This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rasheva, V. I.
Right arrow Articles by Frolov, M. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rasheva, V. I.
Right arrow Articles by Frolov, M. V.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, May 2006, p. 3468-3477, Vol. 26, No. 9
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.9.3468-3477.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Specific Role of the SR Protein Splicing Factor B52 in Cell Cycle Control in Drosophila

Vanya I. Rasheva, David Knight, Przemyslaw Bozko, Katherine Marsh, and Maxim V. Frolov*

Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago, Chicago, Illinois 60607

Received 23 December 2005/ Returned for modification 2 February 2006/ Accepted 6 February 2006


arrow
ABSTRACT
 
E2F and retinoblastoma tumor suppressor protein pRB are important regulators of cell proliferation; however, the regulation of these proteins in vivo is not well understood. In Drosophila there are two E2F genes, an activator, de2f1, and a repressor, de2f2. The loss of de2f1 gives rise to the G1/S block accompanied by the repression of E2F-dependent transcription. These defects can be suppressed by mutation of de2f2. In this work, we show that the de2f1 mutant phenotype is rescued by the loss of the pre-mRNA splicing factor SR protein B52. Mutations in B52 restore S phase in clones of de2f1 mutant cells and phenocopy the loss of the de2f2 function. B52 acts upstream of de2f2 and plays a specific role in regulation of de2f2 pre-mRNA splicing. In B52-deficient cells, the level of dE2F2 protein is severely reduced and the expression of dE2F2-dependent genes is deregulated. Reexpression of the intronless copy of dE2F2 in B52-deficient cells restores the dE2F2-mediated repression. These results uncover a previously unrecognized role of the splicing factor in maintaining the G1/S block in vivo by specific regulation of the dE2F2 repressor function.


arrow
INTRODUCTION
 
Many models attribute a central role in cell cycle regulation to a transcriptional factor, E2F, and retinoblastoma tumor suppressor protein (pRB) (for reviews, see references 5, 10, 16, 21, and 48). pRB is a founding member of a family of negative regulators of cell proliferation. The E2F/pRB module translates the activity of cyclin-dependent kinases (cdk) into the cell cycle transcriptional program, thus linking gene expression to the position of the cell within the cell cycle. In mammalian cells, there are eight E2f genes. E2F1 through E2F6 function as heterodimers with DP proteins, while recently discovered E2F7 and E2F8 do not require DP for their activity (31, 32). The E2F/DP heterodimer is referred to as E2F.

E2Fs are very loosely classified into two groups according to their function. E2F1, E2F2, and E2F3a are generally considered activators, whereas E2F3b, E2F4, and E2F5 have the properties of repressors. Accordingly, the combined loss of E2f-1, E2f-2, and E2f-3 in primary mouse fibroblasts results in the repression of E2F-dependent transcription and a block in cell proliferation (50). Recent microarray and chromatin immunoprecipitation studies have led to the appreciation that besides regulation of G1-to-S progression, E2F/pRB has many other diverse cellular functions, including regulation of G2/M progression, apoptosis, DNA repair, DNA recombination, and differentiation (16). There is also considerable debate over the mechanism by which pRB negatively controls cell proliferation and its tumor suppressor properties. Thus, a large number of related E2F and pRB family members in mammalian cells and recent findings that these proteins have a role beyond the G1/S control complicate study of the function and regulation of these proteins in vivo.

Drosophila melanogaster has a streamlined version of the mammalian cell cycle regulation. This is attested by the functional conservation of the basic biochemical machinery that controls cell proliferation in flies and mammals (12). In flies, there are two pRB-related genes, rbf1 and rbf2, and two E2F genes, an activator, dE2F1, and a repressor, dE2F2 (11, 17, 20, 22, 37, 42, 45). The two dE2Fs work antagonistically during development. Consistent with the function of E2F, de2f1 mutant flies are retarded in growth and show clear defects in S-phase entry and in the G1/S transcriptional program (19, 40). The loss of the repressor de2f2 does not significantly impact development and has a rather minimal effect on E2F-dependent transcription. Strikingly, many features of the de2f1 mutant phenotype, including the block to cell proliferation, are rescued by concomitant loss of de2f2 (22). There are several ways to explain this result, and at present, it is not clear precisely how de2f1 and de2f2 antagonize each other. Nevertheless, the de2f1 mutant phenotype is evidently a result of unchecked de2f2 activity and modulation of de2f2 function is able to rescue the de2f1 mutant phenotype.

There has been significant progress in recent years toward understanding of the biochemical properties of the E2F and pRB proteins and the ways they are regulated. Nevertheless, there is no agreement about the significance of these features in vivo. Apparently, our understanding of the roles of E2F and pRB and their regulation in the context of a multicellular organism lags far behind the pace of their biochemical characterization. We are particularly interested in identification of new genes that interface with the E2F/pRB module in vivo and contribute to its regulation during development. In this work, we show that the loss of a splicing factor, SR protein B52, overcomes the dE2F2-dependent block to cell proliferation in de2f1 mutant cells. In B52-deficient cells, the level of dE2F2 protein is severely reduced and endogenous dE2F2 target genes become derepressed. We show that these defects correlate with incorrect splicing of the de2f2 pre-mRNA. To our knowledge, this is the first example in which a mutation in a gene other than de2f2 is capable of rescuing the de2f1 mutant phenotype in vivo. Thus, our data establish a functional significance of B52 regulation of dE2F2 and establish a mechanistic link between splicing and cell cycle progression.


arrow
MATERIALS AND METHODS
 
Mosaic screen for suppressors of the de2f1 mutant phenotype. We carried out an FLP/FRT mosaic screen to identify new suppressors that rescue proliferation defects associated with the loss of de2f1. Since the de2f1mutant phenotype was suggested to be due to unchecked activity of repressor dE2F2 (22) suppressors of the de2f1 mutant phenotype may identify genes required for dE2F2 to restrict cell proliferation. To recover suppressors on chromosome 3R, FRT82B de2f1729/TM3 Sb males were mutagenized with ethylmethanesulfonate and then crossed either to y w eyFLP; FRT82B P[mini-w]90E l(3)cl-R31/TM6B Tb (35) (F1 screen) or first to w; TM3 Ser/MKRS and then individually to y w eyFLP; FRT82B P[mini-w]90E l(3)cl-R31/TM6B Tb (F2 screen). Following mutagenesis, clones that are double homozygous for de2f1729 and a randomly induced mutation in the eye are generated. Since clones of de2f1 mutant cells are small (less than 10 cells) (8, 34), no visible white spots marking de2f1 mutant cells can normally be seen in the eye (Fig. 1A). The lethality of wild-type homozygous cells due to the presence of l(3)cl-R31 on a wild-type chromosome causes a significant reduction in the size of the adult eye. Exceptional flies whose eyes contained large white patches, indicating that the proliferation block in de2f1729 mutant cells is somehow overridden, were retained, balanced, and retested (Fig. 1B). Approximately 18,000 mutagenized chromosomes were screened in the F1 screen and 10,000 chromosomes in the F2 screen. In each case, the presence of de2f1729 on the mutagenized chromosome was confirmed by the failure to complement another de2f1 allele, de2f17172.


Figure 1
View larger version (93K):
[in this window]
[in a new window]
 
FIG. 1. B52 mutation rescues the de2f1 mutant phenotype during eye development. (A and B) Mosaic eyes containing clones of wild-type (wt) tissue (red) and mutant tissue (white) of the following genotypes: (A) ey-FLP; FRT82B de2f1729/FRT82B P[mini-w]90E l(3)cl-R31; and (B) ey-FLP; FRT82B de2f1729 B525d21/FRT82B P[mini-w]90E l(3)cl-R31. (A) Generation of clones of de2f1729 mutant cells on the background of the l(3)cl-R31 mutation results in a small red eye with no visible de2f1729 mutant tissue (white). (B) The B525d21 allele rescues the de2f1 mutant phenotype and results in the appearance of white tissue. (C) Western blot analysis of larval extracts showing that no B52 protein is expressed from the B525d21 allele. Tub, tubulin. (D to H) Eye imaginal discs from third-instar larvae of (D) ey-FLP; FRT82B/FRT82B P[mini-w]; (E) ey-FLP; FRT82B de2f1729/FRT82B P[mini-w]; (F) ey-FLP; FRT82B de2f1729 B525d21/FRT82B P[mini-w]; (G) ey-FLP; FRT42D dDPa3/FRT42D P[mini-w]; and (H) ey-FLP; FRT82B B525d21/FRT82B P[mini-w]. Mutant tissue fails to show a GFP signal.

For further study, we chose a complementation group represented by two strong alleles, 5d21 and 7d7. To map the position of the isolated mutation, we crossed the 5d21 line to a set of deficiencies from the Bloomington deficiency kit and from the Exelixis deletion collection (38). We found that 5d21 fails to complement the lethality of the Df(3R)Exel6169 deficiency from the Exelixis collection, which deletes a cytological interval, 87F2-10. We have tested several mutations in genes uncovered by the deficiency and found that 5d21 fails to complement a known B52 mutant allele, B52s2249. The B527d7 allele was identified as a B52 mutant allele based upon its failure to complement the B525d21, Df(3R)Exel6169, and B52s2249 alleles. To prove that the loss of B52 rescues the de2f1 mutant phenotype, we generated an FRT-containing chromosome carrying de2f1729 and the publicly available B52 allele B52s2249. Following induction of FLP, clearly visible clones of de2f1729 B52s2249 double mutant cells are found in the eye, indicating that the loss of B52 allows de2f1-deficient cells to proliferate.

The FRT82B B525d21 de2f1+ chromosome was generated from the FRT82B B525d21 de2f1729 chromosome by precise excision of the P element from de2f1 gene in the de2f1729 allele.

To select B525d21 homozygous mutant larvae for Western blot analysis, the B52 mutant chromosome was balanced over the TM6B balancer containing the actin-green fluorescent protein (Act-GFP) transgene. The homozygous mutants were identified by the absence of a GFP signal under a dissecting microscope.

Manipulations with SL2 cells. RNA interference (RNAi) in SL2 cells was carried out using double-stranded RNA (dsRNA) as described previously (44), except that cells were retreated with dsRNA after 2 days. T7-tailed primers specific for targeted RNAs were designed to amplify an 800-bp fragment. The PCR product was then used to synthesize an RNA with the Ribomax-T7 RNA transcription kit (Promega). After precipitation, two strands of RNA were annealed overnight into dsRNA. The efficiency of protein depletion was monitored by Western blot analysis.

For transfections, the Flag-tagged B52 open reading frame was cloned into vector pIE4 (Novagen) under the control of the baculovirus ie1 promoter, the construct was verified by sequencing, and the expression of the protein was verified by Western blot analysis using a mouse anti-Flag antibody (Sigma). The E2F reporter construct p5'-168DPCNAluc, the ß-galactosidase-expressing construct pIE4-lacZ, the dE2F1-expressing construct pIE-dE2F1, and the dE2F2-expressing construct pIE-dE2F2 were described previously (22, 42).

Transient transfections in Drosophila SL2 cells were performed using CellFectin reagent (Invitrogen) according to the manufacturer's recommendations with 10 µg of plasmid DNA. For Western blot analysis, 5 x 106 to 10 x 106 cells were lysed in 250 µl of 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA, and 0.25% NP-40, pH 7.8, buffer and frozen for 5 min at –80°C. After spinning, the protein concentration was determined by the Bradford assay (Bio-Rad). Proteins were resolved by electrophoresis on sodium dodecyl sulfate-10% polyacrylamide. The following antibodies were used for a subsequent Western blot analysis: rabbit polyclonal anti-B52 (13), DX-3 mouse monoclonal anti-RBF1 (17), Yun-3 anti-dDP (18), guinea pig polyclonal anti-dE2F1 (7), and rabbit polyclonal anti-dE2F2 (22).

For quantitative real-time PCR, RNA was isolated from SL2 cells using Trizol and treated for 1 hour at 37°C with RNase-free DNase RQ1 (Promega). The RQ1 was then removed by purification with the RNAeasy kit (QIAGEN); 1 µg of total RNA was used to synthesize a cDNA with the iScript cDNA synthesis kit (Bio-Rad). One-fiftieth of the cDNA synthesis reaction and primer sets was mixed with 2x iQ SYBR green supermix (Bio-Rad). Real-time PCR was performed using a MyIQ PCR machine (Bio-Rad). Primers for real-time PCR were designed using Beacon Designer 4.0 software. To control for the presence of genomic DNA in the reaction, the control PCR was carried out using equivalent amounts of RNA instead of cDNA as a template. Several repeats of the reverse transcription (RT)-PCR assays using multiple RNA preparation of independent RNAi treatments produced the same results.

The following primers were used for real-time PCR: de2f1, TCGCCTTTGTGTCCATCAATCC and CATAGGCATCCGAACCGAAGTC; de2f2, ACTATCACCGTCTGGACAC and AAGTTTCATCTCATCTTTCATCC; dDP, GGACACGGATGCGGATGG and GTGCGGCTCCTGACTAACC; Arp53D, CCTTGGCATAGTTCATTGACACATAGCAG and GGGCGTTACAATGGGCACCTCT; PCNA, GCCGGTGACGCTGACATTTG and TACTCGACTACCAGCGGAACATCT; ß-tubulin, ACATCCCGCCCCGTGGTC and AGAAAGCCTTGCGCCTGAACATAG; and CG17142, AGGGTCCAGCTCTGCGTCATC and CAACCCCAATATCGTGCCCATCA.

The following primers were used for RT-PCR to detect splicing products of the de2f2 mRNA: primer pair A, CACGTGATGATCTGCTGGACATC and AGGATTCAGCTGCAGCAGC, and primer pair B, CTCGTGAAGGCCAACGAAGG and TCGTATATTCGGCGCTTCTGTACG.

Immunofluorescence. Bromodeoxyuridine labeling of eye imaginal discs was performed as previously described using DNase instead of HCl to preserve the GFP signal (46). For immunostaining, mouse monoclonal anti-cyclin B (Developmental Studies Hybridoma Bank) and anti-phosphorylated histone H3 (Upstate) antibodies were used. Images were collected on a Zeiss LSM510 confocal microscope.


arrow
RESULTS
 
Loss of B52 restores S phase in de2f1 mutant cells. It has been suggested that the hallmarks of the de2f1 mutant phenotype, such as block of S-phase entry and repression of E2F targets, are the consequences of uncontrolled dE2F2/RBF activity (22). Thus, genes that are critical for dE2F2/RBF function can be potentially identified as suppressors of the de2f1 mutant phenotype. We employed an FLP/FRT screening technique to isolate recessive mutations that rescue proliferation in clones of de2f1 mutant cells. As described in Materials and Methods, from our screen on 3R we have identified two alleles of the B52 gene, B525d21 and B527d7 (Fig. 1A and B).

We sequenced a B52 open reading frame from the B525d21 mutant chromosome and found that it contains a point mutation that converts a starting AUG into AUA. In agreement with this, no B52 protein is detected by Western blot analysis in extracts prepared from whole B525d21 mutant larvae (Fig. 1C). To unambiguously prove that the B52 mutation is responsible for the suppression, we found that a known B52 allele, B52s2249, also rescues the de2f1 mutant phenotype (data not shown). Taken together, these results strongly argue that the B52 gene encodes a genuine suppressor of the de2f1 mutant phenotype.

Next, we examined clones of B525d21 de2f1729 double mutant cells in the eye imaginal discs dissected from third-instar larvae. Mutant tissue was distinguished from wild-type tissue by the absence of GFP signal (Fig. 1D). As expected, clones of de2f1729 mutant cells are tiny and the eye disc consists entirely of wild-type cells (Fig. 1E). However, numerous clones of B525d21 de2f1729 double mutant cells are clearly recognizable in the eye disc (Fig. 1F).

We compared the eyes bearing clones of B525d21 de2f1729 (Fig. 1F) double mutant cells to clones of dDP (Fig. 1G) mutant cells. dDP is a heterodimeric partner of E2F and removing dDP impairs E2F function as efficiently as targeting dE2F1 and dE2F2 (23). Thus, clones of dDP mutant cells are essentially identical to clones of de2f1 de2f2 double mutant cells. Since the overall amount of B525d21 de2f1729 mutant tissue roughly equals the amount of dDP mutant tissue (compare Fig. 1F and G), this indicates that the loss of B52 might have a strong impact on dE2F2 function. Although this cannot be used as an accurate measurement of cell proliferation, it gives a rough estimation of the strength of a suppressor mutation.

We generated clones of B52 mutant cells on the background of the wild-type de2f1 allele. Our concern was that the loss of B52 may cause tissue overgrowth and "compensate" for the loss of dE2F1 instead of affecting the function of the dE2F2 repressor complex. Following clone induction, we did not find any evidence of overrepresentation of the B525d21 de2f1+ homozygous mutant tissue compared to wild-type tissue (Fig. 1H). A similar result was obtained using the B52s2249 mutant allele (data not shown). We inferred that the rescue by B52 mutation of the de2f1 mutant phenotype is not due to tissue overgrowth.

To further characterize B52 de2f1 double mutant cells, the pattern of S phases was visualized by bromodeoxyuridine labeling of the eye discs following clone induction. The cell cycles in the eye imaginal discs is developmentally regulated. In wild-type cells of the imaginal disc, the morphogenetic furrow separates the cells asynchronously cycling in the anterior part of the disc from the cells synchronously entering the last S phase that is called the second mitotic wave (Fig. 2A). Such synchrony is achieved by imposing a G1 arrest in the morphogenetic furrow. After the second mitotic wave, cells permanently exit the cell cycle and commit to a differentiation program. S phases occur normally in clones of the B525d21 de2f1729 double mutant (Fig. 2A and B) and B525d21 single mutant cells (Fig. 2D and E). The double mutant cells show correct timing for entering and exiting the second mitotic wave. Importantly, no additional bromodeoxyuridine labeling occurs after the second mitotic wave or within the morphogenetic furrow. Thus, the loss of B52 does not interfere with the onset of differentiation, permanent cell cycle exit, or cell quiescence. It appears that the loss of B52 is capable of relieving the S-phase block in de2f1 mutant cells exactly when the cells are normally scheduled to initiate replication.


Figure 2
View larger version (119K):
[in this window]
[in a new window]
 
FIG. 2. Loss of B52 rescues S phases in clones of de2f1 mutant cells. Clones of the de2f1729 B525d21 double mutant (A to C and G) or B525d21 mutant (D to F and H) cells were induced with ey-FLP and eye imaginal discs were labeled with bromodeoxyuridine to visualize cells in S phase (A and B and D and E) or stained with anti-cyclin B antibody (C to F) and anti-phosphorylated histone H3 antibody (G and H) to follow G2 and mitosis. Wild-type cells show the GFP signal. (A and B) de2f1729 B525d21 and (D and E) B525d21 mutant cells enter and exit S phase at the same time as wild-type cells. Merged images of S phases and GFP signals are shown (B and E). (C and F) Cyclin B staining is normal in mutant cells. (G and H) The number of phosphorylated histone H3-positive cells is reduced in de2f1729 B525d21 double mutant cells (G) but not in B525d21 mutant cells (H).

We used anti-cyclin B and anti-phosphorylated histone H3 antibodies to visualize cells in G2 phase and mitosis, respectively. In mutant cells, cyclin B is expressed normally, with no delay or premature appearance of the signal or changes in the level of expression compared to adjacent wild-type cells (Fig. 2C and F). Thus, mutant cells progress through the S and G2 phases of the cell cycle without any obvious defects. However, mitoses appear abnormal in B525d21 de2f1729 double mutant cells in the second mitotic wave. By examining a large number of discs, we noticed that the number of phosphorylated histone H3-positive cells within the mutant clones is generally lower than in neighboring wild-type tissue (Fig. 2G). This is not due to delayed entry into mitosis since there were no ectopic mitoses posterior to the furrow. Furthermore, the mitotic defect does not appear in B52 single mutant cells (Fig. 2H), suggesting that it is not simply the result of inactivation of B52 but rather is due to incomplete rescue of a proliferative defect in de2f1 mutant cells. A reduction in the number of mitotic cells has been previously described in dDP mutant cells (23).

B52 is required for dE2F2-mediated repression. Since multiple B52 mutant alleles restore proliferation in de2f1-deficient cells, we concluded that B52 is a genuine modifier of the de2f1 mutant phenotype. To gain insights into the mechanism of the B52 rescue, we employed RNA interference in Drosophila SL2 tissue culture cells. Cells were incubated with B52 double-stranded RNA, and the level of B52 protein was determined by Western blot analysis. As a control, cells were treated in parallel with nonspecific dsRNA. Following 4 days of treatment, the level of B52 protein was severely reduced (Fig. 3A). Thus, RNAi is efficient in depleting cells of B52 protein.


Figure 3
View larger version (10K):
[in this window]
[in a new window]
 
FIG. 3. Depletion of B52 in Drosophila SL2 cells derepresses dE2F2 target genes. (A) B52 is efficiently depleted by RNAi. NS, nonspecific. (B) Real-time PCR assay of dE2F2-specific targets Arp53D and CG17142 in control (NS) treated cells, in cells depleted of dE2F2, and in cells depleted of B52 by RNAi. Fold derepression is shown. (C) Real-time PCR assay of PCNA expression. PCNA is not affected in either B52- or dE2F2-depleted cells.

Next, we tested whether dE2F2-mediated repression is compromised in B52-depleted cells. Recent microarray experiments identified a group of E2F-regulated genes (group E) that are exclusively regulated by dE2F2/RBF complexes in SL2 cells (15). These genes are strongly repressed in SL2 cells but become derepressed in cells depleted of dE2F2 or of RBF proteins by RNAi. Importantly, an activator dE2F1 does not contribute to their regulation. Thus, group E genes represent a convenient readout of dE2F2-mediated repression and can be used to follow dE2F2/RBF repressor activity. We chose the Arp53D and CG17142 genes as representatives of group E to monitor how efficiently endogenous dE2F2 represses target genes in B52-depleted cells.

The level of Arp53D and CG17142 in B52-depleted cells was quantified using a real-time PCR assay. ß-Tubulin mRNA was used as a standard since its level is not affected by depletion of either dE2Fs or B52 (15, 28). The plotted graphs represent the ratios of the abundances of the corresponding transcripts in cells treated with specific dsRNAs compared to that of control treated cells. In cells treated with dE2F2 dsRNA, Arp53D and CG17142 are strongly derepressed (Fig. 3B). Depletion of B52 resulted in the derepression of both Arp53D and CG17142 to extents similar to those seen in cells depleted of dE2F2. In contrast to group E genes, depletion of dE2F2 does not have an effect on the expression of a well-known E2F target, PCNA (Fig. 3C). In a similar way, PCNA transcripts are not deregulated in B52-treated cells. Thus, depletion of B52 in essence phenocopies the effects on E2F-dependent transcription observed in dE2F2-deficient cells.

Having established that the expression of endogenous dE2F2-specific targets is dependent on B52, we asked whether overexpression of B52 has an effect on the expression of a PCNA reporter construct in transient-transfection assays. This reporter is generally used as a readout of the dE2F2 activity (22, 24, 42, 44, 47). Flag-tagged full-length B52 cDNA was cloned into the expression vector under the control of the baculovirus promoter ie1. An increasing amount of B52 expression construct was cotransfected with the E2F reporter into SL2 cells and the level of exogenous B52 expression was followed using anti-Flag antibody (data not shown). The lacZ expression plasmid was used to normalize for transfection efficiency. B52 strongly represses the E2F reporter, and this effect can be titrated by increasing amounts of B52 expression plasmid (Fig. 4A).


Figure 4
View larger version (11K):
[in this window]
[in a new window]
 
FIG. 4. Overexpression of B52 in transient transfection represses E2F reporter in a dE2F2-dependent manner. (A) SL2 cells were cotransfected with 1 µg each of the luciferase E2F reporter construct and pIE4-lacZ internal control plasmid and with increasing amounts of pIE-B52 expression plasmid. Values for luciferase activity normalized to ß-galactosidase activity are shown. (B) We transfected 1 µg of pIE-B52 into SL2 cells treated with nonspecific dsRNA (NS) or with dE2F2 dsRNA. Exogenous B52 fails to repress the E2F reporter in dE2F2-depleted cells.

Taken together, these results suggest that B52 is required for repression of dE2F2-specific targets in two different assays. We considered two possibilities to explain this requirement. Either B52 is in the same pathway as dE2F2, or B52 acts independently of dE2F2 in a distinct pathway. Therefore we tested whether B52-mediated repression is dependent on the presence of dE2F2. Control treated cells or cells depleted of dE2F2 by RNAi were transfected with the B52 expression construct. B52 represses the PCNA reporter construct in the control experiment but fails to repress it in cells that lack dE2F2 (Fig. 4B). We concluded that B52 is dependent on dE2F2 to repress transcription and likely to act in the same pathway as dE2F2.

Depletion of B52 affects dE2F2 protein and mRNA levels. Having established that B52 requires dE2F2 to represses an E2F reporter, we asked whether B52 affects the dE2F2 level. Cells were treated with B52 dsRNA and the level of dE2F2 was monitored by Western blot analysis after 1, 2, and 4 days of incubation. As shown in Fig. 5A, B52 is efficiently depleted 1 day after treatment and the B52 protein does not reappear on day 2 or 4. Strikingly, the dE2F2 level is dramatically decreased in B52-depleted cells on day 1 and remains barely detectable on days 2 and 4. This effect is specific to dE2F2 because the dE2F1 level is not affected in B52-deficient cells (Fig. 5B). Since the B52 DNA sequence does not share any homology with dE2F2, this effect is unlikely to be due to a nonspecific targeting of dE2F2 by B52 dsRNA. To further exclude the possibility of nonspecific effects of B52 dsRNA on dE2F2 protein, we used two nonoverlapping fragments of B52 cDNA to produce dsRNA probes: one corresponds to the 5' region, B52 (1 to 400), and the other corresponds to the 3' region, B52 (400 to 800). As shown in Fig. 5C, both dsRNAs, as well as a dsRNA synthesized from a larger fragment of B52 (1 to 800), were equally efficient in depletion of B52 protein, and in each case the dE2F2 protein level was severely reduced. Importantly, similar effects were also observed in mutant animals. Early larval lethality associated with the loss of B52 efficiently precluded us from using imaginal discs of mutant animals for Western blot analysis. Instead, we chose the larval brain as a source of material since B52 was shown to be essential for splicing in this tissue (27) and the brain can be straightforwardly dissected even at early stages of larval development. Protein extracts were prepared from larval brains of early second-instar larvae of wild-type and B525d21 de2f1729 double mutant flies. In agreement with the RNAi experiments, dE2F2 protein was dramatically reduced in the mutant animals (Fig. 5D). Thus, the loss of B52 results in reduction of dE2F2 both in cells and in animals.


Figure 5
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 5. B52 protein level is reduced in the absence of dE2F2 both in vivo and in vitro. (A and B) SL2 cells were treated with B52 dsRNA and extracts were prepared 1, 2, and 4 days after the treatment. Nonspecific dsRNA (NS) was used as a control. The level of B52 was efficiently depleted by RNAi. The level of dE2F2 but not dE2F1 protein was decreased in B52-depleted cells. (C) SL2 cells were depleted of B52 with three different dsRNA probes. In each depletion the level of dE2F2 protein was decreased. The positions of the probes used to synthesize dsRNAs are shown. (D) Western blot analysis of protein extracts prepared from early second-instar larval brains of Canton S (control) and de2f1729 B525d21 (5d21) flies. (E) SL2 cells were treated with the specified dsRNAs and cell extracts were analyzed using the specified antibodies. In each panel, tubulin was used as a loading control.

In a reciprocal experiment, neither dE2F1 nor dE2F2 depletion affects the B52 protein level in SL2 cells (Fig. 5E). Although dE2F2 is decreased in B52-depleted cells, the level of RBF1 is not affected. As has been reported previously, dDP, a heterodimeric partner of dE2Fs, is decreased in cells treated with dE2F2 or dE2F1 dsRNA (23). Curiously, the level of dDP is also reduced in B52-deficient cells. Since the dDP and dE2F2 protein levels are interdependent, this could be simply the consequence of deregulation of either of them by the loss of B52. Alternatively, B52 might have an effect on both of them independently.

To determine whether the changes in dE2F2 and dDP protein levels are due to transcriptional effects, we quantified de2f2 and dDP mRNAs in B52-depleted cells by real-time PCR. No decrease in the levels of dDP and de2f1 transcripts was observed in B52-depleted cells (Fig. 6). However, de2f2 mRNA was severely reduced in B52-deficient cells as evidenced by the real-time PCR assay using a pair of primers specific for exon 4. From these experiments, we concluded that the loss of B52 leads to a reduction in the level of de2f2 mRNA and dE2F2 protein. Since dDP transcripts appear to be unaffected in B52-depleted cells and the level of dDP protein has been shown to be reduced in the absence of dE2F2 protein (23), the reduced dDP level is most likely to be a consequence of a low level of dE2F2 protein.


Figure 6
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 6. Real-time PCR analysis reveals that the steady-state level of de2f2 mRNA (E2) is decreased in B52-deficient cells. Depletion of B52 shows no effect on the steady-state level of de2f1 (E1) and dDP (DP) transcripts.

Splicing defects of de2f2 transcript in B52-deficient cells. B52 is an SR protein that has been implicated in the regulation of both constitutive and alternative splicing. de2f2 mRNA contains five exons, but no alternatively spliced transcripts were described for dE2F2. We also failed to find an alternatively spliced de2f2 mRNA by using a random amplification of cDNA ends (RACE) protocol. In addition to selection of alternative splice sites, SR proteins are known to be involved during multiple steps of constitutive splicing (25, 26). Therefore we asked whether there are splicing defects of de2f2 mRNA in B52-deficient cells.

Two sets of primers, A and B, were chosen for RT-PCR assays to amplify segments containing de2f2 exon boundaries (Fig. 7A). No RT was used to control for the presence of genomic DNA in the RNA sample. Splicing product B between exon 1 and 2 in de2f2 pre-mRNA is detected in both control treated and B52-deficient cells (Fig. 7B). However, de2f2 mRNA is not correctly spliced between exons 3 and 5 in B52-depleted cells. This product was not detected either in a multiplex PCR with both A and B sets of primers or in a PCR assay using only the primers A (Fig. 7B). This is consistent with the 15-fold reduction in the level of properly spliced de2f2 mRNA in B52-depleted cells when a pair of primers specific for exon 4 was used (Fig. 6). Since the wild-type splicing product between exons 1 and 2 is present in B52-depleted cells at an approximately normal level, we concluded that the absence of B52 affects the splicing of the de2f2 pre-mRNA rather than its stability or transcription. A reduction in properly spliced mRNA level was previously observed for several other B52 targets (6, 28).


Figure 7
View larger version (36K):
[in this window]
[in a new window]
 
FIG. 7. Splicing defects of the de2f2 pre-mRNA in B52-depleted cells as revealed by RT-PCR. (A) Exon-intron structure of de2f2 pre-mRNA. Exons are designated by solid boxes and introns are depicted by lines. The positions of the two sets of primers used for RT-PCR are shown. (B) Total RNA was isolated from cells treated with the control (nonspecific [NS]) or B52 dsRNA and subjected to RT-PCR using primer sets A and B. RT-PCR products were visualized by gel electrophoresis on an agarose gel. A negative control missing the reverse transcriptase reaction (no RT) was included.

B52 has been shown to regulate the splicing of a large number of pre-mRNAs (6, 28). Therefore, we wished to determine if defects in E2F-mediated repression arise primarily because of the de2f2 pre-mRNA splicing defects or whether incorrect splicing of other pre-mRNAs may also contribute to the defect. If the defective splicing of de2f2 mRNA is the primary cause, then reintroduction of an intronless de2f2 cDNA should be sufficient to repress the E2F reporter. If deregulation in expression of other targets contributes to the loss of dE2F2-mediated repression, then the reintroduction of intronless de2f2 cDNA is not expected to have an effect on the de2f2 ability to repress.

To distinguish between the two possibilities, we transfected de2f2 cDNA into cells depleted of B52 by RNAi or into cells treated with a nonspecific dsRNA. The ability of dE2F2 to repress was determined by measuring expression from the cotransfected E2F reporter. As shown in Fig. 8, dE2F2 represses the reporter in B52-depleted cells and the level of repression is indistinguishable from that observed in control treated cells. These data indicate that defective splicing of de2f2 mRNA is most likely to be the primary cause of the loss of E2F-mediated repression in B52-deficient cells.


Figure 8
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 8. Intronless dE2F2 represses an E2F reporter in B52-depleted cells. Cells were treated with the control (nonspecific [NS]) or B52 dsRNA. Four days after the treatment, cells were transfected with 50 ng of the pIE-dE2F2 expression construct together with 1 µg each of the luciferase E2F reporter construct and pIE4-lacZ internal control plasmid. Normalized luciferase values are shown.


arrow
DISCUSSION
 
In this work, we show that the loss of B52, an SR protein splicing factor, is sufficient to relieve the dE2F2/RBF-dependent block to cell proliferation in de2f1-deficient cells in vivo. We find that depletion of B52 in cells leads to the loss of dE2F2-mediated repression due to severe reduction in the dE2F2 protein level. This correlates with abnormal splicing of de2f2 pre-mRNA in the absence of B52. Our data not only establish the mechanistic link between a splicing factor and a critical component of cell cycle machinery, but also demonstrate the significance of this regulation in vivo.

Numerous studies on pRB and E2F have led to the identification of a large number of proteins that were proposed to be essential for pRB-induced cell cycle arrest. However, in most cases very little is known about their contribution to pRB function in vivo. Here, we used a genetic approach in Drosophila and identified the B52 gene, which is required for dE2F2/RBF to block cell proliferation in de2f1 mutant cells. Using three different B52 mutant alleles, we found that the size of clones of de2f1 B52 double mutant cells is dramatically increased in comparison to that of clones of de2f1 mutant cells.

There are two possible explanations for the increased clone size of de2f1 mutant cells in the absence of B52. One possibility is that clones of de2f1 B52 double mutant cells are defective in their ability to permanently withdraw from the cell cycle. This seems unlikely since we do not find any evidence of ectopic S phases or mitoses in B52 de2f1 double mutant cells in the eye disc. On the contrary, the patterns of cell proliferation appear to be strikingly normal in mutant cells, indicating that the mutant cells respond properly to physiological proliferative and antiproliferative signals. We further note that the timing of S phases is indistinguishable between adjacent wild-type and de2f1 B52 double mutant cells. Thus, we favor the explanation that de2f1 mutant cells progress through the G1/S block at a relatively normal rate in the absence of B52.

Interestingly, de2f1 B52 double mutant cells show mild defects in G2/M progression. This perhaps explains why clones of de2f1 B52 double mutant cells are smaller than clones generated from the wild-type parental chromosome. The phenotype of de2f1 B52 double mutant cells is strikingly similar to the phenotype of dDP mutant cells. Since the loss of dDP mimics simultaneous inactivation of de2f1 and de2f2 (23), this may indicate that de2f2 activity is severely compromised in B52-deficient cells. Such an interpretation is further supported by a strong reduction of the dE2F2 protein level in mutant animals and in cells depleted of B52 by RNAi. The reduction in protein level is accompanied by derepression of dE2F2/RBF target genes, suggesting that dE2F2 function is indeed efficiently abrogated by inactivation of B52.

We noted that de2f1 B52 double mutants die at the first- and second-instar larval stages. This is likely to be a consequence of the early larval lethality associated with the loss of B52 (39), although we cannot exclude the possibility that the B52 mutation does not rescue the de2f1 mutant phenotype in all cell types. It has previously been shown that B52 makes a different contribution to the splicing of endogenous targets in various tissues (27).

Although cell cycle progression and splicing are, at first glance, two independent processes, there is a growing body of evidence suggesting an intimate link between them. This link is best exemplified in Saccharomyces cerevisiae, in which a number of genes that were isolated in genetic screens for splicing factors (prp screens) were independently identified in cell cycle screens (cdc screens) and vice versa (2-4, 14, 41). It is unlikely that the cell cycle arrest is simply a consequence of global defects in splicing since mutations in most genes encoding splicing factors do not perturb the cell cycle. On the contrary, a limited number of mutations simultaneously affect splicing and cell cycle progression. For example, mutations in the CDC40/PRP17 gene, which encodes a pre-mRNA splicing factor involved in the second step of the splicing reaction (49), result in G2/M arrest and defects in G1-to-S progression (14). Similarly, the CDC5/Cef1 product was shown to be a component of the spliceosome that is directly implicated in splicing (1). cdc5 mutants arrest during the G2 phase of the cell cycle prior to entry into mitosis (36). These examples are not limited to yeast, since the loss of SR protein ASF/SF2 in a chicken B-cell line results in G2-phase cell cycle arrest and programmed cell death (30).

In spite of the wealth of data, the exact molecular mechanisms underlying the link between the cell cycle and splicing remain elusive. It has been suggested that specific splicing factors may be selectively required for efficient splicing of genes that directly or indirectly regulate progression through the cell cycle. This is supported by several studies in which the cell cycle defects were linked to abnormal splicing of a particular gene. For example, in cdc40 mutants, the ANC1 gene appear to be a critical target (14), although the precise role of ANC1 in cell cycle control is unclear. G2/M arrest caused by mutation in the splicing factor CDC5/Cef1 is due to inefficient splicing of an intron in the {alpha}-tubulin gene (9). Nevertheless, these studies failed to directly link a splicing factor to a known cell cycle regulator. Furthermore, although the loss of ASF/SF2 brings about G2 arrest, no significant differences in the level of any transcripts encoding known cell cycle regulators were found (29). It was suggested that the observed cell cycle arrest is likely due to activation of a DNA damage checkpoint induced by the appearance of double-strand DNA breaks upon the loss of ASF/SF2 (30).

Our data provide support for the idea of a direct connection between pre-mRNA splicing and the cell cycle. The genetic and molecular data presented here implicate the well-characterized SR protein B52 in the specific regulation of splicing of the de2f2 pre-mRNA that encodes a core component of the cell cycle machinery. B52 is a member of the serine/arginine-rich (SR) protein family of essential splicing regulators. SR proteins contain one or two conserved RNA recognition motifs and a variable arginine/serine-rich (RS) domain. SR proteins are thought to participate in several steps of the splicing reaction and function as both general and regulatory splicing factors. Their regulatory roles are attributed to diverse RNA binding specificities by RNA recognition motifs (25, 26).

A large body of work firmly establishes that B52 is a splicing factor. In vitro, B52 complements both mammalian and Drosophila splicing-deficient cytoplasmic S100 extracts (27, 33). In mutant animals, B52 is not required for global RNA processing but is rate limiting for the splicing of a subset of pre-mRNAs in certain tissues (27). In agreement with this, we find that splicing of de2f2 pre-mRNA but not de2f1 or dDP pre-mRNA is affected in B52-deficient cells. Thus, the role of B52 in splicing of the de2f2 pre-mRNA appears to be highly specific. Genetic rescue of the de2f1 mutant phenotype by mutation in the B52 gene further underscores the functional requirement for B52 in the dE2F2/RBF-dependent cell cycle block in vivo.

Recent microarray experiments identified approximately 100 alternatively spliced pre-mRNAs that are aberrantly regulated in B52-deficient tissue culture cells (6). We cannot exclude the possibility that deregulation of targets other than de2f2 in B52-depleted cells may also affect dE2F2-mediated repression. Our data do not support such an interpretation, however, since reexpression of the intronless de2f2 cDNA that is insensitive to regulation by B52 is sufficient to restore dE2F2-mediated repression in B52-deficient cells. Thus, we suggest that abnormal splicing of the de2f2 pre-mRNA is likely to be a primary cause of the loss of dE2F2-mediated repression.

Further insights into specific regulation of the de2f2 pre-mRNA splicing by B52 will likely require identification of signaling pathways that may utilize B52 to modulate the level of processed de2f2 mRNA. This may provide the cell with an alternative way to effectively inactivate the dE2F2/RBF complex in response to certain signals. It is worth noting that the cdk2-cyclin E complex was shown to phosphorylate the U2 snRNP protein SAP155 (43), exemplifying how the activity of the spliceosome can be modulated in response to the position of the cell within the cell cycle.


arrow
ACKNOWLEDGMENTS
 
We thank our colleagues in the Department of Biochemistry and Molecular Genetics at the University of Illinois at Chicago for valuable discussions. We are especially thankful to Nick Dyson, Alisa Katzen, Pradip Raychaudhuri, and Gary Ramsay for advice and help at all stages of this work. We thank Terry Orr-Weaver for the dE2F1 antibody and John Lis for generously providing the B52 antibody and fly stocks and Nicolene Sarich for technical help.

This work was supported in part by American Cancer Society Illinois Division grant 05-26 to M.V.F. M.V.F. is a Leukemia & Lymphoma Society Special Fellow.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Genetics, University of Illinois at Chicago, MBRB 2352, MC 669, 900 S. Ashland Ave., Chicago, IL 60607. Phone: (312) 413-5797. Fax: (312) 413-0353. E-mail: mfrolov{at}uic.edu. Back


arrow
REFERENCES
 
    1
  1. Ajuh, P., B. Kuster, K. Panov, J. C. Zomerdijk, M. Mann, and A. I. Lamond. 2000. Functional analysis of the human CDC5L complex and identification of its components by mass spectrometry. EMBO J. 19:6569-6581.[CrossRef][Medline]
  2. 2
  3. Ben-Yehuda, S., I. Dix, C. S. Russell, M. McGarvey, J. D. Beggs, and M. Kupiec. 2000. Genetic and physical interactions between factors involved in both cell cycle progression and pre-mRNA splicing in Saccharomyces cerevisiae. Genetics 156:1503-1517.[Abstract/Free Full Text]
  4. 3
  5. Ben-Yehuda, S., C. S. Russell, I. Dix, J. D. Beggs, and M. Kupiec. 2000. Extensive genetic interactions between PRP8 and PRP17/CDC40, two yeast genes involved in pre-mRNA splicing and cell cycle progression. Genetics 154:61-71.[Abstract/Free Full Text]
  6. 4
  7. Ben-Yehuda, S., I. Dix, C. S. Russell, S. Levy, J. D. Beggs, and M. Kupiec. 1998. Identification and functional analysis of hPRP17, the human homologue of the PRP17/CDC40 yeast gene involved in splicing and cell cycle control. RNA 4:1304-1312.[Abstract]
  8. 5
  9. Blais, A., and B. D. Dynlacht. 2004. Hitting their targets: an emerging picture of E2F and cell cycle control. Curr. Opin. Genet. Dev. 14:527-532.[CrossRef][Medline]
  10. 6
  11. Blanchette, M., R. E. Green, S. E. Brenner, and D. C. Rio. 2005. Global analysis of positive and negative pre-mRNA splicing regulators in Drosophila. Genes Dev. 19:1306-1314.[Abstract/Free Full Text]
  12. 7
  13. Bosco, G., W. Du, and T. L. Orr-Weaver. 2001. DNA replication control through interaction of E2F-RB and the origin recognition complex. Nat. Cell Biol. 3:289-295.[CrossRef][Medline]
  14. 8
  15. Brook, A., J.-E. Xie, W. Du, and N. Dyson. 1996. Requirements for dE2F function in proliferating cells and in post-mitotic differentiating cells. EMBO J. 15:3676-3683.[Medline]
  16. 9
  17. Burns, C. G., R. Ohi, S. Mehta, E. T. O'Toole, M. Winey, T. A. Clark, C. W. Sugnet, M. Ares, Jr., and K. L. Gould. 2002. Removal of a single {alpha}-tubulin gene intron suppresses cell cycle arrest phenotypes of splicing factor mutations in Saccharomyces cerevisiae. Mol. Cell. Biol. 22:801-815.[Abstract/Free Full Text]
  18. 10
  19. Cam, H., and B. D. Dynlacht. 2003. Emerging roles for E2F: beyond the G1/S transition and DNA replication. Cancer Cell 3:311-316.[CrossRef][Medline]
  20. 11
  21. Cayirlioglu, P., P. C. Bonnette, M. R. Dickson, and R. J. Duronio. 2001. Drosophila E2f2 promotes the conversion from genomic DNA replication to gene amplification in ovarian follicle cells. Development 128:5085-5098.[Medline]
  22. 12
  23. Cayirlioglu, P., and R. J. Duronio. 2001. Cell cycle: flies teach an old dogma new tricks. Curr. Biol. 11:R178-R181.[CrossRef][Medline]
  24. 13
  25. Champlin, D. T., M. Frasch, H. Saumweber, and J. T. Lis. 1991. Characterization of a Drosophila protein associated with boundaries of transcriptionally active chromatin. Genes Dev. 5:1611-1621.[Abstract/Free Full Text]
  26. 14
  27. Dahan, O., and M. Kupiec. 2004. The Saccharomyces cerevisiae gene CDC40/PRP17 controls cell cycle progression through splicing of the ANC1 gene. Nucleic Acids Res. 32:2529-2540.[Abstract/Free Full Text]
  28. 15
  29. Dimova, D., O. Stevaux, M. V. Frolov, and N. J. Dyson. 2003. Cell cycle-dependent and cell cycle-independent control of transcription by the Drosophila E2F/RB pathway. Genes Dev. 17:2308-2320.[Abstract/Free Full Text]
  30. 16
  31. Dimova, D. K., and N. J. Dyson. 2005. The E2F transcriptional network: old acquaintances with new faces. Oncogene 24:2810-2826.[CrossRef][Medline]
  32. 17
  33. Du, W., M. Vidal, J.-E. Xie, and N. Dyson. 1996. RBF, a novel RB-related gene that regulates E2F activity and interacts with cyclin E in Drosophila. Genes Dev. 10:1206-1218.[Abstract/Free Full Text]
  34. 18
  35. Du, W., J.-E. Xie, and N. Dyson. 1996. Ectopic expression of dE2F and dDP induces cell proliferation and death in the Drosophila eye. EMBO J. 15:3684-3692.[Medline]
  36. 19
  37. Duronio, R. J., P. H. O'Farrell, J.-E. Xie, A. Brook, and N. Dyson. 1995. The transcription factor E2F is required for S phase during Drosophila embryogenesis. Genes Dev. 9:1445-1455.[Abstract/Free Full Text]
  38. 20
  39. Dynlacht, B. D., A. Brook, M. S. Dembski, L. Yenush, and N. Dyson. 1994. DNA-binding and trans-activation properties of Drosophila E2F and DP proteins. Proc. Natl. Acad. Sci. USA 91:6359-6363.[Abstract/Free Full Text]
  40. 21
  41. Dyson, N. 1998. The regulation of E2F by pRB-family proteins. Genes Dev. 12:2245-2262.[Free Full Text]
  42. 22
  43. Frolov, M. V., D. S. Huen, O. Stevaux, D. Dimova, K. Balczarek-Strang, M. Elsdon, and N. J. Dyson. 2001. Functional antagonism between E2F family members. Genes Dev. 15:2146-2160.[Abstract/Free Full Text]
  44. 23
  45. Frolov, M. V., N. S. Moon, and N. J. Dyson. 2005. dDP is needed for normal cell proliferation. Mol. Cell. Biol. 25:3027-3039.[Abstract/Free Full Text]
  46. 24
  47. Frolov, M. V., O. Stevaux, N. S. Moon, D. Dimova, E. J. Kwon, E. J. Morris, and N. J. Dyson. 2003. G1 cyclin-dependent kinases are insufficient to reverse dE2F2-mediated repression. Genes Dev. 17:723-728.[Abstract/Free Full Text]
  48. 25
  49. Graveley, B. R., K. J. Hertel, and T. Maniatis. 1999. SR proteins are ‘locators’ of the RNA splicing machinery. Curr. Biol. 9:R6-R7.[Medline]
  50. 26
  51. Hertel, K. J., and B. R. Graveley. 2005. RS domains contact the pre-mRNA throughout spliceosome assembly. Trends Biochem. Sci. 30:115-118.[CrossRef][Medline]
  52. 27
  53. Hoffman, B. E., and J. T. Lis. 2000. Pre-mRNA splicing by the essential Drosophila protein B52: tissue and target specificity. Mol. Cell. Biol. 20:181-186.[Abstract/Free Full Text]
  54. 28
  55. Kim, S., H. Shi, D. K. Lee, and J. T. Lis. 2003. Specific SR protein-dependent splicing substrates identified through genomic SELEX. Nucleic Acids Res. 31:1955-1961.[Abstract/Free Full Text]
  56. 29
  57. Lemaire, R., J. Prasad, T. Kashima, J. Gustafson, J. L. Manley, and R. Lafyatis. 2002. Stability of a PKCI-1-related mRNA is controlled by the splicing factor ASF/SF2: a novel function for SR proteins. Genes Dev. 16:594-607.[Abstract/Free Full Text]
  58. 30
  59. Li, X., J. Wang, and J. L. Manley. 2005. Loss of splicing factor ASF/SF2 induces G2 cell cycle arrest and apoptosis, but inhibits internucleosomal DNA fragmentation. Genes Dev. 19:2705-2714.[Abstract/Free Full Text]
  60. 31
  61. Logan, N., A. Graham, X. Zhao, R. Fisher, B. Maiti, G. Leone, and N. B. La Thangue. 2005. E2F-8: an E2F family member with a similar organization of DNA-binding domains to E2F-7. Oncogene 24:5000-5004.[CrossRef][Medline]
  62. 32
  63. Maiti, B., J. Li, A. de Bruin, F. Gordon, C. Timmers, R. Opavsky, K. Patil, J. Tuttle, W. Cleghorn, and G. Leone. 2005. Cloning and characterization of mouse E2F8, a novel mammalian E2F family member capable of blocking cellular proliferation. J. Biol. Chem. 280:18211-18220.[Abstract/Free Full Text]
  64. 33
  65. Mayeda, A., A. M. Zahler, A. R. Krainer, and M. B. Roth. 1992. Two members of a conserved family of nuclear phosphoproteins are involved in pre-mRNA splicing. Proc. Natl. Acad. Sci. USA 89:1301-1304.[Abstract/Free Full Text]
  66. 34
  67. Neufeld, T. P., A. F. A. de la Cruz, L. A. Johnston, and B. A. Edgar. 1998. Coordination of cell growth and division by Drosophila E2F. Cell 93:1183-1193.[CrossRef][Medline]
  68. 35
  69. Newsome, T. P., B. Asling, and B. J. Dickson. 2000. Analysis of Drosophila photoreceptor axon guidance in eye-specific mosaics. Development 127:851-860.[Abstract]
  70. 36
  71. Nurse, P., P. Thuriaux, and K. Nasmyth. 1976. Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146:167-178.[CrossRef][Medline]
  72. 37
  73. Ohtani, K., and J. R. Nevins. 1994. Functional properties of a Drosophila homolog of the E2F1 gene. Mol. Cell. Biol. 14:1603-1612.[Abstract/Free Full Text]
  74. 38
  75. Parks, A. L., K. R. Cook, M. Belvin, N. A. Dompe, R. Fawcett, K. Huppert, L. R. Tan, C. G. Winter, K. P. Bogart, J. E. Deal, M. E. Deal-Herr, D. Grant, M. Marcinko, W. Y. Miyazaki, S. Robertson, K. J. Shaw, M. Tabios, V. Vysotskaia, L. Zhao, R. S. Andrade, K. A. Edgar, E. Howie, K. Killpack, B. Milash, A. Norton, D. Thao, K. Whittaker, M. A. Winner, L. Friedman, J. Margolis, M. A. Singer, C. Kopczynski, D. Curtis, T. C. Kaufman, G. D. Plowman, G. Duyk, and H. L. Francis-Lang. 2004. Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nat. Genet. 36:288-292.[CrossRef][Medline]
  76. 39
  77. Ring, H. Z., and J. T. Lis. 1994. The SR protein B52/SRp55 is essential for Drosophila development. Mol. Cell. Biol. 14:7499-7506.[Abstract/Free Full Text]
  78. 40
  79. Royzman, I., A. J. Whittaker, and T. L. Orr-Weaver. 1997. Mutations in Drosophila DP and E2F distinguish G1-S progression from an associated transcriptional program. Genes Dev. 11:1999-2011.[Abstract/Free Full Text]
  80. 41
  81. Russell, C. S., S. Ben-Yehuda, I. Dix, M. Kupiec, and J. D. Beggs. 2000. Functional analyses of interacting factors involved in both pre-mRNA splicing and cell cycle progression in Saccharomyces cerevisiae. RNA 6:1565-1572.[Abstract]
  82. 42
  83. Sawado, T., M. Yamaguchi, Y. Nishimoto, K. Ohno, K. Sakaguchi, and A. Matsukage. 1998. dE2F2, a novel E2F-family transcription factor in Drosophila melanogaster. Biochem. Biophys. Res. Commun. 251:409-415.[CrossRef][Medline]
  84. 43
  85. Seghezzi, W., K. Chua, F. Shanahan, O. Gozani, R. Reed, and E. Lees. 1998. Cyclin E associates with components of the pre-mRNA splicing machinery in mammalian cells. Mol. Cell. Biol. 18:4526-4536.[Abstract/Free Full Text]
  86. 44
  87. Stevaux, O., D. Dimova, M. V. Frolov, B. Taylor-Harding, E. Morris, and N. J. Dyson. 2002. Distinct mechanisms of E2F regulation by Drosophila RBF1 and RBF2. EMBO J. 21:4927-4937.[CrossRef][Medline]
  88. 45
  89. Stevaux, O., D. K. Dimova, J. Y. Ji, N. S. Moon, M. V. Frolov, and N. J. Dyson. 2005. Retinoblastoma family 2 is required in vivo for the tissue-specific repression of dE2F2 target genes. Cell Cycle 4:1272-1280.[Medline]
  90. 46
  91. Tapon, N., K. F. Harvey, D. W. Bell, D. C. Wahrer, T. A. Schiripo, D. A. Haber, and I. K. Hariharan. 2002. Salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human cancer cell lines. Cell 110:467-478.[CrossRef][Medline]
  92. 47
  93. Taylor-Harding, B., U. K. Binne, M. Korenjak, A. Brehm, and N. J. Dyson. 2004. p55, the Drosophila ortholog of RbAp46/RbAp48, is required for the repression of dE2F2/RBF-regulated genes. Mol. Cell. Biol. 24:9124-9136.[Abstract/Free Full Text]
  94. 48
  95. Trimarchi, J. M., and J. A. Lees. 2002. Sibling rivalry in the E2F family. Nat. Rev. Mol. Cell. Biol. 3:11-20.[CrossRef][Medline]
  96. 49
  97. Vijayraghavan, U., M. Company, and J. Abelson. 1989. Isolation and characterization of pre-mRNA splicing mutants of Saccharomyces cerevisiae. Genes Dev. 3:1206-1216.[Abstract/Free Full Text]
  98. 50
  99. Wu, L., C. Timmers, B. Maiti, H. I. Saavedra, L. Sang, G. T. Chong, F. Nuckolls, P. Giangrande, F. A. Wright, S. J. Field, M. E. Greenberg, S. Orkin, J. R. Nevins, M. L. Robinson, and G. Leone. 2001. The E2F1-3 transcription factors are essential for cellular proliferation. Nature 414:457-462.[CrossRef][Medline]


Molecular and Cellular Biology, May 2006, p. 3468-3477, Vol. 26, No. 9
0270-7306/06/$08.00+0     doi:10.1128/MCB.26.9.3468-3477.2006
Copyright © 2006, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Bjork, P., Jin, S., Zhao, J., Singh, O. P., Persson, J.-O., Hellman, U., Wieslander, L. (2009). Specific combinations of SR proteins associate with single pre-messenger RNAs in vivo and contribute different functions. JCB 184: 555-568 [Abstract] [Full Text]  
  • Hebeisen, M., Drysdale, J., Roy, R. (2008). Suppressors of the cdc-25.1(gf)-associated intestinal hyperplasia reveal important maternal roles for prp-8 and a subset of splicing factors in C. elegans. RNA 14: 2618-2633 [Abstract] [Full Text]  
  • Ambrus, A. M., Nicolay, B. N., Rasheva, V. I., Suckling, R. J., Frolov, M. V. (2007). dE2F2-Independent Rescue of Proliferation in Cells Lacking an Activator dE2F1. Mol. Cell. Biol. 27: 8561-8570 [Abstract] [Full Text]  
  • Gabut, M., Dejardin, J., Tazi, J., Soret, J. (2007). The SR Family Proteins B52 and dASF/SF2 Modulate Development of the Drosophila Visual System by Regulating Specific RNA Targets. Mol. Cell. Biol. 27: 3087-3097 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rasheva, V. I.
Right arrow Articles by Frolov, M. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rasheva, V. I.
Right arrow Articles by Frolov, M. V.