![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Previous Article | Next Article 
Molecular and Cellular Biology, April 2006, p. 3308-3318, Vol. 26, No. 8
0270-7306/06/$08.00+0 doi:10.1128/MCB.26.8.3308-3318.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Sandro Banfi,1
Mariastella Zannini,3
Janice L. Brissette,2 and
Caterina Missero1*
Telethon Institute of Genetics and Medicine, 80131 Napoli, Italy,1 Cutaneous Biology Research Center, Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 02129,2 Istituto di Endocrinologia ed Oncologia Sperimentale-CNR, Dipartimento di Biologia e Patologia Cellulare e Molecolare, University Federico II, 80131 Napoli, Italy3
Received 30 September 2005/ Returned for modification 4 November 2005/ Accepted 28 January 2006
 |
ABSTRACT |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
INTRODUCTION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The p63 gene encodes a tetrameric transcription factor that is expressed as at least six isoforms, driven by two independent promoters and with widely different transactivation potentials (2, 29, 40). The first promoter, located upstream from exon 1, drives the expression of transcripts encoding proteins that have an amino-terminal transactivation (TA) domain similar to the TA domain of p53. The other promoter, located more than 30 kb downstream from the first starting site, gives rise to N-terminally truncated (
N) products that lack the TA domain. Both TA and N isoforms contain a common transactivation domain, rendering the N isoforms also capable of some transactivation activity (8, 10, 39).
Alternative splicing gives rise to three different carboxyl termini designated 
, ß, and 
. Whereas the p63 isoforms are transcriptionally the most active, at least in vitro, the p63 isoforms contain a longer carboxy-terminal region that includes a protein-protein interaction domain (SAM domain), which is mutated in the Hay-Wells syndrome (24), and a transcription inhibitory domain (TID) that is responsible for dominant negative function toward transactivation by p53 and p63 (32, 40). Np63 is the most abundant isoform class in mature proliferating epithelia such as the skin (17, 30, 40).
Given its selective expression and crucial role in stratified epithelia, understanding of the molecular mechanisms underlying the specific expression of p63 is crucial to unravel the molecular pathways controlling the specification and maintenance of these tissues. A 10-kb human genomic fragment upstream from the Np63 transcription start site is insufficient to mimic endogenous Np63 expression in mammary epithelial cells (11), suggesting that epithelial cell-specific elements may reside elsewhere in the genome.
With the completion of genomic sequences from several vertebrate species, a number of strongly conserved genomic regions can be identified as candidate cis-acting regulatory elements (6). To identify such elements, we performed a functional analysis of evolutionarily conserved sequences located in the p63 genomic region. We isolated a robust keratinocyte-specific enhancer located in intron 5 that recapitulates p63 expression during embryonic development in transgenic mice. The enhancer sequence is evolutionarily conserved in vertebrates from humans to fish and contains a highly conserved binding site for the p63 protein that is essential for its function. p63 associates with the enhancer both in primary keratinocytes and in skin. Reduced p63 expression in primary keratinocytes results in suppression of the enhancer activity, suggesting that p63 regulates its own expression. In addition, we provide strong evidence that a complex balance among transactivating and dominant negative p63 isoforms controls endogenous p63 expression, thus establishing an autoregulatory feedback mechanism. Lastly, we found that the transcription factor AP-2 binds to the enhancer and cooperates with p63 to stimulate enhancer activity.
|
MATERIALS AND METHODS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(40), FLAG-Np63, FLAG-Np63, and FLAG-Np63R304Q, under the control of the cytomegalovirus promoter; shp63 and shp53 (5); and pCMV-Renilla or TK-Renilla (20 ng; Promega). Primary keratinocytes were transfected with stealth small interfering RNA (siRNA) (Invitrogen) using Lipofectamine 2000, following the manufacturer's protocol. Luciferase activity was determined 48 h after transfection with the dual-luciferase reporter assay kit (Promega). Renilla luciferase activity was used to normalize transfection efficiency. Identification and cloning of conserved noncoding elements. Identification of conserved noncoding elements was performed with the Multi LAGAN program (http://lagan.stanford.edu) using NCBI Build 33 for the mouse genome, NCBI Build 35 for the human genome, the February 2004 chicken draft assembly produced by the Genome Sequencing Center at Washington University (St. Louis, Mo.), and the whole-genome shotgun assembly for Fugu rubripes (v.3.0; August 2002). The mouse trp63 genome region from kb –100 to +10 was the reference sequence. The parameters used selected contiguous segments of 100 bp that have a minimum of 75% identity between the mouse and human genomes. Genomic regions had a PhastCons score equal to or above 60, taking into account the lowest score among the exons (exon 9 had a score of 64). Each conserved element was amplified from mouse genomic DNA using oligonucleotide primers designed just outside the conserved region (see Table S1 in the supplemental material), and the sequence was verified and cloned in the TK minimal promoter-Luc vector (28).
Generation of transgenic mice and ß-galactosidase staining. Four copies of the C40 enhancer were subcloned in tandem in the modified ß-globin-lacZ vector p1229 (42). The resulting construct was tested for ß-galactosidase activity by transient transfection in mouse primary keratinocytes. To generate transgenic mice, the construct was linearized, purified, and injected into fertilized oocytes of DBA x C57BL/6 mice at the CBRC Transgenic Facility (Massachusetts General Hospital, Boston, MA). Integration of the transgene was confirmed by PCR as previously described (21). Founders were backcrossed with C57BL/6 mice to establish lines. Mice were housed and treated according to the guidelines of the local Institutional Animal Care and Use Committee. ß-Galactosidase staining was performed as described elsewhere (21).
Constructs and analysis of transcription factor binding site.
The Np63 and - expression vectors were obtained by amplifying the coding sequences that lacked the ATG from keratinocyte cDNA and cloning in frame in pCMVFLAG2 (Sigma). The constructs were sequence verified and tested for their expression and transactivating properties. The Np63 R304Q mutant was obtained by site-directed mutagenesis (see the supplemental material). The Np63 promoter (4.4 kb from the start codon) was amplified from genomic DNA and cloned in pGL3-basic Luc. A 2.2-kb promoter region was obtained by deletion using the restriction enzyme SacI. Expression vector short hairpin RNAs (shRNAs) for p63 were generated by insertion in the pSUPER vector (5) of double-stranded oligonucleotides containing the specific target sequence (see the supplemental material for oligonucleotide sequences). Analysis of transcription factor binding sites was performed using a combination of MatInspector (GenomatixSuite 3.1.0) (31), TRANSFAC (TRANSFAC Professional 8.2) (16), and the binding factor identification algorithm (A. Ambesi and D. Di Bernardo, unpublished results), a novel algorithm that takes account of conservation among species.
Immunoblotting analysis.
For induction of the endogenous p63 gene, HeLa cells were transfected with 2 µg expression vectors carrying p53, Np63, Np63, Np63R304Q, or an empty vector as the control, in the presence of Lipofectamine 2000 (Invitrogen). For RNA interference experiments, HeLa cells were cotransfected with 0.2 µg of pCMV-Np63 or pcDNA3myc-TAp63 and 2 µg of empty pSUPER vector, pSUPER p53, or various pSUPER p63 constructs; 20 µg of protein lysates was run on a 10% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) gel and transferred on an Immobilon-P transfer membrane (Millipore). The membrane was probed with anti-p63 monoclonal antibodies (4A4; Santa Cruz Biotechnology) and with anti-ERK antibodies (Santa Cruz Biotechnology) or with antitubulin antibodies (Santa Cruz Biotechnology) as loading controls.
Real-time RT-PCR. Forty-eight hours after transfection, RNA was extracted using TRIzol reagent (Invitrogen) and treated with RNase-free DNase I (Promega). cDNA was synthesized using Superscript II (Invitrogen) and random primers. Two-step real-time reverse transcription (RT)-PCR was performed using the SYBR Green PCR core kit (Applied Biosystems). Expression of the exogenous and endogenous p63 transcripts, as well as glyceraldehyde-3-phosphate dehydrogenase and green fluorescent protein, was quantified. pCMV-GFP (0.1 µg) was cotransfected to normalize for transfection efficiency. Oligonucleotide sequences are given in the supplemental material.
Chromatin immunoprecipitation. Approximately 3 x 106 mouse keratinocytes or dermal fibroblasts were fixed with 1% formaldehyde in growth medium at 37°C for 10 min. For chromatin immunoprecipitation in vivo, total skin was isolated from 1-day-old CD1 mice and fixed immediately with 1% formaldehyde for 20 min at room temperature. Tissue disaggregation was obtained by chopping tissue into small pieces and by using a Dounce homogenizer. Extracts were extensively sonicated on ice to obtain DNA fragments ranging from 400 to 800 bp in length. Chromatin was immunoprecipitated as in the Upstate protocol (http://www.upstate.com). Immunoprecipitation was performed using anti-p63 (H-137; Santa Cruz Biotechnology), anti-p53 (Ab-7; Oncogene Research Products), and anti-ERK-1 (K23; Santa Cruz Biotechnology) antibodies. Real-time PCR was performed using the SYBR Green PCR master mix in an ABI PRISM 7000 (Applied Biosystems). Oligonucleotide sequences are given in the supplemental material.
Electrophoretic mobility shift assays.
Total protein extracts were obtained from HEK293 cells 48 h after transfection with pcDNA3.1 AP-2 (25) or with an unrelated control, by centrifugation in 40 mM Tris (pH 7.5), 1 mM EDTA, and 150 mM NaCl. The cell pellets were then lysed in a buffer containing 10 mM HEPES (pH 7.9), 400 mM NaCl, 0.1 mM EGTA (pH 7.8), 5% glycerol, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride and centrifuged for 30 min at 4°C (12,000 x g). The protein concentration was determined using the Bio-Rad DC protein assay (Bio-Rad). The double-stranded oligonucleotide (CCCCATGGCCTGCAGCGTTTACGTAGAAATTGGGGATG) was labeled with -32P-labeled ATP and T4 polynucleotide kinase and used as the probe. The binding reactions were carried out in 10 mM HEPES (pH 7.9), 10% glycerol, 0.1 mM EDTA, 8 mM MgCl2, 1 mM dithiothreitol, and 0.15 µg/ml of poly(dI-dC) for 30 min at room temperature. DNA-protein complexes were resolved on a 6% nondenaturing polyacrylamide gel and visualized by autoradiography. For DNA competition experiments, unlabeled double-stranded oligonucleotide was added 10 min before the probe. As unlabeled competitor, the following oligonucleotide primer was used: CCCCATGCGTTGCAGCGTTTACGTAGAAATTGGGGATG.
|
RESULTS |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
N isoforms (Fig. 1A). Neither promoters nor nearby conserved sequences (Table 1) were sufficient to confer keratinocyte-specific expression on a luciferase reporter gene (data not shown).
|
|
To assess whether the transcription-modulatory activity of these elements was cell type specific, we tested them in several cell types. Human primary keratinocytes, which, like their murine counterparts, express high levels of endogenous p63, were compared to cells that express p63 at very low to undetectable levels (data not shown). C40 exerted a strong enhancer activity in human primary keratinocytes but was inactive in all other cell types, including primary dermal fibroblasts (Fig. 1C). In contrast, the C15 enhancer, whose activity was less robust than that of C40 in human and mouse primary keratinocytes, was also active in fibroblasts and fibrosarcoma cells, albeit less so than in keratinocytes (Fig. 1C). As in mouse primary keratinocytes, C14 acted as a strong repressor in all cell types tested (data not shown), and thus its activity was not characterized further.
C40 enhancer was also assayed in the context of the Np63 promoter, as Np63 is highly expressed in keratinocytes. Promoter activity was strongly induced by C40 independently of its orientation (Fig. 1D and data not shown). In contrast, addition of the C15 element did not further increase the promoter activity in the presence of C40. For this reason further studies were focused on the C40 element.
C40 enhancer recapitulates p63 expression in transgenic mice. We next asked whether the C40 element is active in vivo and whether its activity mimics the pattern of p63 expression occurring during embryogenesis, i.e., in the ectodermal surfaces of the limb buds, branchial arches, and epidermal appendages (26, 41).
Towards this aim, we engineered transgenic mice harboring four copies of the C40 sequence coupled to the heterologous ß-globin minimal promoter to drive a lacZ reporter gene (Fig. 2A). The construct was first tested for its enhancer activity in cell cultures and was found to possess the same specificity as the single-copy element in keratinocytes and fibroblasts (data not shown). Seven independent lines expressed the transgene in a similar pattern and showed remarkable tissue-specific lacZ expression, mostly recapitulating the expression of endogenous p63. lacZ expression was already detectable at embryonic day 8.5 (E8.5) in the branchial arches (data not shown). At E10.5, ß-galactosidase staining was restricted to the first and second branchial arches and to the apical ectodermal ridge of both the fore- and hind limbs (Fig. 2C). At E13.5, ß-galactosidase staining was still present at the tip of the developing limbs and was also detected in the mammary buds and developing whiskers (Fig. 2E), consistent with the p63 expression pattern previously reported for the endogenous gene. At E15.5, the lacZ reporter was expressed in the developing digits, in the epithelial cells of the nasal cavity, the whiskers, the external genitalia, and to a lesser extent in the skin and hair follicles throughout the body (Fig. 3B and C).
|
|
Thus, C40 contained the information required for tissue- and differentiation-specific gene expression in a pattern that markedly resembled that of the endogenous p63 gene.
p63 is required for C40 enhancer activity. Multiple alignment of the mouse C40 enhancer sequence with the DNA sequences from several vertebrate species, including Gallus gallus, Xenopus laevis, Tetraodon nigroviridis, and Fugu rubripes, revealed a remarkably high sequence identity (Fig. 4A), which further supports its role as a cis-acting element. Extensive bioinformatics analyses of the C40 enhancer revealed a number of putative sequence motifs for known transcription factors, including SMAD, AP-2 (two sites), p53, and the transcription factors of the forkhead Fox family (Fig. 4A). To evaluate whether any of these sequence motifs is involved in the enhancer activity, we mutated three base pairs of each binding core by site-directed mutagenesis and tested the mutant C40 elements versus the wild type in keratinocytes (Fig. 4B). Mutations in the p53-binding site inhibited transcription by 90%, whereas mutations in the AP-2(B) binding site partially impaired the enhancer activity.
|
Since p63 can bind to the p53 binding site (3, 13, 29, 40), we evaluated whether p63 rather than p53 regulates C40 enhancer activity. In fibroblasts, expression of TAp63 induced the C40-TK-Luc construct more efficiently than p53 (30-fold) (data not shown). Importantly, while p53 expression did not induce C40 activity in keratinocytes, exogenous TAp63 and Np63 isoforms strongly induced C40 activity, whereas Np63 suppressed it (Fig. 4C), consistent with their previously described roles as transactivator and dominant negative factors, respectively. Mutation of the putative p53 binding site resulted in complete suppression of TAp63-mediated activation (Fig. 4C), demonstrating that the identified p53 binding site is essential for p63 activity.
We next investigated whether p63 is required for C40 activity in keratinocytes. Because primary keratinocytes cannot be efficiently isolated from p63 null mice, we engineered pSUPER constructs expressing p63-specific short hairpin RNAs either targeted to a region in common to all isoforms (shp63) or designed to interfere specifically with TAp63 (shTAp63) or Np63 (shNp63) (Fig. 5A and B). In primary keratinocytes, shp63, but not shp53, markedly inhibited C40 enhancer activity in a dose-dependent manner, but did not affect the TK minimal promoter (Fig. 5C), demonstrating that p63 is required for C40 enhancer activity. A similar strong inhibition of C40 enhancer activity was obtained by transfecting two independent p63-specific stealth siRNAs, which were able to efficiently suppress the endogenous p63 expression at the RNA and protein levels (Fig. 5D and data not shown).
|
is a strong transactivator, it could be responsible for C40 activity, even if its expression is very low in keratinocytes. However, a TAp63-specific shRNA did not inhibit the C40 enhancer, whereas two Np63-specific shRNAs severely impaired enhancer activity (Fig. 5C). Taken together, these data suggest that in keratinocytes the C40 enhancer is controlled by p63 and, more specifically, is regulated by Np63 isoforms. p63 associates in vivo with the C40 enhancer region. To assess whether p63 plays a significant role in regulating the C40 enhancer, we tested whether p63 binds to the enhancer in intact primary keratinocytes by chromatin immunoprecipitation assays. The protein-DNA complexes were immunoprecipitated with control antibodies and antibodies specific for p63 and p53. The DNA content of immunoprecipitates was then analyzed by real-time PCR. The C40 enhancer region was more enriched in immunoprecipitates obtained with anti-p63 antibodies than with control and anti-p53 antibodies (Fig. 6A). In contrast, in dermal fibroblasts immunoprecipitation with anti-p63 antibodies resulted in no enrichment of the C40 enhancer, consistent with the fact that p63 is not expressed in these cells.
|
Selective regulation of p63 gene expression by different p63 protein isoforms.
Regulation of the C40 enhancer by p63 suggests that p63 may be able to regulate its own expression. To directly test this possibility, we expressed exogenous p53 and the various p63 isoforms in HeLa cells and measured expression of the endogenous human Np63 gene using oligonucleotides primers specific for the 5' untranslated region. HeLa cells expressed low levels of Np63 transcripts as measured by real-time RT-PCR. Np63 protein expression resulted in robust induction of the endogenous Np63 gene, whereas p53 expression was unable to significantly affect its expression (Fig. 6C), consistent with the ability of p63 proteins, but not of p53, to directly bind and control the C40 enhancer. A missense mutation affecting the DNA-binding domain of Np63 (R304Q) (35) completely abolished the ability to induce the p63 transcript. Np63 protein repressed endogenous Np63 gene expression (Fig. 6C), in agreement with the dominant negative function exerted by this protein on the C40 enhancer (Fig. 4C).
At the protein level, p63 was undetectable in HeLa cells, and expression of p53 was unable to induce p63 expression. In contrast, exogenous expression of the Np63 isoform turned on expression of the endogenous Np63 isoform, whereas the mutation in the DNA-binding domain impaired this function (Fig. 6D). Consistent with these observations, in keratinocytes overexpression of Np63, as achieved by adenovirus infection, significantly impaired endogenous gene expression (data not shown).
Taken together these data indicate that the various p63 isoforms differentially regulate expression of their own transcripts, and this autoregulatory loop is likely to occur through direct p63 binding to the C40 enhancer.
AP-2 cooperates with p63 to modulate C40 enhancer activity.
We next investigated the contribution of AP-2 to the C40 enhancer activity, since mutations in the AP-2(B) binding site affect its activity (Fig. 4B). Many epidermal promoters contain functional binding sites for the AP-2 family of transcription factors, which however are expressed not only in skin but also in a number of other cells (20, 22, 27). Overexpression of two members of the AP-2 family, and , did not significantly induce C40 activity in either fibroblasts or keratinocytes (Fig. 7A and data not shown). Interestingly however, AP-2 and - expression resulted in induction of C40 activity in the presence of either TAp63 or Np63, suggesting that AP-2 cooperates with p63 to induce enhancer activity (Fig. 7A and data not shown).
|
Thus, AP-2 binds to the enhancer both in vitro and in vivo and cooperates with p63 to induce its activity in keratinocytes.
|
DISCUSSION |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
N transcriptional start sites, respectively, provides the first example of a long-range cis-regulatory element specific for keratinocytes. Its functional significance is supported by its remarkable conservation even in lower vertebrates such as chickens, Xenopus, Fugu, and Tetraodon spp. It has recently been recognized that long-range enhancers can control the transcription of genes located as far as 1 Mb from the enhancer (18). Here we report compelling evidence that the C40 enhancer specifically controls p63 expression, as none of the other genes located within 2.2 Mb from the p63 gene in the mouse has the complicated expression pattern of p63. Remarkably, in transgenic mice during embryonic development, lacZ expression under the control of the C40 enhancer almost entirely overlaps the expression of endogenous p63 in most cells and tissues. lacZ expression was also detected in the embryonic heart, in parallel with the finding that TAp63 is expressed at the RNA level in the adult heart (40). Interestingly, in skin, even though the enhancer activity is confined to the epithelial components, C40 directs expression primarily to the hair follicle and to a lesser extent the epidermis, suggesting that other as-yet-unknown regulatory elements may contribute to the epidermis-specific expression of p63. These unknown elements may reside either in less-conserved genomic regions or in genomic regions outside of the genomic portion taken into consideration. In addition, functional elements that may be essential in vivo may be inactive in transient-transfection assays where the chromatin context is altered. These hypotheses will be the subject of future studies aimed at fully characterizing the transcriptional regulation of the p63 gene.
In addition to the specific pattern of expression elicited by the C40 enhancer during embryogenesis, we present strong evidence of a direct feedback regulation of p63 on its own gene expression through the enhancer. p63 is required for C40 enhancer activity, is sufficient to stimulate the enhancer activity in p63-expressing and -nonexpressing cell types, and binds to it in isolated keratinocytes as well as in skin. In addition, in cells that express very low levels of p63, expression of the Np63 isoform, but not of Np63, results in induction of Np63 endogenous gene expression. Binding to the DNA is required for Np63-mediated induction of the endogenous p63 genes, as its ability is impaired by a binding-defective Np63 mutant.
Consistent with its previously described function as dominant negative and with its activity on the enhancer, overexpression of Np63 results in inhibition of the endogenous p63 gene. Using isoform-specific shRNAs, however, we showed that Np63 positively controls the enhancer activity, suggesting either that endogenous Np63 may be required for the enhancer function or that even small amounts of Np63 in keratinocytes are sufficient to positively regulate the enhancer activity. In other contexts, such as during embryonic development, when the TAp63 transcripts are readily detectable (19; our unpublished observations), the TA isoforms may also play an important role in regulating the enhancer activity. p63 activity and function are complex, as TAp63 and, to a lesser extent, Np63 are extremely active transactivators that, similar to p53, induce apoptosis when overexpressed (40). In contrast, the highly abundant Np63 is a stable nontoxic protein that is endowed with both transcription-activating (8, 39), and -repressing (3, 38, 40) functions.
Taken together, these data suggest a model in which a fine balance between the and isoforms exists in keratinocytes in controlling p63 expression, with the isoform inducing the C40 enhancer and activating endogenous gene expression, thus bursting the isoform. In turn, the isoform may negatively control p63 expression as shown by downmodulation of the p63 gene in response to Np63 overexpression in primary keratinocytes, which is consistent with its ability to inhibit the C40 enhancer.
Two recent studies have pointed to the presence of a conserved p63-binding site in the Np63 promoter sequence (11, 37). Interestingly, we find that TAp63 expression exerts a modest inhibitory effect on the Np63 promoter, whereas Np63 has a modest stimulatory effect (D. Antonini and C. Missero, unpublished observations), possibly partially counteracting the effect of the enhancer on Np63 expression, but not on TAp63.
As p63 binds to its own enhancer and autoregulation cannot initiate expression of a gene, the initiation of p63 expression must be triggered by other means. p63 expression in zebra fish is mediated by bone morphogenetic protein signaling (1). In the mouse C40 enhancer, mutation of the binding site for SMAD does not affect the enhancer activity in keratinocytes, which may be due to the fact that in isolated cells p63 expression has already been initiated and that it is by itself sufficient to maintain the loop. These data raise the interesting possibility that bone morphogenetic protein signaling may also be involved in initial transcription activation of p63 in the mouse, possibly through the highly conserved SMAD site that we identified. After the first induction, p63 is required in cooperation with AP-2 to maintain its own expression by a positive autoregulatory feedback.
AP-2 participates in the control of the C40 enhancer, as a mutation in the AP-2 binding sites affects enhancer activity. In addition, AP-2 directly binds the C40 enhancer in keratinocytes and cooperates with p63 to induce enhancer activity. The relevance of AP-2 in directing skin-specific expression is widely documented, as many epidermis-specific upstream regulatory regions contain functional binding sites for AP-2 (14, 15, 20, 23, 34). Our data indicate that AP-2 may fulfill its function in skin at least in part through regulation of p63 expression.
In conclusion, identification of the mechanisms that regulate this novel keratinocyte-specific enhancer shed light on the complex regulation of p63 expression during embryonic development and in keratinocytes.
|
ACKNOWLEDGMENTS |
|---|
and - constructs. We are indebted to Jean Gilder (Scientific Communication) for text editing. T.D.P. is the recipient of an AIRC (Associazione Italiana per la Ricerca sul Cancro) fellowship. This work was supported by grants from the Italian Telethon Foundation (TCMP14TELB), from the Ministry of Instruction, University and Research (MIUR FIRB), from the European Union (LSHG-CT-2004-511990) to C.M., from AIRC to M.Z., and from the NIH (AR45284) to J.L.B. J.L.B. was also funded by the Cutaneous Biology Research Center through the Massachusetts General Hospital/Shiseido Co. Ltd. agreement.
|
FOOTNOTES |
|---|
Supplemental material for this article may be found at http://mcb.asm.org/.
Present address: Dipartimento Materno Infantile e Tecnologie Biomediche, University of Brescia, 25123 Brescia, Italy.
|
REFERENCES |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2. Bamberger, C., and H. Schmale. 2001. Identification and tissue distribution of novel KET/p63 splice variants. FEBS Lett. 501:121-126.[CrossRef][Medline]
3. Barbieri, C. E., C. A. Perez, K. N. Johnson, K. A. Ely, D. Billheimer, and J. A. Pietenpol. 2005. IGFBP-3 is a direct target of transcriptional regulation by deltaNp63alpha in squamous epithelium. Cancer Res. 65:2314-2320.
4. Brudno, M., C. B. Do, G. M. Cooper, M. F. Kim, E. Davydov, E. D. Green, A. Sidow, and S. Batzoglou. 2003. LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA. Genome Res. 13:721-731.
5. Brummelkamp, T. R., R. Bernards, and R. Agami. 2002. A system for stable expression of short interfering RNAs in mammalian cells. Science 296:550-553.
6. Dermitzakis, E. T., A. Reymond, and S. E. Antonarakis. 2005. Conserved non-genic sequences—an unexpected feature of mammalian genomes. Nat. Rev. Genet. 6:151-157.[CrossRef][Medline]
7. Dotto, G. P., R. A. Weinberg, and A. Ariza. 1988. Malignant transformation of mouse primary keratinocytes by Harvey sarcoma virus and its modulation by surrounding normal cells. Proc. Natl. Acad. Sci. USA 85:6389-6393.
8. Ellisen, L. W., K. D. Ramsayer, C. M. Johannessen, A. Yang, H. Beppu, K. Minda, J. D. Oliner, F. McKeon, and D. A. Haber. 2002. REDD1, a developmentally regulated transcriptional target of p63 and p53, links p63 to regulation of reactive oxygen species. Mol. Cell 10:995-1005.[CrossRef][Medline]
9. Frank, S. R., M. Schroeder, P. Fernandez, S. Taubert, and B. Amati. 2001. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation. Genes Dev. 15:2069-2082.
10. Ghioni, P., F. Bolognese, P. H. Duijf, H. Van Bokhoven, R. Mantovani, and L. Guerrini. 2002. Complex transcriptional effects of p63 isoforms: identification of novel activation and repression domains. Mol. Cell. Biol. 22:8659-8668.
11. Harmes, D. C., E. Bresnick, E. A. Lubin, J. K. Watson, K. E. Heim, J. C. Curtin, A. M. Suskind, J. Lamb, and J. DiRenzo. 2003. Positive and negative regulation of deltaN-p63 promoter activity by p53 and deltaN-p63-alpha contributes to differential regulation of p53 target genes. Oncogene 22:7607-7616.[CrossRef][Medline]
12. Hennings, H., D. Michael, C. Cheng, P. Steinert, K. Holbrook, and S. H. Yuspa. 1980. Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell 19:245-254.[CrossRef][Medline]
13. Ihrie, R. A., M. R. Marques, B. T. Nguyen, J. S. Horner, C. Papazoglu, R. T. Bronson, A. A. Mills, and L. D. Attardi. 2005. Perp is a p63-regulated gene essential for epithelial integrity. Cell 120:843-856.[CrossRef][Medline]
14. Jang, S. I., and P. M. Steinert. 2002. Loricrin expression in cultured human keratinocytes is controlled by a complex interplay between transcription factors of the Sp1, CREB, AP1, and AP2 families. J. Biol. Chem. 277:42268-42279.
15. Kaufman, C. K., S. Sinha, D. Bolotin, J. Fan, and E. Fuchs. 2002. Dissection of a complex enhancer element: maintenance of keratinocyte specificity but loss of differentiation specificity. Mol. Cell. Biol. 22:4293-4308.
16. Kel, A. E., E. Gossling, I. Reuter, E. Cheremushkin, O. V. Kel-Margoulis, and E. Wingender. 2003. MATCH: a tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res. 31:3576-3579.
17. King, K. E., R. M. Ponnamperuma, T. Yamashita, T. Tokino, L. A. Lee, M. F. Young, and W. C. Weinberg. 2003. DeltaNp63alpha functions as both a positive and a negative transcriptional regulator and blocks in vitro differentiation of murine keratinocytes. Oncogene 22:3635-3644.[CrossRef][Medline]
18. Kleinjan, D. A., and V. van Heyningen. 2005. Long-range control of gene expression: emerging mechanisms and disruption in disease. Am. J. Hum. Genet. 76:8-32.[CrossRef][Medline]
19. Koster, M. I., S. Kim, A. A. Mills, F. J. DeMayo, and D. R. Roop. 2004. p63 is the molecular switch for initiation of an epithelial stratification program. Genes Dev. 18:126-131.
20. Leask, A., C. Byrne, and E. Fuchs. 1991. Transcription factor AP2 and its role in epidermal-specific gene expression. Proc. Natl. Acad. Sci. USA 88:7948-7952.
21. Lee, D., D. M. Prowse, and J. L. Brissette. 1999. Association between mouse nude gene expression and the initiation of epithelial terminal differentiation. Dev. Biol. 208:362-374.[CrossRef][Medline]
22. Luo, T., M. Matsuo-Takasaki, M. L. Thomas, D. L. Weeks, and T. D. Sargent. 2002. Transcription factor AP-2 is an essential and direct regulator of epidermal development in Xenopus. Dev. Biol. 245:136-144.[CrossRef][Medline]
23. Maytin, E. V., J. C. Lin, R. Krishnamurthy, N. Batchvarova, D. Ron, P. J. Mitchell, and J. F. Habener. 1999. Keratin 10 gene expression during differentiation of mouse epidermis requires transcription factors C/EBP and AP-2. Dev. Biol. 216:164-181.[CrossRef][Medline]
24. McGrath, J. A., P. H. Duijf, V. Doetsch, A. D. Irvine, R. de Waal, K. R. Vanmolkot, V. Wessagowit, A. Kelly, D. J. Atherton, W. A. Griffiths, S. J. Orlow, A. van Haeringen, M. G. Ausems, A. Yang, F. McKeon, M. A. Bamshad, H. G. Brunner, B. C. Hamel, and H. van Bokhoven. 2001. Hay-Wells syndrome is caused by heterozygous missense mutations in the SAM domain of p63. Hum. Mol. Genet. 10:221-229.
25. McPherson, L. A., and R. J. Weigel. 1999. AP2alpha and AP2gamma: a comparison of binding site specificity and trans-activation of the estrogen receptor promoter and single site promoter constructs. Nucleic Acids Res. 27:4040-4049.
26. Mills, A. A., B. Zheng, X. J. Wang, H. Vogel, D. R. Roop, and A. Bradley. 1999. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 398:708-713.[CrossRef][Medline]
27. Mitchell, P. J., P. M. Timmons, J. M. Hebert, P. W. Rigby, and R. Tjian. 1991. Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev. 5:105-119.
28. Ohno, M., M. Zannini, O. Levy, N. Carrasco, and R. di Lauro. 1999. The paired-domain transcription factor Pax8 binds to the upstream enhancer of the rat sodium/iodide symporter gene and participates in both thyroid-specific and cyclic-AMP-dependent transcription. Mol. Cell. Biol. 19:2051-2060.
29. Osada, M., M. Ohba, C. Kawahara, C. Ishioka, R. Kanamaru, I. Katoh, Y. Ikawa, Y. Nimura, A. Nakagawara, M. Obinata, and S. Ikawa. 1998. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med. 4:839-843.[CrossRef][Medline]
30. Parsa, R., A. Yang, F. McKeon, and H. Green. 1999. Association of p63 with proliferative potential in normal and neoplastic human keratinocytes. J. Investig. Dermatol. 113:1099-1105.[CrossRef][Medline]
31. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878-4884.
32. Serber, Z., H. C. Lai, A. Yang, H. D. Ou, M. S. Sigal, A. E. Kelly, B. D. Darimont, P. H. Duijf, H. Van Bokhoven, F. McKeon, and V. Dotsch. 2002. A C-terminal inhibitory domain controls the activity of p63 by an intramolecular mechanism. Mol. Cell. Biol. 22:8601-8611.
33. Siepel, A., and D. Haussler. 2004. Phylogenetic estimation of context-dependent substitution rates by maximum likelihood. Mol. Biol. Evol. 21:468-488.
34. Sinha, S., L. Degenstein, C. Copenhaver, and E. Fuchs. 2000. Defining the regulatory factors required for epidermal gene expression. Mol. Cell. Biol. 20:2543-2555.
35. van Bokhoven, H., B. C. Hamel, M. Bamshad, E. Sangiorgi, F. Gurrieri, P. H. Duijf, K. R. Vanmolkot, E. van Beusekom, S. E. van Beersum, J. Celli, G. F. Merkx, R. Tenconi, J. P. Fryns, A. Verloes, R. A. Newbury-Ecob, A. Raas-Rotschild, F. Majewski, F. A. Beemer, A. Janecke, D. Chitayat, G. Crisponi, H. Kayserili, J. R. Yates, G. Neri, and H. G. Brunner. 2001. p63 gene mutations in EEC syndrome, limb-mammary syndrome, and isolated split hand-split foot malformation suggest a genotype-phenotype correlation. Am. J. Hum. Genet. 69:481-492.[CrossRef][Medline]
36. van Bokhoven, H., and F. McKeon. 2002. Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans. Trends Mol. Med. 8:133-139.[CrossRef][Medline]
37. Waltermann, A., N. N. Kartasheva, and M. Dobbelstein. 2003. Differential regulation of p63 and p73 expression. Oncogene 22:5686-5693.[CrossRef][Medline]
38. Westfall, M. D., D. J. Mays, J. C. Sniezek, and J. A. Pietenpol. 2003. The Np63 phosphoprotein binds the p21 and 14-3-3 sigma promoters in vivo and has transcriptional repressor activity that is reduced by Hay-Wells syndrome-derived mutations. Mol. Cell. Biol. 23:2264-2276.
39. Wu, G., S. Nomoto, M. O. Hoque, T. Dracheva, M. Osada, C. C. Lee, S. M. Dong, Z. Guo, N. Benoit, Y. Cohen, P. Rechthand, J. Califano, C. S. Moon, E. Ratovitski, J. Jen, D. Sidransky, and B. Trink. 2003. DeltaNp63alpha and TAp63alpha regulate transcription of genes with distinct biological functions in cancer and development. Cancer Res. 63:2351-2357.
40. Yang, A., M. Kaghad, Y. Wang, E. Gillett, M. D. Fleming, V. Dotsch, N. C. Andrews, D. Caput, and F. McKeon. 1998. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol. Cell 2:305-316.[CrossRef][Medline]
41. Yang, A., R. Schweitzer, D. Sun, M. Kaghad, N. Walker, R. T. Bronson, C. Tabin, A. Sharpe, D. Caput, C. Crum, and F. McKeon. 1999. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature 398:714-718.[CrossRef][Medline]
42. Yee, S. P., and P. W. Rigby. 1993. The regulation of myogenin gene expression during the embryonic development of the mouse. Genes Dev. 7:1277-1289.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
