| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, June 2007, p. 4328-4339, Vol. 27, No. 12
0270-7306/07/$08.00+0 doi:10.1128/MCB.00153-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
and 3ß Mediate a Glucose-Sensitive Antiapoptotic Signaling Pathway To Stabilize Mcl-1
Department of Pharmacology and Cancer Biology,1 Sarah W. Stedman Nutrition and Metabolism Center,2 Department of Immunology, Duke University Medical Center, Durham, North Carolina 27710,4 Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis, Minnesota 554553
Received 26 January 2007/ Returned for modification 2 March 2007/ Accepted 9 March 2007
| ABSTRACT |
|---|
|
|
|---|
and 3ß (GSK-3
/ß), which otherwise promoted Mcl-1 degradation. While a number of kinases can phosphorylate and inhibit GSK-3
/ß, we provide evidence that protein kinase C may be stimulated by glucose-induced alterations in diacylglycerol levels or distribution to phosphorylate GSK-3
/ß, maintain Mcl-1 levels, and inhibit cell death. These data provide a novel nutrient-sensitive mechanism linking glucose metabolism and Bcl-2 family proteins via GSK-3 that may promote survival of cells with high rates of glucose utilization, such as growth factor-stimulated or cancerous cells. | INTRODUCTION |
|---|
|
|
|---|
In contrast to normal cells, in which glucose metabolism is regulated by growth factors (16, 53), cancer cells often both maintain enhanced glucose utilization and resist cell death even in the absence of growth factors (19, 21). An increased rate of glycolysis is an attribute of cancer cells that has been appreciated for many years (55), with tumor cells exhibiting high rates of glucose uptake and utilization but moderate rates of mitochondrial oxidation (49). More recently, the high rates of glucose uptake into cancer cells have been exploited in positron emission tomography to image many types of tumors in patients (18). Increased glycolysis can stem from tumor hypoxia (19), and a number of oncogenes (4, 10, 20, 40, 44, 52) have been shown to directly promote glucose metabolism. In addition, genes directly involved in glucose utilization, such as glucose transporter 1 (Glut1) and hexokinases 1 and 2 (HK1 and HK2), which catalyze the uptake and phosphorylation of glucose to glucose-6-phosphate, respectively, are often overexpressed in cancer cells and have been correlated with poor prognosis (50, 59). Despite ample evidence for altered glucose metabolism in cancer cells, the specific impact that this form of metabolism may have on cell fate has been obscured by the myriad of other signaling and transcriptional events that can occur in cellular transformation.
The ability to maintain glucose metabolism may play a key role in cancer cell resistance to death upon growth factor deprivation. We have shown that overexpression of Glut1 and HK1 is sufficient to delay loss of plasma membrane integrity of growth factor-withdrawn cells (44). These findings suggested the existence of a glucose-dependent signaling pathway that could delay or prevent apoptosis. While glucose-sensitive signaling to initiate insulin secretion in pancreatic beta cells is relatively well understood (22), glucose-dependent signaling pathways that may regulate apoptosis are less certain. In support of such a pathway, pretreatment of cells with high extracellular glucose concentrations or hyperglycemia has been shown to enhance de novo synthesis of diacylglycerol and promote protein kinase C (PKC) activation to protect cardiomyocytes and neurons from ischemic injury. The mechanism of this protection, however, is not clear (29, 38, 46, 57).
The Bcl-2 family of proteins includes both pro- and antiapoptotic proteins (12) and are likely candidates to mediate regulation of cell death by glucose metabolism. Some evidence has previously suggested that Bcl-2 family proteins may be sensitive to cell metabolic status because the proapoptotic Bcl-2 family member Bax can become activated upon glucose deprivation (7, 53). The mechanism linking the Bcl-2 family and glucose metabolism, however, is not certain yet likely utilizes critical regulatory Bcl-2 family proteins. In hematopoietic cells, induction and translocation to mitochondria of the proapoptotic BH3-only protein Bim have been shown to play an important role in many cell death pathways (6). The antiapoptotic Bcl-2 family protein Mcl-1 also plays a vital role in cell survival and binds Bim on mitochondria to inhibit Bim-induced activation of the proapoptotic protein Bax. Conditional gene targeting has shown that Mcl-1 is required for the survival of both B and T cells (36). Mcl-1 levels are highly regulated by proteolytic degradation, and phosphorylation of Mcl-1 by GSK-3 in cytokine-deprived cells has recently been shown to play an important role in targeting Mcl-1 for ubiquitination and degradation (31, 62).
Cellular activation or transformation leads to signaling and transcriptional as well as metabolic events that may affect Bcl-2 family members and cell death. To address how the increased glucose uptake and catabolism characteristic of activated lymphocytes or cancer cells may influence the Bcl-2 family in the absence of other signaling or transcriptional events, we have analyzed the death of cells in which only glucose uptake and metabolism are promoted. Using this approach, we describe a novel glucose-responsive antiapoptotic signaling pathway. In this pathway, enhanced glucose uptake led to inhibitory phosphorylation of GSK-3, most likely via PKC activity, to stabilize the antiapoptotic Bcl-2 family protein Mcl-1. This novel nutrient-sensing pathway may provide a critical mechanism to connect glucose utilization to the Bcl-2 family of proteins via diacylglycerol-induced activation of PKC isoforms to inhibit GSK-3 and set a threshold for apoptosis of cells with high rates of glucose metabolism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs. Bim isoforms were cloned from FL5.12 mRNA using SuperScript One-Step reverse transcription-PCR with Platinum Pfx (Invitrogen) according to the manufacturer's protocol and subcloned into pEF6 (Invitrogen). Hemagglutinin (HA)-tagged Mcl-1 (generously provided by H. J. Brady, University College, London) was cloned into pEF6. Bim and Mcl-1 shRNAi plasmids were constructed using previously described approaches (15). shRNAi sequences were as follows: Bim, GATCTGCGCCCGGAGATACGGATTCCTCGAGCAATCCGTATCTCCGGGCGCAGATC; Mcl-1, AATGGTTCGATGAAGCTTTCCCTCGAGCGAAAGCTTCATCGAACCATT (34), and GFP, GATCCGTTCAACTAGCAGACCATTCCTCGAGCAATGGTCTGCTAGTTGAACGGATC. Sequences were cloned under control of the hU6 promoter in pCR2.1 and pKD vectors as described previously (15). The GSK-3ß shRNAi construct was kindly provided by David Turner (University of Michigan) (60). EGFP-PKD-CRD and EGFP-PKD-CRD-P155/287G constructs were kindly provided by Martin Spitaler and Doreen Cantrel (University of Dundee, United Kingdom). pCMV-FLAG-ubiquitin was kindly provided by Michael Ehlers (Duke University).
Mass spectral analysis of organic acids. Intracellular organic acids were analyzed as described previously (24). Briefly, cells were washed in PBS, lysed in 0.1 M HCl, and cleared by centrifugation. A cocktail of stable-isotope internal standards was added, and lysates were then extracted in ethyl acetate, dried, and converted to methyl esters, with the addition of trimethyl silyl esters with ethoxyamine hydrochloride. Organic acids were then analyzed by capillary gas chromatography/mass spectrometry.
Cell fractionation. To isolate mitochondria, cells were washed once in PBS, resuspended in mitochondrial isolation buffer (20 mM HEPES [pH 7.5], 10 mM KCl, 5 mM MgCl2, 1 mM EDTA, 1 mM EGTA, 250 mM sucrose, protease inhibitors), and forced by syringe to pass through a 5-µm polycarbonate filter membrane. Unbroken cells and nuclei were pelleted by centrifugation at 800 x g for 10 min at 4°C. The supernatant was subjected to an additional centrifugation at 16,000 x g for 10 min at 4°C. The pellet was collected as heavy membrane and mitochondrial fractions, and the supernatant was used as the cytosolic fraction.
Clonogenic assay. Cells were withdrawn from IL-3 for 0, 12, 18, 24, and 48 h; washed; and recultured in medium containing IL-3 in 96-well plates at concentrations of 1/3, 1, or 3 cells per well. The frequency of colonies on each plate after 7 days was determined as the mean and standard error of colony number relative to cell input for each plate (n = 5).
Western blots. Cells were lysed in radioimmunoprecipitation assay buffer with protease inhibitors (BD Pharmingen) and phosphatase inhibitors (Sigma) on ice for 10 min and precleared by centrifugation. Protein concentrations were determined by bicinchoninic acid protein assay (Bio-Rad), and 25 µg of protein was subjected to 4 to 20% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (Bio-Rad). Antibodies used were rabbit anti-Bax (Cell Signaling), rabbit anti-Bim (BD Pharmingen), rabbit anti-Bcl-2 (BD Pharmingen), mouse anti-cytochrome c (BD Pharmingen), rabbit anti-Glut1 (Abcam), rabbit anti-phospho-GSK-3(Ser9/21) (Cell Signaling), rabbit anti-GSK-3ß (Cell signaling), mouse anti-phospho-Akt (Ser473), rabbit anti-Mcl-1 (Santa Cruz and Biolegend), rabbit anti-Cox IV, rabbit antiubiquitin (Santa Cruz), rat anti-HA (Roche), rabbit anti-FLAG (Sigma), and mouse antiactin (Sigma). Rabbit anti-phospho-Mcl-1(Ser159) was a kind gift of D. Green (St. Jude Children's Research Hospital, Memphis, TN) and U. Maurer (Institut für Molekulare Medizin und Zellforschung, Germany). Secondary antibodies were anti-rabbit and anti-mouse horseradish peroxidase-labeled antibodies (BD Pharmingen) and anti-rabbit infrared-labeled antibody and were detected with ECL-Plus (Amersham, Biosciences) or the Odyssey infrared imaging system (Licor). All images were uniformly contrasted, and some were digitally rearranged for ease of viewing (rearranged lanes indicated by spaces).
Immunoprecipitation. Cells were harvested and lysed in CHAPS buffer {50 mM Tris [pH 7.5], 10% glycerol, 1% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate [CHAPS], 150 mM NaCl, 1 mM EDTA, proteasome inhibitor}. Lysates were precleared, antibodies (rabbit anti-Bax [clone 6A7; BD Pharmingen], rabbit anti-Bim [BD Pharmingen], and rat anti-HA [Roche]) were added, and the mixtures were rotated at 4°C for 1 h. Anti-rabbit immunoglobulin G beads (ebioscience) or protein A/G beads (Santa Cruz) were then added to the lysates and incubated overnight. Beads were washed with 1% CHAPS buffer three times, and proteins were eluted by boiling the beads in sodium dodecyl sulfate loading buffer.
Fluorescence microscopy. To image GSK-3 phosphorylation in primary bone marrow cells, cells were cytospun, fixed on the slides in 4% paraformaldehyde, washed in PBS-0.1% Tween, and blocked with 20% normal goat serum. Slides were stained with anti-nerve growth factor receptor (NGFR)-biotin (BD Pharmingen) and anti-phospho-GSK-3 (Cell Signaling) or an isotype control, followed by anti-rabbit-Alexa 546 (Molecular Probes), antistreptavidin-FITC (BD Pharmingen), and DAPI (4',6'-diamidino-2-phenylindole). To image cells expressing GFP fusion proteins, cells were fixed with 1% paraformaldehyde in PBS and viewed with a Zeiss LSM410 confocal microscope (Zeiss, Thornwood, NY) and Metamorph software.
Glut1-transgenic mice and primary cell culture. Full-length rat Glut1 was cloned into the pLck.E2 vector, which we have used previously for T-lymphocyte-specific transgene expression (43). Transgenic animals were made in and were a generous gift of the Abramson Family Cancer Research Institute transgenic facility at the University of Pennsylvania. Mice were backcrossed five generations to C57BL6/J mice and cared for at Duke University. T cells were purified by negative selection, and glucose uptake and in vitro survival in neglect were measured as described previously (3, 43). Bone marrow cells were cultured in 5 ng/ml recombinant IL-3-containing RPMI 1640 medium. Media with IL-3 were changed every 2 days. On day 4, cells were infected in retrovirus supernatant (MSCV-Glut1-IRES-NGFR or vector control) at a concentration of 1 x 106 cells/ml for 24 h at 37°C, and they were analyzed by immunofluorescence 2 days later.
| RESULTS |
|---|
|
|
|---|
|
Commitment to cell death upon growth factor withdrawal in hematopoietic cells occurs at the point of mitochondrial disruption by Bax and Bak and release of cytochrome c into the cytosol. To identify the stage at which glucose metabolism may delay cell death commitment, Bax activation and cytochrome c release were analyzed in Glut1/HK1 cells. Control and Glut1/HK1 cells were deprived of IL-3 for 10 h, and Bax was immunoprecipitated from cell lysates by using an active Bax conformation-specific antibody (Fig. 1E). No active Bax was detectable in cells cultured in the presence of IL-3. Upon IL-3 withdrawal, activated Bax was readily observed in control cells but not in Glut1/HK1 cells. Cytosolic and mitochondrial cell fractions from control, Glut1/HK1, and Bcl-xL cells were also analyzed by immunoblotting to observe mitochondrial disruption and release of cytochrome c (Fig. 1F). Mitochondria in control cells began to lose integrity 10 h after IL-3 withdrawal, with decreased cytochrome c in the mitochondrial fractions and the appearance of cytochrome c in cytoplasmic fractions. In contrast, cytochrome c release was delayed in Glut1/HK1 cells, and cytosolic cytochrome c was readily detectable only after 12 h of IL-3 withdrawal. By this time, control cells had released the majority of the cytochrome c into the cytosol. Cells overexpressing Bcl-xL maintained mitochondrial integrity throughout the time analyzed. Caspase activation in Glut1/HK1 cells was also reduced upon IL-3 withdrawal, as precipitation of caspase 3 in Glut1/HK1 cells with biotinylated zVAD, a broad caspase inhibitor that binds to active caspases, yielded only 40% of that obtained in control cells upon IL-3 withdrawal (data not shown). These results indicate that increased glucose metabolism delayed commitment to cell death after growth factor withdrawal upstream of Bax activation and cytochrome c release.
Bim is necessary and sufficient for cytokine withdrawal-induced apoptosis, yet glucose metabolism promotes resistance to Bim toxicity. Antiapoptotic glucose signaling in Glut1/HK1 cells delayed Bax activation and cytochrome c release upon IL-3 withdrawal, suggesting regulation of the Bcl-2 family members by glucose hydrolysis. Gene-targeting studies have shown that the proapoptotic BH3-only Bcl-2 family member Bim plays a pivotal role in apoptosis of hematopoietic cells upon cytokine withdrawal (6). In FL5.12 cells, the three isoforms of Bim (BimEL, BimL, and BimS) were induced and were important for efficient apoptosis upon IL-3 withdrawal, as cells with decreased Bim expression by shRNAi partially resisted IL-3 deprivation-induced apoptosis (Fig. 2A and B). To test if glucose metabolism affected Bim induction, we cultured control, Glut1/HK1, and Bcl-xL cells in IL-3 or withdrew cells from IL-3 for 10 h. Transcriptional induction of Bim RNA was analyzed by RNase protection (Fig. 2C), and total Bim protein levels were determined by immunoblotting (Fig. 2D). All three Bim isoforms were induced at the RNA level, and BimEL and BimL were upregulated at the protein level in all three cell lines upon IL-3 withdrawal. Endogenous BimS protein was undetectable in all conditions (data not shown). For reasons that are not clear, Glut1/HK1 and Bcl-xL cells had somewhat higher levels of total cellular Bim RNA and protein induction following IL-3 deprivation. Nevertheless, apoptosis was delayed in Glut1/HK1 cells (Fig. 1C). Mitochondrial levels of Bim are critical for Bim to promote apoptosis, and increased glucose metabolism may have affected Bim translocation to mitochondria (41). To analyze Bim translocation, mitochondria were isolated from control, Glut1/HK1, and Bcl-xL cells deprived of IL-3 for the indicated times and were immunoblotted for Bim protein levels. Despite somewhat higher total Bim levels, Glut1/HK1 and Bcl-xL cells showed similar Bim translocation to mitochondria compared to control cells, (Fig. 2E). To determine if Bim protein associations were altered by Glut1/HK1 expression, Bim was immunoprecipitated from control and Glut1/HK1 cells and analyzed by immunoblotting for associations with Bcl-2 and Mcl-1 (Fig. 2F). While IL-3 withdrawal increased the amount of immunoprecipitated Bim, no differences between control and Glut1/HK1 cells were observed in Bcl-2 coimmunoprecipitation. Mcl-1 was also precipitated with Bim in both cell lines, although total Mcl-1 levels were reduced in IL-3-withdrawn control cells.
|
Increased glucose metabolism stabilizes Mcl-1 to protect cells against IL-3 withdrawal-induced apoptosis. Although RNase protection showed no differences in mRNA levels of multiple Bcl-2 family members upon IL-3 withdrawal (data not shown), mitochondrial protein levels of the antiapoptotic protein Mcl-1 were found to be affected by glucose metabolism. Mitochondria were purified from control and Glut1/HK1-expressing cells that were cultured in the presence or absence of IL-3 and analyzed for Mcl-1 and Bcl-2 expression levels (a representative gel is shown in Fig. 3A, and quantification from three similar independent experiments is shown in Fig. 3B). Mitochondrial Bcl-2 expression remained constant in the presence or absence of IL-3 and was used as a loading and normalization control. Mitochondrial Mcl-1 protein levels, in contrast, decreased in control and Bcl-xL-expressing cells upon IL-3 withdrawal. Glut1/HK1 cells, however, maintained mitochondrial Mcl-1 levels even upon IL-3 withdrawal. Notably, reduction of Mcl-1 levels in Bcl-xL-expressing cells indicated that Mcl-1 loss occurred independent of mitochondrial disruption, cytochrome c release, and caspase activity. To determine the loss of Mcl-1 over time after IL-3 withdrawal, total cellular lysates from control, Glut1/HK1, and Bcl-xL cells deprived of IL-3 for the indicated times were analyzed by immunoblotting for Mcl-1 and actin to obtain the relative ratio of cellular abundance of Mcl-1 to that of actin (Fig. 3C). In both control and Bcl-xL-expressing cells, the ratio of Mcl-1 to actin decreased over time when cells were withdrawn from IL-3. This relative loss of Mcl-1 protein was attenuated, however, in Glut1/HK1 cells.
|
Expression of Glut1 and HK1 attenuates Mcl-1 protein degradation after growth factor withdrawal. Ubiquitination and proteasomal degradation play critical roles in control of Mcl-1 levels (62). To determine the effect of Glut1/HK1 expression on the degradation of Mcl-1, we cultured control and Glut1/HK1 cells in the absence of IL-3 for 8 h, treated cells with cycloheximide to block new protein synthesis, and observed Mcl-1 degradation. In whole-cell (Fig. 4A) or mitochondrial (a representative gel is shown in Fig. 4B, and quantification from three similar independent experiments is shown in Fig. 4C) extracts, the Mcl-1 was more rapidly degraded in control cells than in Glut1/HK1 cells. To further confirm delayed Mcl-1 degradation, control and Glut1/HK1 cells expressing HA-tagged Mcl-1 were transfected with FLAG-tagged ubiquitin and withdrawn from IL-3. Immunoprecipitation of HA-Mcl-1 followed by immunoblotting for FLAG-ubiquitin showed that Mcl-1 ubiquitination was reduced in Glut1/HK1 cells (Fig. 4D). Antiapoptotic glucose signaling, therefore, appeared to inhibit growth factor withdrawal-induced apoptosis via a glucose-sensitive attenuation of Mcl-1 protein ubiquitination and degradation.
|
/ß activity is negatively regulated by phosphorylation on serines 21 and 9, respectively, total GSK-3ß and phospho-GSK-3
/ß levels were determined by immunoblotting in control and Glut1 and/or HK1 cells (Fig. 5B). Increased levels of phospho-GSK-3 occurred in multiple independently derived FL5.12 cell clones in which Glut1 and hexokinase 1 were expressed individually or together (Fig. 5B). Phosphorylation of GSK-3 appeared to be specific for GSK-3 and did not represent increased overall cellular signaling activity, as levels of phospho-Akt (serine 473) were similar in all cell lines (Fig. 5B) and comparable levels of phospho-STAT5, the STAT3 and STAT5 target Pim1, phospho-mTOR, and phospho-p70S6 kinase were observed in control and Glut1/HK1 cells (data not shown). Enhanced phosphorylation of GSK-3 was maintained upon IL-3 withdrawal and was also observed in Glut1/HK1-expressing 32D and BAF3 early hematopoietic cell lines (Fig. 5C).
|
/ß in regulation of Mcl-1 (31) to include regulation of GSK-3 by glucose metabolism. Inhibition of GSK-3 in control cells increased maintenance of Mcl-1 (Fig. 5D) and provided protection from cell death (Fig. 5E) upon growth factor deprivation to extents comparable to those observed in Glut1/HK1 cells. In addition, RNAi of GSK-3ß, leading to an approximately 50% decrease in GSK-3ß protein with unchanged GSK-3
levels, increased Mcl-1 protein levels (Fig. 5F) and attenuated cell death upon IL-3 withdrawal similarly to the case for Glut1/HK1 cells (Fig. 5G). GSK-3 phosphorylation and inhibition of Mcl-1 protein degradation, therefore, appears to represent a critical point in a nutrient-sensing pathway linking glucose metabolism to cell survival. Glut1 expression increases the phospho-GSK-3 level, protects Mcl-1, and attenuates cell death in primary hematopoietic cells. Having demonstrated increased phospho-GSK-3 levels and maintenance of Mcl-1 in Glut1/HK1-expressing bone marrow-derived myeloid and pro-B-cell lines, we next tested the ability of increased glucose uptake to regulate phospho-GSK-3 in primary bone marrow-derived hematopoietic cells. Primary murine bone marrow cells were isolated, cultured in IL-3, infected with control or Glut1-expressing retrovirus, and analyzed by immunofluorescence for phospho-GSK-3. Similar to the case for cell lines, Glut1 expression in primary bone marrow cells led to enhanced levels of phospho-GSK-3 (Fig. 6A). We also generated a transgenic mouse with expression of Glut1 specifically in T lymphocytes. Purified peripheral T cells from Glut1-transgenic mice had increased Glut1 expression (Fig. 6B) and resting glucose uptake (Fig. 6C). Importantly, freshly isolated T cells from Glut1-transgenic mice had increased levels of phospho-GSK-3 compared to T cells purified from littermate nontransgenic mice (Fig. 6D) that was partially maintained upon in vitro culture in the absence of stimulation (Fig. 6E, Neglect). In accordance with GSK-3-mediated regulation of Mcl-1 protein levels, Mcl-1 protein levels decreased when T cells were neglected in vitro (Fig. 6F). This was attenuated by inhibition of GSK-3 or by expression of the Glut1 transgene (Fig. 6F and G). In addition, Glut1-transgenic T cells showed increased resistance to cell death when cultured in vitro in the absence of growth factor or cytokine stimulation (Fig. 6H). Increased phospho-GSK-3, protection of Mcl-1, and resistance to growth factor withdrawal-induced cell death, therefore, appear to be general events in primary hematopoietic cells with increased glucose uptake.
|
/ß can be phosphorylated on serines 21 and 9 by a number of kinases, including PKA, PKC, and Akt (26). To identify candidate kinases by which glucose catabolism may stimulate phosphorylation of GSK-3, we treated control and Glut1 cells with inhibitors to each kinase and observed phospho-GSK-3 levels (Fig. 7A). Inhibition of Akt by the phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 or of PKA by the inhibitor H89 did not decrease phosphorylation of GSK-3
/ß at serines 21 and 9 in Glut1/HK1 cells but did appear to increase GSK-3 phosphorylation in control cells. PI3K/Akt and PKA are, therefore, not major GSK-3 kinases responsible for glucose-stimulated GSK-3 phosphorylation. The mechanism of this increased GSK-3 phosphorylation by these inhibitors is not clear, but it is likely due to compensation by other kinases activated under the stress of inhibitor treatment. In contrast, the global PKC inhibitor (Ro31-8220) led to a near-complete loss of phospho-GSK-3 in both control and Glut1/HK1 cells (Fig. 7A), suggesting that PKC isoforms were critical GSK-3 kinases. This effect was not dependent on other described nutrient-sensing kinase pathways, such as mTOR (58) and CamK II (33), as the mTOR/Raptor inhibitor (rapamycin) and CamK II inhibitor (KN93) also had no effect on phospho-GSK-3 levels in Glut1/HK1 cells and increased phospho-GSK-3 levels in control cells (Fig. 7A), possibly due to compensatory increases in PKC activity similar to those of other kinase inhibitors. To further examine a role for PKC isoforms in phospho-GSK-3
/ß, control and Glut1/HK1 cells were subjected to treatment with a variety of PKC inhibitors with differing specificities (Fig. 7A). With the exception of Go6983 and Rottlerin, which inhibit primarily conventional PKCs and PKC
, respectively, each provided at least partial inhibition of GSK-3 phosphorylation, suggesting that PKC isoforms may play prominent roles in phosphorylation of GSK-3 in response to enhanced glucose metabolism.
|
To determine if enhanced PKC activity in Glut1/HK1 cells was required for antiapoptotic glucose signaling and increased survival, we examined the effect of PKC inhibition in cell death upon IL-3 withdrawal. Glut1/HK1 cells were withdrawn from IL-3 and were untreated or treated with PKC inhibitor alone or with GSK-3 inhibitor, and Mcl-1 levels were determined by immunoblotting (Fig. 7D). Inhibition of PKC led to a sharp reduction in Mcl-1 protein levels that simultaneous inhibition of GSK-3 could partially rescue. In addition, inhibition of PKC prevented Glut1/HK1-mediated protection from cell death and reduced the survival of IL-3-withdrawn Glut1/HK1 cells to a level equivalent to that of control cells (Fig. 7E). This loss of Glut1/HK1-mediated protection appeared to be due to activation of GSK-3, as increases in the rate of cell death caused by PKC inhibition could be reversed by simultaneous inhibition of GSK-3. Together, these data suggest that a signaling pathway via PKC and GSK-3 is sensitive to glucose metabolism and is active in highly glycolytic cells, such as growth factor-stimulated or cancer cells. Ultimately, this glucose-dependent signaling pathway protects cells from apoptosis by attenuating degradation of Mcl-1 and thus inhibiting toxicity from the proapoptotic proteins, such as Bim.
| DISCUSSION |
|---|
|
|
|---|
Nutrient-induced signaling pathways have been shown to play important roles in many aspects of cell physiology. The mTOR/Raptor protein complex has been clearly implicated in amino acid sensing for regulation of protein synthesis, cell growth, and autophagy (30). Metabolic stress, such as may occur when ATP levels become depleted, can promote activation of AMP kinase via increased intracellular levels of AMP, which can both inhibit protein synthesis (23) and activate p53 to inhibit cell cycle progression (25). Here we provide evidence of a novel glucose-sensitive signaling pathway. This pathway was stimulated by expression of Glut1 and/or HK1 and appeared to require glucose catabolism, as the nonhydrolyzable glucose analog 2DOG was incapable of providing this glucose-induced survival signal. Elevated glucose metabolism led to phosphorylation of GSK-3
/ß on serines 21 and 9 in cells to maintain Mcl-1 protein levels and inhibit Bim-induced apoptosis in hematopoietic cells. While PKC activation in response to hyperglycemia has been thought to play a potential antiapoptotic role (1, 28, 38, 39), to our knowledge this is the first description of a similar pathway in cells with intrinsically high glucose uptake, such as growth factor-stimulated or cancer cells, and the first to connect this pathway to GSK-3 and the Bcl-2 family of proteins.
The approach utilized here to examine the effects of glucose metabolism on cell death in the absence of other signaling or oncogenic events revealed a pathway that may be of broad importance in both cell survival and growth. While the antiapoptotic effects of Glut1 and HK1 expression were not long term, this survival advantage nevertheless provided a significant clonogenic survival advantage over control cells (Fig. 1C) and likely underestimated the overall role that sustained glucose utilization may play in preventing cell death. Indeed, cytokine withdrawal ultimately leads to the loss of expression of both glycolytic and pentose phosphate pathway enzymes, which is not prevented by expression of Glut1 and HK1 (data not shown and reference 44). Thus, in contrast to the case for growth factor-stimulated or cancer cells, which coordinately upregulate and maintain entire metabolic pathways (49), expression of Glut1 and HK1 alone allows only a temporary increase in glucose metabolism after IL-3 withdrawal. In addition, while this analysis focused on the effects of this glucose signaling pathway on hematopoietic cell death, PKC isoforms and GSK-3 have multiple functions, and glucose-stimulated PKC activity and GSK-3 inhibition may affect other aspects of cell survival and growth to promote cancer progression or proliferation of growth factor-stimulated cells of multiple tissues. Addressing the contribution of glucose-stimulated signaling will be an important consideration for future studies of growth and survival of cancer cells as well as of stimulated lymphocytes, which show a robust increase in glucose uptake and utilization after antigenic stimulation (2, 13, 17).
There has been additional evidence to suggest that glucose-mediated pathways may regulate apoptosis. In hepatocytes and pancreatic ß-cells, glucokinase may reside in a protein complex with the BH3-only protein Bad, where Bad phosphorylation by PKA can regulate glucose-stimulated insulin secretion and cell death induced by glucose deprivation (11). It has also recently been shown that NADPH levels can regulate phosphorylation of caspase 2 and mitochondrial release of cytochrome c via CamK II in Xenopus egg extracts (33). Each of these models is not mutually exclusive with the antiapoptotic glucose-signaling pathway proposed here. In particular, NADPH levels may play a key role in metabolic signaling to PKC if acyl coenzyme A synthesis is required for de novo diacylglycerol generation. As we did not, however, observe any effect of PKA or CamK II inhibition on phospho-GSK-3 levels in Glut1/HK1 cells and Glut1/HK1 expression increased clonogenicity upon IL-3 withdrawal, our results likely identify a novel PKC-mediated glucose signaling pathway. It is also possible that Glut1/HK1 inhibited cell death in part by enhanced availability of metabolic substrates and generation of cytosolic NADH and ATP that may be cytoprotective as energy sources. The glucose-initiated signaling pathway described here may act in concert with and in the context of each of these other pathways and direct metabolic effects to prevent cell death of glycolytic cells.
Altered diacylglycerol levels or distribution and prevention of GSK-3 phosphorylation by PKC inhibitors suggest that this nutrient-signaling pathway is initiated by glucose-mediated effects on diacylglycerol and PKC localization or activity. Conventional and novel PKC isoforms are regulated by phosphorylation, calcium, and diacylglycerol (51). While they are not calcium or diacylglycerol regulated, atypical PKCs (PKC
and PKC
) are regulated by other kinases, including PKCs (61), or lipids (37, 48). In principle, increased glucose metabolism may affect intracellular calcium levels or kinase and phosphatase pathways that promote PKC activity. Using a biosensor for diacylglycerol, we show here that increased glucose metabolism leads to altered diacylglycerol levels or localization. Increased extracellular levels of glucose have been shown to enhance de novo synthesis of diacylglycerol in a variety of cell types, and this can stimulate activity of multiple PKC isoforms (38, 54, 57) that can be protective in both cardiac and neuronal ischemia (29, 46). Basal de novo generation of diacylglycerol and related lipids depends on both glucose and the availability or synthesis of fatty acids and thus incorporates several aspects of cell metabolism to indicate nutrient status. This pathway may, therefore, be ideally situated to regulate nutrient-stimulated survival and may regulate basal PKC activity not just in cells in the presence of high extracellular glucose but also in cells with high intrinsic glucose uptake and utilization.
For decades it has been known that cancer cells have increased rates of glycolysis and that growth factors and lymphocyte activation stimulate glucose metabolism. Due to mutation or activation of specific transcriptional programs that may affect apoptosis, however, it has been impossible to discern the effects of glycolysis on apoptosis. In this study, we directly analyzed the effects of increased glucose utilization on apoptosis by expressing only essential glycolytic genes in nontransformed cell lines and primary lymphocytes. Our results demonstrate the existence of a novel antiapoptotic signaling pathway stimulated by glucose metabolism that can set a threshold for apoptotic death. While regulation of Mcl-1 levels appeared to be the critical regulator of cell death in the systems used here, GSK-3 has also been shown to influence a variety of targets to regulate cell function and fate (26). Thus, glucose-regulated PKC activation and inhibition of GSK-3 may affect a variety of cell types through distinct mechanisms. This study indicates that the long-acknowledged glycolytic metabolism of cancer cells and activated lymphocytes may directly influence cell survival and reveals a novel pathway for possible therapeutic intervention.
| ACKNOWLEDGMENTS |
|---|
This work was funded by a Howard Temin KO1 Career Development Award from the National Cancer Institute (to J.C.R.), a Sidney Kimmel Foundation for Cancer Research Scholar Award (to J.C.R.), a V Foundation for Cancer Research Scholar Award (to J.C.R.), and R01 AI063345 (to J.C.R.).
| FOOTNOTES |
|---|
Published ahead of print on 19 March 2007. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Bental, M., and C. Deutsch. 1993. Metabolic changes in activated T cells: an NMR study of human peripheral blood lymphocytes. Magn. Reson. Med. 29:317-326.[Medline]
3. Bentley, J., D. Itchayanan, K. Barnes, E. McIntosh, X. Tang, C. P. Downes, G. D. Holman, A. D. Whetton, P. J. Owen-Lynch, and S. A. Baldwin. 2003. Interleukin-3-mediated cell survival signals include phosphatidylinositol 3-kinase-dependent translocation of the glucose transporter GLUT1 to the cell surface. J. Biol. Chem. 278:39337-39348.
4. Bentley, J., I. Walker, E. McIntosh, A. D. Whetton, P. J. Owen-Lynch, and S. A. Baldwin. 2001. Glucose transport regulation by p210 Bcr-Abl in a chronic myeloid leukaemia model. Br. J. Haematol. 112:212-215.[CrossRef][Medline]
5. Boise, L. H., M. Gonzalez-Garcia, C. E. Postema, L. Ding, T. Lindsten, L. A. Turka, X. Mao, G. Nunez, and C. B. Thompson. 1993. bcl-x, a bcl-2 related gene that functions as a dominant regulator of apoptotic cell death. Cell 74:597-608.[CrossRef][Medline]
6. Bouillet, P., D. Metcalf, D. C. Huang, D. M. Tarlinton, T. W. Kay, F. Kontgen, J. M. Adams, and A. Strasser. 1999. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science 286:1735-1738.
7. Chi, M. M., J. Pingsterhaus, M. Carayannopoulos, and K. H. Moley. 2000. Decreased glucose transporter expression triggers BAX-dependent apoptosis in the murine blastocyst. J. Biol. Chem. 275:40252-40257.
8. Ciofani, M., and J. C. Zuniga-Pflucker. 2005. Notch promotes survival of pre-T cells at the beta-selection checkpoint by regulating cellular metabolism. Nat. Immunol. 6:881-888.[CrossRef][Medline]
9. Conlon, I., and M. Raff. 1999. Size control in animal development. Cell 96:235-244.[CrossRef][Medline]
10. Dang, C. V. 1999. c-Myc target genes involved in cell growth, apoptosis, and metabolism. Mol. Cell. Biol. 19:1-11.[Medline]
11. Danial, N. N., C. F. Gramm, L. Scorrano, C. Y. Zhang, S. Krauss, A. M. Ranger, S. R. Datta, M. E. Greenberg, L. J. Licklider, B. B. Lowell, S. P. Gygi, and S. J. Korsmeyer. 2003. BAD and glucokinase reside in a mitochondrial complex that integrates glycolysis and apoptosis. Nature 424:952-956.[CrossRef][Medline]
12. Danial, N. N., and S. J. Korsmeyer. 2004. Cell death: critical control points. Cell 116:205-219.[CrossRef][Medline]
13. Doughty, C. A., B. F. Bleiman, D. J. Wagner, F. J. Dufort, J. M. Mataraza, M. F. Roberts, and T. C. Chiles. 2006. Antigen receptor-mediated changes in glucose metabolism in B lymphocytes: role of phosphatidylinositol 3-kinase signaling in the glycolytic control of growth. Blood 107:4458-4465.
14. Edinger, A. L., and C. B. Thompson. 2002. Akt maintains cell size and survival by increasing mTOR-dependent nutrient uptake. Mol. Biol. Cell 13:2276-2288.
15. Fox, C. J., P. S. Hammerman, R. M. Cinalli, S. R. Master, L. A. Chodosh, and C. B. Thompson. 2003. The serine/threonine kinase Pim-2 is a transcriptionally regulated apoptotic inhibitor. Genes Dev. 17:1841-1854.
16. Frauwirth, K. A., J. L. Riley, M. H. Harris, R. V. Parry, J. C. Rathmell, D. R. Plas, R. L. Elstrom, C. H. June, and C. B. Thompson. 2002. The CD28 signaling pathway regulates glucose metabolism. Immunity 16:769-777.[CrossRef][Medline]
17. Frauwirth, K. A., and C. B. Thompson. 2004. Regulation of T lymphocyte metabolism. J. Immunol. 172:4661-4665.
18. Gambhir, S. S. 2002. Molecular imaging of cancer with positron emission tomography. Nat. Rev. Cancer 2:683-693.[CrossRef][Medline]
19. Gatenby, R. A., and R. J. Gillies. 2004. Why do cancers have high aerobic glycolysis? Nat. Rev. Cancer 4:891-899.[CrossRef][Medline]
20. Gottlob, K., N. Majewski, S. Kennedy, E. Kandel, R. B. Robey, and N. Hay. 2001. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev. 15:1406-1418.
21. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57-70.[CrossRef][Medline]
22. Henquin, J. C. 2000. Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes 49:1751-1760.[Abstract]
23. Inoki, K., T. Zhu, and K. L. Guan. 2003. TSC2 mediates cellular energy response to control cell growth and survival. Cell 115:577-590.[CrossRef][Medline]
24. Jensen, M. V., J. W. Joseph, O. Ilkayeva, S. Burgess, D. Lu, S. M. Ronnebaum, M. Odegaard, T. C. Becker, A. D. Sherry, and C. B. Newgard. 2006. Compensatory responses to pyruvate carboxylase suppression in islet beta-cells: preservation of glucose-stimulated insulin secretion. J. Biol. Chem. 281:22342-22351.
25. Jones, R. G., D. R. Plas, S. Kubek, M. Buzzai, J. Mu, Y. Xu, M. J. Birnbaum, and C. B. Thompson. 2005. AMP-activated protein kinase induces a p53-dependent metabolic checkpoint. Mol. Cell 18:283-293.[CrossRef][Medline]
26. Jope, R. S., and G. V. Johnson. 2004. The glamour and gloom of glycogen synthase kinase-3. Trends Biochem. Sci. 29:95-102.[CrossRef][Medline]
27. Khaled, A. R., and S. K. Durum. 2002. Lymphocide: cytokines and the control of lymphoid homeostasis. Nat. Rev. Immunol. 2:817-830.[CrossRef][Medline]
28. Koya, D., and G. L. King. 1998. Protein kinase C activation and the development of diabetic complications. Diabetes 47:859-866.[Abstract]
29. Malliopoulou, V., C. Xinaris, I. Mourouzis, A. D. Cokkinos, N. Katsilambros, C. Pantos, E. Kardami, and D. V. Cokkinos. 2006. High glucose protects embryonic cardiac cells against simulated ischemia. Mol. Cell. Biochem. 284:87-93.[CrossRef][Medline]
30. Martin, D. E., and M. N. Hall. 2005. The expanding TOR signaling network. Curr. Opin. Cell Biol. 17:158-166.[CrossRef][Medline]
31. Maurer, U., C. Charvet, A. S. Wagman, E. Dejardin, and D. R. Green. 2006. Glycogen synthase kinase-3 regulates mitochondrial outer membrane permeabilization and apoptosis by destabilization of MCL-1. Mol. Cell 21:749-760.[CrossRef][Medline]
32. Morissette, M. R., A. L. Howes, T. Zhang, and J. Heller Brown. 2003. Upregulation of GLUT1 expression is necessary for hypertrophy and survival of neonatal rat cardiomyocytes. J. Mol. Cell Cardiol. 35:1217-1227.[CrossRef][Medline]
33. Nutt, L. K., S. S. Margolis, M. Jensen, C. E. Herman, W. G. Dunphy, J. C. Rathmell, and S. Kornbluth. 2005. Metabolic regulation of oocyte cell death through the CaMKII-mediated phosphorylation of caspase-2. Cell 123:89-103.[CrossRef][Medline]
34. Oishi, K., S. Kamakura, Y. Isazawa, T. Yoshimatsu, K. Kuida, M. Nakafuku, N. Masuyama, and Y. Gotoh. 2004. Notch promotes survival of neural precursor cells via mechanisms distinct from those regulating neurogenesis. Dev. Biol. 276:172-184.[CrossRef][Medline]
35. Opferman, J. T., H. Iwasaki, C. C. Ong, H. Suh, S. Mizuno, K. Akashi, and S. J. Korsmeyer. 2005. Obligate role of anti-apoptotic MCL-1 in the survival of hematopoietic stem cells. Science 307:1101-1104.
36. Opferman, J. T., A. Letai, C. Beard, M. D. Sorcinelli, C. C. Ong, and S. J. Korsmeyer. 2003. Development and maintenance of B and T lymphocytes requires antiapoptotic MCL-1. Nature 426:671-676.[CrossRef][Medline]
37. Pandian, S. S., A. A. Sneddon, C. S. Bestwick, S. McClinton, I. Grant, K. W. Wahle, and S. D. Heys. 2001. Fatty acid regulation of protein kinase C isoforms in prostate cancer cells. Biochem. Biophys. Res. Commun. 283:806-812.[CrossRef][Medline]
38. Peter-Riesch, B., M. Fathi, W. Schlegel, and C. B. Wollheim. 1988. Glucose and carbachol generate 1,2-diacylglycerols by different mechanisms in pancreatic islets. J. Clin. Investig. 81:1154-1161.[Medline]
39. Pinton, P., T. Tsuboi, E. K. Ainscow, T. Pozzan, R. Rizzuto, and G. A. Rutter. 2002. Dynamics of glucose-induced membrane recruitment of protein kinase C beta II in living pancreatic islet beta-cells. J. Biol. Chem. 277:37702-37710.
40. Plas, D. R., J. C. Rathmell, and C. B. Thompson. 2002. Homeostatic control of lymphocyte survival: potential origins and implications. Nat. Immunol. 3:515-521.[CrossRef][Medline]
41. Puthalakath, H., D. C. Huang, L. A. O'Reilly, S. M. King, and A. Strasser. 1999. The proapoptotic activity of the Bcl-2 family member Bim is regulated by interaction with the dynein motor complex. Mol. Cell 3:287-296.[CrossRef][Medline]
42. Raff, M. C. 1992. Social controls on cell survival and cell death. Nature 356:397-400.[CrossRef][Medline]
43. Rathmell, J. C., R. L. Elstrom, R. M. Cinalli, and C. B. Thompson. 2003. Activated Akt promotes increased resting T cell size, CD28-independent T cell growth, and development of autoimmunity and lymphoma. Eur. J. Immunol. 33:2223-2232.[CrossRef][Medline]
44. Rathmell, J. C., C. J. Fox, D. R. Plas, P. Hammerman, R. M. Cinalli, and C. B. Thompson. 2003. Akt-directed glucose metabolism can prevent Bax conformation change and promote growth factor-independent survival. Mol. Cell. Biol. 23:7315-7328.
45. Rathmell, J. C., M. G. Vander Heiden, M. H. Harris, K. A. Frauwirth, and C. B. Thompson. 2000. In the absence of extrinsic signals, nutrient utilization by lymphocytes is insufficient to maintain either cell size or viability. Mol. Cell 6:683-692.[CrossRef][Medline]
46. Raval, A. P., K. R. Dave, D. Mochly-Rosen, T. J. Sick, and M. A. Perez-Pinzon. 2003. Epsilon PKC is required for the induction of tolerance by ischemic and NMDA-mediated preconditioning in the organotypic hippocampal slice. J. Neurosci. 23:384-391.
47. Ravikumar, B., A. Stewart, H. Kita, K. Kato, R. Duden, and D. C. Rubinsztein. 2003. Raised intracellular glucose concentrations reduce aggregation and cell death caused by mutant huntingtin exon 1 by decreasing mTOR phosphorylation and inducing autophagy. Hum. Mol. Genet. 12:985-994.
48. Selbie, L. A., C. Schmitz-Peiffer, Y. Sheng, and T. J. Biden. 1993. Molecular cloning and characterization of PKC iota, an atypical isoform of protein kinase C derived from insulin-secreting cells. J. Biol. Chem. 268:24296-24302.
49. Semenza, G. L., D. Artemov, A. Bedi, Z. Bhujwalla, K. Chiles, D. Feldser, E. Laughner, R. Ravi, J. Simons, P. Taghavi, and H. Zhong. 2001. The metabolism of tumours: 70 years later. Novartis Found Symp. 240:251-260, 260-264.[Medline]
50. Smith, T. A. 2000. Mammalian hexokinases and their abnormal expression in cancer. Br. J. Biomed. Sci. 57:170-178.[CrossRef][Medline]
51. Tan, S. L., and P. J. Parker. 2003. Emerging and diverse roles of protein kinase C in immune cell signalling. Biochem. J. 376:545-552.[CrossRef][Medline]
52. Valverde, A. M., P. Navarro, M. Benito, and M. Lorenzo. 1998. H-ras induces glucose uptake in brown adipocytes in an insulin- and phosphatidylinositol 3-kinase-independent manner. Exp. Cell Res. 243:274-281.[CrossRef][Medline]
53. Vander Heiden, M. G., D. R. Plas, J. C. Rathmell, C. J. Fox, M. H. Harris, and C. B. Thompson. 2001. Growth factors can influence cell growth and survival through effects on glucose metabolism. Mol. Cell. Biol. 21:5899-5912.
54. Vary, T. C., and C. J. Lynch. 2006. Meal feeding stimulates phosphorylation of multiple effector proteins regulating protein synthetic processes in rat hearts. J. Nutr. 136:2284-2290.