) ChIP analysis was conducted as described in the legend to Fig. 1 using H14 antibodies against phosphorylated Ser5. (B) Western analysis of WCEs from the strains in panel A using H14 antibodies and antibodies against Rpb3p, Myc (to detect Myc-Paf1p), HA (to detect HA-Kin28p), and Gcd6p. (C-E) ChIP analysis was conducted as described in the legend to Fig. 1 for the strains in panel A using Rpb3p antibodies (panel C), Gcn4p antibodies (panel D), or Myc antibodies (panel E). (F) ChIP analysis was conducted on PAF1-Myc strains HQY397 (gcn4 ), HQY997 (WT), and HQY998 (kin28-as), which were cultured in synthetic complete medium lacking Ile and Val and treated with NA-PP1 at 12 µM for 12 min and then with sulfometuron for 30 min. (G) The ratio percent immunoprecipitation (GCN4/gcn4 ) values for Myc-Paf1p in panel E were normalized to those for Rpb3p in panel C.
|
70%. Whereas inhibition of the kin28-as product decreased Rpb3p occupancy of these sequences by only
20% (middle panel), it decreased Myc-Paf1p binding to the TATA and 5' ORF sequences by
50%. The fact that Paf1p occupancy was not reduced as much as Ser5P occupancy may indicate that Paf1C can still associate with Pol II molecules phosphorylated on a fraction of the CTD which might persist in NA-PP1-inhibited kin28-as cells.
We obtained independent evidence that Paf1C is associated primarily with elongating Pol II phosphorylated on Ser5 by coimmunoprecipitation analysis of Pol II-Paf1C complexes in WCEs. Myc-Paf1p was immunoprecipitated with anti-Myc antibodies, and immune complexes were probed with H14 antibodies specific for Ser5P (employed above in ChIP analysis) or with 8WG16 antibodies that react primarily with hypophosphorylated Rpb1p. (Although it appears that 8WG16 antibodies recognize Rpb1p that is Ser5 phosphorylated in a subset of heptapeptide repeats of the CTD, this species has been observed only in ctk1
cells lacking Ser2P (28).) As shown in Fig. 4, a much larger proportion of hyperphosphorylated versus hypophosphorylated Rpb1p coimmunoprecipitated with Myc-Paf1p (Fig. 4A, lanes 1 and 2), suggesting that Paf1C is preferentially associated with Ser5P. The association of Myc-Paf1p with Ser5P is specific, because it was nearly abolished by deletion of the Paf1C subunit Cdc73p (lanes 4 to 6).
![]() View larger version (36K): [in a new window] |
FIG. 4. Paf1p preferentially coimmunoprecipitates with Ser5-phosphorylated Pol II dependent on Cdc73p and Spt4p. (A) WCEs from PAF1-myc strains HQY389 (WT), HQY889 (cdc73 ), and HQY905 (spt4 ) were immunoprecipitated (IP) with antibodies against Myc, and immune complexes were subjected to Western analysis using antibodies against Myc, Ser5P (H14), hypophosphorylated Rpb1p (8WG16), Spt5p, and Spt4p. (B) WCEs of SPT4 strain HQY993 and SPT4-myc strain HQY994, both containing PAF1-HA, were immunoprecipitated with Myc antibodies and analyzed as in panel A except using HA antibodies to detect HA-Paf1p. I, 5% of input WCE; P, 50% of immunoprecipitated pellet; S, 5% of supernatant. (C) WCEs from SPT4-myc strains HQY987 (WT) and HQY988 (kin28-ts) were immunoprecipitated with Myc antibodies and subjected to Western analysis using antibodies against Myc, Spt5p, and Rtf1p.
|
produced a strong reduction in Paf1p occupancy (Fig. 5A and B). This defect was complemented by plasmid-borne WT SPT4 (see Fig. 5C, left panel), which also complements the known (6) 6-azauracil sensitivity of this spt4
strain (data not shown). Importantly, spt4
does not reduce the steady-state level of Myc-Paf1p (Fig. 5D), nor does it decrease the amount of Rtf1p that coimmunoprecipitates with Myc-Paf1p (Fig. 5F). Thus, Spt4p is important for recruitment of Paf1C to ARG1, not to maintain the cellular level of intact Paf1C.
![]() ![]() View larger version (99K): [in a new window] |
FIG.5. Deletion of SPT4 impairs Paf1p association with ARG1, PMA1, and PYK1 without decreasing cellular levels of Paf1C or Ser5P. (A-B) PAF1-myc strains containing the indicated deletions were subjected to ChIP analysis as described in Fig. 1, using anti-Myc antibodies. PAF1-myc gcn4 strain HQY397 was analyzed as a negative control. (C) PAF1-myc strains HQY389 (WT), HQY905 (spt4 ) containing an empty vector, and HQY905 containing SPT4 plasmid pHQ1437 (spt4 +pSPT4) were subjected to ChIP analysis as described in the legend to Fig. 1 using Myc antibodies (left panel) or Rpb3p antibodies (right panel). HQY397 was analyzed as a negative control. (D) Western analysis of WCEs from strains HQY389 (WT) and HQY905 (spt4 ) conducted as described in the legend to Fig. 3B. (E) PAF1-myc strains HQY389 (WT), HQY905 (spt4 ), and HQY397 (gcn4 ) were subjected to ChIP analysis using H14 antibodies. (F) WCEs of strains BY4741 (PAF1), HQY389 (WT), and HQY905 (spt4 ) were immunoprecipitated with Myc antibodies, and immune complexes were probed with antibodies against Myc or Rtf1p. Inp, adjacent lanes contain 1.25%, 2.5%, and 5% of input WCEs; P, 50% of pellet; S, 5% of supernatant. (G) ChIP analysis of Myc-Paf1p occupancy at the promoter and 5' ORF of PMA1 and PYK1 measured as described in the legend to Fig. 1, using Myc antibodies and strains described in the legend to panel E, except that the results were not normalized to those observed with gcn4 cells.
|
impairs Paf1C recruitment indirectly by reducing Pol II occupancy at ARG1. However, we found that spt4
did not reduce Rpb3p occupancy at any position in the ARG1 ORF (Fig. 5C, right panel). It was shown recently that spt4
decreases the processivity of elongating Pol II on a Gal4p-induced gene in vivo; however, a substantial reduction in Pol II occupancy was evident only at a distance of 8 kb from the promoter (23). Thus, a detectable decrease in Pol II occupancy in spt4
cells would not be predicted for the
1.25-kb ARG1 ORF, as we observed. We found that spt4
also does not reduce the cellular level of Ser5P (Fig. 5D) nor the amount of Ser5P associated with the ARG1 ORF (Fig. 5E), ruling out an indirect role for Spt4p in Paf1C recruitment at the level of Ser5 phosphorylation. We conclude that Spt4p is required for association of Paf1C with elongating Pol II phosphorylated at WT levels on Ser5.
We obtained evidence that Spt4p plays a general role in promoting Pol II-Paf1C interaction by showing that coimmunoprecipitation of Ser5P with Myc-Paf1p was greatly reduced by spt4
(Fig. 4A, cf. lanes 1 to 3 and 7 to 9 in second row). Spt4p is likely to function directly in linking Paf1C to elongating Pol II because Spt4p is associated with both of these factors in vivo. Thus, we found that Spt4p and its partner, Spt5p, both coimmunoprecipitated from WCEs with Myc-Paf1p in a manner reduced by disruption of Paf1C by cdc73
(Fig. 4A, lanes 4 to 6). In addition, both HA-tagged Paf1p and Ser5P coimmunoprecipitated with Myc-Spt4p (Fig. 4B). These findings agree with previous results indicating that Spt5p is physically associated in vivo with Pol II (6) and Paf1C (43). Importantly, we found that coimmunoprecipitation of Spt5p with Myc-Paf1p was impaired by spt4
(Fig. 4A, cf. lanes 1 to 3 and 7 to 9), suggesting that Spt4p enhances interaction of Spt5p with Paf1C. Finally, by ChIP experiments we found that the low-level Paf1p occupancy in the TATA region and the high-level Paf1p occupancy in the ORF at both PMA1 and PYK1 were strongly diminished by spt4
(Fig. 5G). Note that gcn4
had no effect on the Paf1p occupancy at PMA1 and PYK1 because these are not Gcn4p target genes. These results support a global role for Spt4p in Paf1C recruitment to the ORF that is not limited to activator Gcn4p or amino acid starvation conditions.
Recruitment of Spt4p to the ARG1 ORF does not require Paf1C. Our finding above that a much larger proportion of Ser5P versus unphosphorylated Rpb1p coimmunoprecipitated with Myc-Spt4p (Fig. 4B) is consistent with the idea that Spt4p is specifically associated with elongating Pol II. Supporting this interpretation, Myc-Spt4p cross-linked at higher levels to the coding region of ARG1 (both 5' and 3' ORF sequences) than to the TATA region (Fig. 6A, WT columns), as described above for Paf1p (Fig. 1C and 2A). In contrast to Paf1p, however, Spt4p maintains high-level occupancy in the region downstream of the ARG1 ORF (Fig. 6A, WT, Down1), as observed for Pol II itself (Fig. 6B). These findings fit with previous results on several other yeast genes (10). We found that recruitment of Spt4p to the ARG1 ORF is strongly impaired by deletion of the TATA box (Fig. 6A), just as observed for Pol II (Rpb3p) (Fig. 6B). In addition, Spt4p occupancy at ARG1 was reduced by kin28-ts16 (Fig. 6D) but to a much smaller degree than was Ser5P (Fig. 6C). In fact, Spt4p occupancy was reduced to the same extent observed for Pol II (Rpb3p), so that the Spt4p:Rpb3p ratio at ARG1 was virtually unchanged by inactivation of kin28-ts16 (Fig. 6E). Thus, it appears that Spt4p can interact with elongating Pol II that is hypophosphorylated on Ser5 of Rpb1p, a conclusion reached previously for Spt5p from coimmunoprecipitation experiments (19). Note that Spt4p differs from Paf1p, which showed little association with the ARG1 ORF in the kin28-ts16 mutant (Fig. 3E), suggesting that Paf1C is more highly dependent than Spt4p on Ser5 phosphorylation for association with elongating Pol II.
The ability of Spt4p, but not Paf1p, to interact with hypophosphorylated Pol II at ARG1, plus the fact that Spt4p but not Paf1p is present at high levels downstream of the ARG1 ORF, implies that Spt4p association with Pol II is independent of Paf1C. Mueller et al. reported that Spt5p occupancy in the CLN1 ORF was reduced by
50% in paf1
and rtf1
mutants (25). However, we found that Spt4p occupancy in the ARG1 ORF was unaffected by disruption of Paf1C in the rtf1
and cdc73
mutants (Fig. 6A). Thus, while strong Paf1C recruitment to the ARG1 ORF requires Kin28p and Spt4p, recruitment of Spt4p to the ARG1 ORF is independent of intact Paf1C and is reduced by impairing Kin28p only to the extent that Pol II occupancy in the ORF is diminished. The simplest explanation for our findings is that Spt4p (likely in association with Spt5p) interacts with elongating Pol II and mediates recruitment of Paf1C in a manner stimulated by CTD phosphorylation (Fig. 6F). A final piece of evidence supporting a stimulatory role for Ser5 phosphorylation in Paf1C recruitment is provided by the data in Fig. 4C showing that inactivation of kin28-ts16 eliminates coimmunoprecipitation of the Paf1C subunit Rtf1p with Myc-Spt4p without affecting interaction of Myc-Spt4p with Spt5p.
Deletion of BUR2 reduces association of Spt4p, Spt5p, and Pol II with Paf1p.
It was reported recently that deletion of BUR2, encoding the cyclin partner of cyclin-dependent protein kinase Bur1p, impaired Paf1C occupancy of the PMA1 ORF without reducing Pol II occupancy of this gene (17). We made a similar observation at the ARG1 gene, where bur2
nearly eliminated Paf1C recruitment by Gcn4p but had little impact on Pol II occupancy (Fig. 7A, compare right and left panels). Given our findings on the importance of Spt4p in Paf1C recruitment, we asked whether BUR2 deletion would reduce association of Spt4p with Paf1C. As shown in Fig. 7B, bur2
essentially eliminated coimmunoprecipitation of Ser5P with Myc-Paf1p, providing additional evidence that Bur2p is required for Paf1C recruitment by Pol II (17). Interestingly, bur2
also greatly reduced association of Spt4p with Myc-Paf1p and substantially diminished Spt5p-Paf1p interaction (Fig. 7B). Thus, Bur2p may promote Paf1C-Pol II association at least partly by enhancing interaction of Spt4p/Spt5p with Paf1C (Fig. 6F).
![]() View larger version (40K): [in a new window] |
FIG. 7. Deletion of SPT4 reduces global histone H3-K4 methylation. (A) Deletion of BUR2 impairs Paf1p association with ARG1 without affecting Pol II occupancy. PAF1-myc strains HQY389 (WT) and HQY1001 (bur2 ) were subjected to ChIP analysis as described in the legend to Fig. 1 using Myc (left panel) or Rpb3 (right panel) antibodies, with HQY397 (gcn4 ) analyzed as a negative control. (B) Bur2p promotes association of Paf1C with Spt4p, Spt5p, and Ser5-phosphorylated Pol II. WCEs from PAF1-myc strains HQY389 (WT) and HQY1001 (bur2 ) were immunoprecipitated with Myc antibodies, and immune complexes were probed with Myc antibodies, H14 antibodies, 8WG16 antibodies, and antibodies against Spt5p and Spt4p. (C) spt4 reduces H3-K4 trimethylation at ARG1. PAF1-myc strains HQY389 (WT) and HQY905 (spt4 ) were subjected to ChIP analysis as described in the legend to Fig. 1 using antibodies against H3-K4-Me3. The results were not normalized to those observed in gcn4 cells. (D) spt4 reduces H3-K4-Me3 in bulk histones. Increasing amounts of WCEs prepared from independent cultures of HQY389 (WT) and HQY905 (spt4 ) were subjected to Western analysis using antibodies against histone H3-K4-Me3, H3-K79-Me2, and total H3. (E) Densities of bands in lanes 2, 5, 8, and 11 of panel C were calculated with a scanner and NIH image software (version 1.63), and the values for H3-K4-Me3 and H3-K79-Me2 in the duplicate cultures were averaged and normalized to the corresponding averages for total H3. IP, immunoprecipitation.
|
is sufficient to reduce H3-K4-Me3 at ARG1 and many other loci. First, ChIP analysis using antibodies specific for H3-K4-Me3 revealed a significant reduction in this modification at the 5' end of ARG1 in spt4
cells (Fig. 7C). Next, we quantified the levels of H3-K4-Me3 in bulk histones by Western analysis. Interestingly, spt4
lowers the ratio of H3-K4-Me3 to total H3 by
70% but does not significantly reduce the corresponding ratio for H3-K79-Me2 (Fig. 7D and E). A selective reduction in H3-K4-Me3 was unexpected; however, Laribee et al. (17) observed a similar phenotype in bur2
cells. Our findings suggest that the reduction in Paf1C-Pol II association in spt4
cells is sufficient to reduce H3-K4-Me3 formation but not to impair dimethylation of H3-K79. |
|
|---|
eliminated detectable Paf1p occupancy without reducing Pol II occupancy at ARG1, and it greatly reduced coimmunoprecipitation of Paf1p with Ser5P without affecting the levels of Ser5 phosphorylation or Paf1C abundance. Reducing Ser5 phosphorylation by a kin28 mutation did not appear to impair association of Spt4p with elongating Pol II at ARG1, nor did the disruption of Paf1C by deleting Rtf1p or Cdc73p. These results indicate that Spt4p, probably in conjunction with Spt5p, provides a platform on elongating Pol II that enables efficient recruitment of Paf1C. We also found that inactivation of the kin28-ts16 product disrupted the association of Paf1C with Spt4p, supporting a role for Ser5 phosphorylation in stabilizing Paf1C interaction with the elongating Pol II-Spt4p/Spt5p complex (Fig. 6F). Finally, spt4
reduced the level of H3-K4 trimethylation, indicating that Spt4p enhances transcription-coupled methylation of H3-K4 by the Set1p complex. These findings reveal a new function for yeast DSIF in stimulating a Paf1C-dependent histone modification during transcription elongation. The preferential association of Paf1C with Pol II phosphorylated on Ser5 versus hypophosphorylated Pol II was unexpected considering that Paf1C was originally isolated by its association with unphosphorylated Pol II (47). Our findings do not contradict these previous results but rather suggest that Paf1C is more highly associated with elongating, hyperphosphorylated Pol II than with the hypophosphorylated enzyme unbound to chromatin or residing in PICs. Interestingly, Paf1C subunits were purified recently by their affinity for CTD repeats doubly phosphorylated on Ser5 and Ser2 (30). Thus, Paf1C may interact directly with the phosphorylated CTD or with another phospho-CTD-interacting factor, in addition to Spt4p/Spt5p.
It could be argued that the preferential association of Paf1C with Ser5-phosphorylated Pol II is inconsistent with the uniform distribution of Paf1C across the ORF observed here and elsewhere (10), given the apparent reduction in Ser5P from 5' to 3' across the ORF (13) (Fig. 3A). However, Ser5P is detected at the 3' ends of ORFs in WT cells at higher levels than in the promoters and 5' ORF sequences of kin28 mutants (13) (Fig. 3A), indicating that a certain level of Ser5 phosphorylation persists throughout the ORF. Indeed, there is evidence that the CTD phosphorylated on Ser2 is also phosphorylated on Ser5 (8). It is also uncertain whether Ser5 phosphorylation, as opposed to accessibility of the epitope recognized by the H14 antibody, diminishes across the ORF (30).
Our demonstration that Spt4p is required for efficient recruitment of Paf1C to elongating Pol II is consistent with previous results indicating genetic interactions between Spt4p/Spt5p and Paf1C subunits and the physical association of these factors in the same Pol II complexes (3, 43). Likewise, there are genetic and physical interactions linking Spt4p/Spt5p to elongating Pol II and other elongation factors (6, 19, 20, 23, 46). On the basis of such interactions, the requirement for Rtf1p and Cdc73p to tether other Paf1C subunits to chromatin, and the evidence for direct binding of Cdc73p to Pol II (39), Mueller et al. speculated recently that Paf1C-Pol II association would depend on direct Rtf1p-Spt5p and Cdc73p-Pol II interactions (25). To our knowledge, there is no evidence for direct interaction between Rtf1p and Spt5p; however, a role for Spt5p in stabilizing Paf1C-Pol II interaction would not be surprising, since Spt4p and Spt5p are associated with one another in the yeast equivalent of DSIF. In addition, we observed residual Paf1p association with Pol II and Spt5p in spt4
cells (Fig. 4A; also data not shown), consistent with a direct role for Spt5p in Paf1C recruitment. We consider it likely that Spt4p also interacts with a Paf1C subunit, a Pol II subunit, or both, although Spt4p might only facilitate interactions of Spt5p with Paf1C and Pol II. Considerable effort will be required to identify all of the contacts between Spt4p/Spt5p, Paf1C subunits, and Pol II subunits and evaluate their relative importance for optimal recruitment of Paf1C to elongating Pol II in vivo.
Do any other elongation factors make critical contributions to Paf1C recruitment? Our results in Fig. 5 eliminate this possibility for TFIIS and the THO complex and also rule out important contributions from H2B ubiquitylation by Bre1p/Rad6p, histone H3 methylation, and the activities of Chd1p and Isw1p. The essential elongation factor Spt6 interacts genetically with Paf1C subunits and, like Paf1C, can be coimmunoprecipitated with Spt5p (20, 43). While there are indications that Spt6p promotes Paf1C association with elongating Pol II, the reduced Paf1C occupancy at the GAL1,10 genes observed in an spt6 mutant might result from decreased levels of Paf1C rather than a recruitment defect. In addition, no reduction in global levels of H3-K4 trimethylation was observed in this spt6 mutant (9). There is also genetic and physical evidence (15, 43) that Paf1C interacts with the elongation factor FACT, comprised in yeast of the essential proteins Spt16p/Pob3p (42), so that Spt16p or Pob3p could also contribute to Paf1C recruitment.
Apart from our work implicating Spt4p, only the Bur1p/Bur2p kinase complex has been shown clearly to be required for Paf1C recruitment to elongating Pol II (17), a finding that we have confirmed here. It is interesting that bur1 mutants have phenotypes in common with spt4 mutants (33), given that they share a defect in Paf1C recruitment. Moreover, spt4
resembles bur2
in reducing H3-K4 trimethylation without affecting H3-K79 methylation (17). It was shown recently that Bur1p/Bur2p kinase stimulates H2B ubiquitylation by phosphorylation of Rad6p (50), consistent with the requirement for Bur1p/Bur2p in H3-K4 trimethylation. However, phosphorylation of Rad6p cannot account for the role of Bur1p/Bur2p in Paf1C recruitment, because we found that Rad6p is dispensable for WT Paf1C recruitment at ARG1. Given our finding that bur2
reduces association of Paf1p with Spt4p and Spt5p, it is possible that Bur1p/Bur2p stimulates the interaction of Paf1C with Spt4p/Spt5p as one way of promoting Paf1C-Pol II interaction (Fig. 6F).
This research was supported by the Intramural Research Program of the NICHD, NIH.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»