![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article 
Molecular and Cellular Biology, July 2007, p. 5040-5046, Vol. 27, No. 13
0270-7306/07/$08.00+0 doi:10.1128/MCB.02228-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Cynthia L. Smith,
and
Steven J. Burden*
Molecular Neurobiology Program, The Helen L. and Martin S. Kimmel Center for Biology and Medicine at the Skirball Institute of Biomolecular Medicine, NYU School of Medicine, 540 1st Avenue, New York, New York 10016
Received 28 November 2006/ Returned for modification 17 January 2007/ Accepted 24 April 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, the DNA-binding subunit of GABP, leads to early embryonic lethality, preventing analysis of synapse formation in gabp mutant mice. To study the role of GABP at neuromuscular synapses, we conditionally inactivated gabp in skeletal muscle and studied synaptic differentiation and muscle gene expression. Although expression of rb, a target of GABP, is elevated in muscle tissue deficient in GABP, clustering of synaptic AChRs at synapses and synapse-specific gene expression are normal in these mice. These data indicate that GABP is dispensable for synapse-specific transcription and maintenance of normal AChR expression at synapses. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
GABP is a dimer of GABP, which contains an Ets domain that binds DNA, and GABPß, which contributes a nuclear localization sequence and the transcriptional activation domain to GABP (18, 31). Dimerization of GABP and GABPß is mediated by interactions between four amino-terminal ankyrin repeats in GABPß and the Ets domain, plus a short -helix adjacent to the Ets domain, in GABP (1, 39). While there is one known gabp gene, two gabpß genes, gabpß1 and gabpß2, have been found in mammals, and gabpß1 gives rise to at least four distinct splice isoforms (7, 10, 18, 41). Certain GABPß isoforms mediate formation of a heterotetramer, composed of two GABP/ß dimers, which binds to paired Ets sites, whereas other GABPß isoforms are recruited to a single Ets site as part of a GABP/ß dimer (7).
Synapse-specific transcription of the AChR 
gene is dependent upon a single Ets site in its promoter region (16). GABP is the major Ets protein in myotube nuclear extracts that binds this Ets site (9, 33). The AChR 
promoter also contains an Ets site that binds GABP, and mutations in this Ets site are responsible for certain congenital myasthenic syndromes in humans (22, 23, 35). While the importance of Ets sites in synapse-specific gene expression is widely accepted, the role of GABP in synapse formation is less clear. Transfection of a dominant-negative form of GABPß, lacking sequences required for transcriptional activation, inhibits AChR cluster formation and induction of an AChR reporter construct by ectopic agrin expression in adult skeletal muscle (2). Transfection of a dominant-negative form of GABPß also attenuates the activation of a MuSK reporter construct by agrin in vitro (17). Furthermore, transfection of a mutant form of GABP that cannot be phosphorylated at threonine 280 interferes with the induction of AChR gene expression by neuregulin 1 (Nrg-1) in cultured muscle cells (38). Forced expression of the DNA-binding domain of Ets2, another Ets domain-containing transcription factor, in skeletal muscle leads to defects in the organization and size of primary gutters and secondary folds at neuromuscular synapses and reduces the expression levels of "synaptic" genes (6). These results indicate that interfering with the function of multiple members of the Ets family of transcription factors by transfection of dominant-negative constructs affects the expression of genes that are preferentially transcribed in subsynaptic nuclei at the neuromuscular synapse. These studies, however, do not address whether GABP is required for neuromuscular synapse formation or synapse-specific gene expression.
Deletion of GABP in mice results in embryonic lethality prior to embryonic day 7.5 (E7.5) of development (26), preventing an analysis of a potential role for GABP in synapse formation, which begins at E13. Here we conditionally inactivated gabp specifically in skeletal muscle and analyzed synaptic development. We find that GABP is dispensable for synapse-specific gene expression and clustering of synaptic AChRs during synapse formation. Furthermore, postnatal synaptic maturation is normal in conditional gabp mutant mice. These findings suggest that additional proteins bind the Ets site in AChR genes and stimulate their expression in synaptic nuclei.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
.
To generate the loxP-flanked gabp allele (gabpf), we introduced loxP sites into introns 7 and 9 of a gabp genomic DNA fragment encompassing exons 7 through 10; furthermore, we introduced a frt-flanked neomycin resistance cassette into intron 9 and a diphtheria toxin A cassette at the 5' end of the targeting vector (Fig. 1A). Because exons 8 and 9 encode the majority of the Ets domain and sequences immediately amino-terminal to the Ets domain, which are required for GABP function, deletion of these exons is likely to result in a null allele (gabp–). Indeed, gabp–/– mice died during embryogenesis, whereas gabp+/– mice survived as adults (see below). 129S6/SvEvTac-derived W4 embryonic stem (ES) cells were electroporated with the targeting vector and selected with neomycin, and surviving clones were screened for homologous recombination by Southern blotting using a 3' EcoRV/EcoRI fragment as a probe (Fig. 1A and B). One gabpf/+ ES cell clone was chosen for blastocyst injections, and resulting chimeras were crossed to C57BL/6 mice. Phenotypic analyses were carried out in a mixed background.
|
f/+ mice were crossed to FlpE-expressing mice (8) to remove the neomycin resistance cassette from intron 9 (Fig. 1A). We generated gabp+/– mice by crossing gabpf/f mice with CMV::cre mice, which express Cre recombinase in the germ line (42).
Mouse strains and genotyping.
HSA::cre mice have been described previously (20) and were genotyped as reported previously (13). loxP-flanked and wild-type gabp alleles were detected by PCR using primers that hybridize to sequences in gabp (CTTACAATTTTGAGGTGCATAGACC and CCAAAGGAATTAGGGGAATCTTTCC). The null allele was detected using a separate pair of primers (GGCCAGCCAAGAGCAACA and TCCACCCTTGGACAGATCCTGCATGGC).
Immunohistochemistry.
Motor axons and nerve terminals were visualized by staining with antibodies against neurofilament and synaptophysin, respectively; muscle fibers and AChR clusters were stained with Alexa660-phalloidin and Alexa594--bungaratoxin (Alexa594--Bgt), as described previously (13).
To determine the branch point number of postsynaptic AChR clusters in P21 diaphragm muscles, we analyzed 10 synapses per animal for 4 animals per genotype. We determined the means for each genotype and compared them in a two-tailed Student t test.
Quantitation of synaptic AChRs.
The number and density of synaptic AChRs were determined by measuring Alexa594--Bgt binding, as described previously (13). We analyzed at least 62 synapses in each P0 diaphragm muscle, at least 27 synapses in each P21 gastrocnemius muscle, and a minimum of 23 synapses in each P21 diaphragm muscle. The mean AChR level and density from multiple mice (numbers of mice are indicated in the figure legends) with the same genotype were determined. Because the density and level of synaptic AChRs were not significantly different in P21 gabpf/– and gabpf/+ mice (data not shown), the data from these two genotypes were grouped.
In situ hybridization.
Intercostal and diaphragm muscles were processed for in situ hybridization and hybridized with digoxigenin-labeled riboprobes that recognize the AChR -subunit (5), AChR -subunit (36), AChR -subunit (13), or MuSK mRNA (11) as described elsewhere (13). Labeling with sense probes resulted in weak, uniform staining for each gene (data not shown).
The width of the in situ hybridization signal was measured relative to the distance between two adjacent ribs using ImageJ (NIH). Means were determined from four tissue samples (from two mice) of the same genotype, and genotypes were compared in a two-tailed Student t test.
Quantitative RT-PCR.
RNA isolation from gastrocnemius muscle, reverse transcription (RT), and quantitative PCR were carried out essentially as described previously (13). Relative expression levels of gabp and the AChR -subunit were normalized to muscle creatine kinase (mck) expression. retinoblastoma (rb) and cytochrome c oxidase subunit IV (coxIV) RNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (gapdh) expression. The primers used for PCR amplification were TGCATCCTGCACCACCAACT and ATGCCTGCTTCACCACCTTC for gapdh, CGTGTCACCTCTGCTGCT and CCTTCATATTGCCTCCCTTCT for mck, AATGGGGACAACGTAAGAACA and GTACACAAATCTCTTGCCTTGAAC for wild-type gabp, TGCTAGCCCAGACTGTCTTCTT and GTCGTTGGCGTCCTCAAAG for AChR , CTTGGCTAACTTGGGAGAAAG and GCTCAGTAAAAGTGAATGGCAT for rb, and GGGAGTGTTGTGAAGAGTGAAG and CCTTCTCCTTCTCCTTCAGC for coxIV.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
mutant alleles and conditional inactivation of GABP in skeletal muscle.
GABP has been implicated in the regulation of a wide variety of genes, including but not limited to nuclear genes encoding mitochondrial proteins, rb, and AChR subunit genes (14, 27, 32). To determine the function of GABP in vivo, we generated mice carrying a loxP-flanked allele of gabp (gabpf; Fig. 1A and B). In these mice, exons 8 and 9, which encode the majority of the GABP Ets domain, are flanked by loxP sites, allowing Cre-mediated deletion of these sequences (Fig. 1A). We also generated mice with a gabp allele lacking exons 8 and 9 (gabp–) by crossing gabpf/+ mice to CMV::cre mice, which express Cre in all cell types, including the germ line (Fig. 1A) (see Materials and Methods). We intercrossed gabp+/– mice and failed to obtain gabp–/– newborn mice (data not shown). At E8.5, the earliest stage we examined, we failed to recover homozygous mutant embryos; however, genotyping of extraembryonic membrane tissue from empty deciduas showed that this tissue contained gabp–/– embryos, which had apparently resorbed prior to E8.5 (data not shown). These results indicate that GABP is required for survival during early embryonic development, as reported previously (26, 43), preventing analysis of its function at later stages of development.
To determine the role of GABP in skeletal muscle, we inactivated GABP specifically in skeletal muscle. To this end, we generated mice carrying a human skeletal actin (HSA)::cre transgene and null and loxP-flanked alleles of gabp. HSA::cre; gabpf/– mice were born at the expected Mendelian frequency. Because mice die at birth if the diaphragm and intercostal muscles fail to form or function, these findings suggest that GABP is not essential for the formation of skeletal muscles. To measure the extent of gabp inactivation in skeletal muscle tissue, we isolated RNA from P21 HSA::cre; gabpf/– mice and gabpf/+ littermates and used a quantitative, real-time PCR assay to measure the level of gabp expression (Materials and Methods). We found that the expression of RNA encoding wild-type GABP is reduced nearly 10-fold in muscle tissue from HSA::cre; gabpf/– mice (11.8% ± 0.9% of the level found in muscle tissue from gabpf/+ mice; P < 0.0005) (Fig. 1C). Because GABP is expressed in most if not all cell types (19, 24, 26) and because muscle tissue contains fibroblasts, smooth muscle cells, Schwann cells, and endothelial cells in addition to muscle fibers, these data establish a minimal reduction of GABP expression within skeletal myofibers. Residual expression of GABP in vascular, interstitial, and neural cell types is likely to contribute to most if not all of the remaining expression of GABP in skeletal muscle tissue. Thus, our data indicate that GABP expression is substantially reduced in skeletal myofibers of HSA::cre; gabpf/– mice.
rb gene expression is regulated by GABP. GABP has been implicated in the regulation of nuclear genes encoding mitochondrial proteins, including cytochrome c oxidase subunits and the rb gene (14, 27). GABP binds the promoter regions of these target genes, and GABP overexpression induces their transcription; conversely, their transcription is attenuated by expression of dominant-negative forms of GABP (25, 30, 37, 40).
To determine whether GABP regulates the expression of rb and coxIV, we measured their expression in gastrocnemius muscles from P21 HSA::cre; gabpf/– mice and gabpf/+ littermates by quantitative RT-PCR. We found that coxIV mRNA levels are normal in muscle from HSA::cre; gabpf/– mice (92.2% ± 3.9% of control; P > 0.2) (Fig. 2). rb expression, on the other hand, was elevated in muscle from HSA::cre; gabpf/– mice (132.5% ± 11.1% of control; P < 0.07) (Fig. 2). These findings indicate that coxIV expression in muscle is not dependent upon GABP and suggest that rb is negatively regulated by GABP.
|
is not required for synapse formation and synaptic gene expression during embryonic development.
GABP has been implicated in synapse-specific gene expression and neuromuscular synapse formation (32). To study presynaptic and postsynaptic differentiation in HSA::cre; gabpf/– mice, we stained whole mounts of diaphragm muscle from P0 HSA::cre; gabpf/– mice and control littermates with probes that allowed us to visualize motor axons, nerve terminals, muscle fibers, and AChRs (Materials and Methods). Muscle fibers in HSA::cre; gabpf/– mice are of normal arrangement and size, and the positions of the main intramuscular nerve and synaptic sites appear normal (Fig. 3A and B) (data not shown). Moreover, in HSA::cre; gabpf/– mice, as in wild-type mice, AChRs are clustered at synaptic sites, and the size and shape of presynaptic nerve terminals and postsynaptic AChR clusters appear normal (Fig. 3A and B). Similar results were obtained for gastrocnemius muscle (data not shown). These results indicate that expression of GABP in skeletal muscle is not essential for the formation of muscle fibers, growth of motor axons to muscle, or the formation of neuromuscular synapses.
|
, we measured synaptic AChR protein expression by quantitating the amount of Alexa594--Bgt bound to synaptic AChRs in diaphragm muscles from P0 HSA::cre; gabpf/– mice and control mice (Fig. 3C) (Materials and Methods). We found no significant difference in the density or number of synaptic AChRs in gabp mutant mice and control littermates (density, 99% ± 3.3% of control, P > 0.2; total number, 111% ± 10.9% of control, P > 0.2). These findings indicate that the number and density of AChRs at developing synapses do not depend upon GABP expression in muscle.
To analyze the role of GABP in synaptic transcription, we examined the pattern of AChR gene expression in intercostal muscles from P0 mice by in situ hybridization. We found that AChR -subunit and AChR -subunit mRNAs are concentrated in the central region of muscle from HSA::cre; gabpf/– mice, as with control mice (Fig. 3D to G). We measured the width of the AChR and AChR expression domains relative to the distance between individual ribs and found no significant difference (P > 0.2) between control mice (AChR , 16% ± 1.1%, n = 4; AChR , 16% ± 2.2%, n = 4) and HSA::cre; gabpf/– littermates (AChR , 17% ± 2.2%, n = 4; AChR , 17% ± 1.9%, n = 4). We also analyzed the pattern of MuSK gene expression and found that MuSK mRNA is patterned normally in HSA::cre; gabpf/– mice (Fig. 3H and I) and that there is no significant difference (P > 0.2) in the width of the MuSK expression domain between control mice (21% ± 2.5%; n = 4) and conditional gabp mutant mice (17% ± 3.7%; n = 4). These findings indicate that GABP function in skeletal muscle is not required to establish the pattern of synapse-specific gene expression during development.
GABP expression in muscle is dispensable for postnatal maturation of neuromuscular synapses.
Postnatally, neuromuscular synapses undergo extensive remodeling and maturation. Hence, we analyzed whether GABP is required for the maturation or maintenance of neuromuscular synapses after birth. Postnatal HSA::cre; gabpf/– mice appear healthy and do not display any overt phenotype (data not shown). We visualized motor axons, nerve terminals, muscle fibers, and AChRs in whole mounts of diaphragm muscle from P21 mice. We found that AChRs are concentrated at synaptic sites in gabp mutant mice; these AChR clusters are apposed by nerve terminals that have the same size and shape as nerve terminals in wild-type mice (Fig. 4A and B). Similar results were obtained for gastrocnemius muscle (data not shown). To quantitatively compare the morphology of neuromuscular synapses in diaphragms of HSA::cre; gabpf/– mice and gabpf/+ mice, we determined the number of branch points in postsynaptic AChR clusters (see Materials and Methods). We found no significant difference (P > 0.2) in branch point number between control mice (5.5 ± 0.58) and conditional gabp mutant mice (5.1 ± 0.30). Thus, GABP is not essential to maintaining the normal arrangement of AChRs and nerve terminals at neuromuscular synapses in postnatal mice.
|
is required to maintain AChR expression postnatally, we measured the densities and numbers of synaptic AChRs in diaphragm muscles from P21 HSA::cre; gabpf/– mice and control mice (Fig. 4C). We found no significant difference in the density or number of synaptic AChRs in gabp mutant mice and control littermates (density, 98% ± 9.3% of control, P > 0.2; total number, 99% ± 12.7% of control, P > 0.2). Similar results were obtained for gastrocnemius muscles (density, 109% ± 3.1% of control, P > 0.2; total number, 93% ± 4.2% of control, P > 0.2; n = 3 for control mice; n = 5 for mutant mice). These findings indicate that the number and density of AChRs at mature synapses do not depend upon GABP expression in muscle.
During the first week of postnatal life, expression of the AChR 
-subunit is down-regulated and expression of the AChR -subunit is induced; this postnatal switch in AChR subunit expression is critically responsible for a change in the kinetics and conductance of synaptic AChRs (21). Because GABP has been proposed to play a key role in inducing AChR -subunit expression (2, 22, 23, 35), we analyzed AChR expression in HSA::cre; gabpf/– mice. We examined the expression pattern of the AChR -subunit gene in intercostal muscles of P21 gabp mutant mice by in situ hybridization and found that AChR -subunit mRNA is concentrated in the central region of muscle from HSA::cre; gabpf/– mice, as with control littermates (Fig. 4D and E; width of AChR expression domain, 13% ± 1.5% for controls, n = 4; 14% ± 1.1% for mutants, n = 4; P > 0.2). Similar results were obtained with diaphragm muscle (data not shown). These results indicate that skeletal muscle GABP is not required for activating AChR -subunit transcription in subsynaptic nuclei and patterning synapse-specific gene expression postnatally.
To determine whether GABP regulates the level of AChR -subunit gene expression, we measured AChR mRNA in gastrocnemius muscle from P21 HSA::cre; gabpf/– mice and control mice by quantitative RT-PCR. We found that AChR mRNA levels are normal in HSA::cre; gabpf/– mice (89.6% ± 2.9% of control; P > 0.2) (Fig. 4F). Thus, the AChR expression level is not dependent upon GABP.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, in skeletal muscle and found that the pattern of synapse-specific gene expression is normal in these mutant mice. Synapses develop and mature normally in these mice, forming an elaborate, branched shape that contains normal numbers of postsynaptic AChRs. Moreover, AChR -subunit gene expression is induced postnatally and patterned normally in gabp conditionally mutant mice. These results provide strong evidence against an essential role for GABP in neuromuscular synapse formation and synapse-specific transcription. O'leary et al. have recently described their analysis of mice that are deficient in skeletal muscle GABP (24a). Although they report that the arborization of nerve terminals is simplified at a subset of synapses and that AChR gene expression is reduced in the diaphragm muscle, similar to our findings, they report that skeletal muscle GABP is not essential for viability, growth, muscle development, or neuromuscular synapse formation.
GABP has been implicated in the induction of the rb gene, since the rb promoter region contains a binding site for GABP, and overexpression of GABP stimulates expression of a reporter gene controlled by the rb promoter in cultured cells (30, 37). Surprisingly, we find that the expression of rb is elevated (1.3-fold) in muscle of HSA::cre; gabpf/– mice, suggesting that GABP suppresses rb gene expression, possibly directly, in skeletal muscle. These data demonstrate that deletion of gabp in skeletal muscle of HSA::cre; gabpf/– mice causes misregulation of at least one proposed GABP target gene, while neuromuscular synapse formation and synapse-specific transcription are unaffected. We cannot exclude the possibility that these mutant mice still express a low level of GABP, insufficient to repress rb expression but fully capable of stimulating synapse-specific gene expression.
We used HSA::cre mice to conditionally inactivate gabp in skeletal muscle. Previously we demonstrated that the HSA::cre transgene mediates efficient (>95%) deletion of loxP-flanked target sequences in muscle fibers (13). Here we show that the levels of wild-type gabp transcript are reduced approximately 10-fold in muscle tissue of HSA::cre; gabpf/– mice compared to those for gabpf/+ mice. Because gabp is likely to be expressed in nonmuscle cells within muscle tissue (see Results) and because fibroblasts, smooth muscle cells, Schwann cells, and endothelial cells constitute approximately 50% of the nuclei within muscle tissue (34), the reduction of gabp within muscle fibers of HSA::cre; gabpf/– mice is likely greater than 10-fold.
The gabp– allele described here is likely to be a null allele, because it lacks the sequences in gabp that encode the DNA-binding domain. Consistent with this idea, gabp–/– mice die before E8.5 (data not shown), as do mice that are homozygous for a gabp allele lacking the first protein-coding exon (26). Because the gabp gene encodes the DNA-binding portion of GABP and GABPß does not bind directly to DNA (3), deletion of gabp in HSA::cre; gabpf/– mice abolishes the ability of GABP to stimulate transcription in skeletal muscle.
Expression of a dominant-negative form of GABPß, which can interact with GABP but lacks the transcriptional activation domain, inhibits ectopic induction of AChR gene expression by agrin in adult skeletal muscle, suggesting that GABP can regulate synaptic AChR gene expression (2). These findings and our results would be reconciled if a complex of GABP and transcriptionally defective GABPß remained bound to the Ets site in the AChR gene, preventing other, "compensating" Ets proteins from binding to the Ets site and substituting for GABP. In contrast, removal of GABP in HSA::cre; gabpf/– mice may allow for other Ets proteins to occupy the Ets site in AChR genes and compensate for the absence of GABP. Consistent with this idea, the DNA-binding specificities of different members of the family of Ets domain-containing transcription factors are very similar (3), and multiple Ets proteins are expressed in muscle (12, 29). Thus, although it is possible that Ets domain-containing transcription factors other than GABP normally confer synapse-specific gene expression, other Ets domain proteins may only compensate for the loss of GABP. Notably, one Ets family member, Erm, is a particularly attractive candidate for regulating synapse-specific transcription, since erm RNA is highly concentrated at synaptic sites in skeletal muscle (12, 15). Further analysis of erm mutant mice should reveal whether Erm alone or Erm together with GABP has a role in synapse-specific gene expression.
|
ACKNOWLEDGMENTS |
|---|
We thank Judith Melki and Kevin Campbell for HSA::cre mice and Xiang-Qing Li and Jihua Fan for expert technical assistance.
|
FOOTNOTES |
|---|
Published ahead of print on 7 May 2007.
Present address: Tessier-Lavigne lab, Genentech Inc., South San Francisco, CA 94080.
Present address: Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, ME 04609-1500.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
/ß: an ETS domain-ankyrin repeat heterodimer bound to DNA. Science 279:1037-1041.2. Briguet, A., and M. A. Ruegg. 2000. The Ets transcription factor GABP is required for postsynaptic differentiation in vivo. J. Neurosci. 20:5989-5996.
3. Brown, T. A., and S. L. McKnight. 1992. Specificities of protein-protein and protein-DNA interaction of GABP alpha and two newly defined ets-related proteins. Genes Dev. 6:2502-2512.
4. Burden, S. J. 2002. Building the vertebrate neuromuscular synapse. J. Neurobiol. 53:501-511.[CrossRef][Medline]
5. DeChiara, T. M., D. C. Bowen, D. M. Valenzuela, M. V. Simmons, W. T. Poueymirou, S. Thomas, E. Kinetz, D. L. Compton, E. Rojas, J. S. Park, C. Smith, P. S. DiStefano, D. J. Glass, S. J. Burden, and G. D. Yancopoulos. 1996. The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo. Cell 85:501-512.[CrossRef][Medline]
6. de Kerchove D'Exaerde, A., J. Cartaud, A. Ravel-Chapuis, T. Seroz, F. Pasteau, L. M. Angus, B. J. Jasmin, J. P. Changeux, and L. Schaeffer. 2002. Expression of mutant Ets protein at the neuromuscular synapse causes alterations in morphology and gene expression. EMBO Rep. 3:1075-1081.[CrossRef][Medline]
7. de la Brousse, F. C., E. H. Birkenmeier, D. S. King, L. B. Rowe, and S. L. McKnight. 1994. Molecular and genetic characterization of GABP beta. Genes Dev. 8:1853-1865.
8. Farley, F. W., P. Soriano, L. S. Steffen, and S. M. Dymecki. 2000. Widespread recombinase expression using FLPeR (flipper) mice. Genesis 28:106-110.[CrossRef][Medline]
9. Fromm, L., and S. J. Burden. 1998. Synapse-specific and neuregulin-induced transcription require an ets site that binds GABPalpha/GABPbeta. Genes Dev. 12:3074-3083.
10. Gugneja, S., J. V. Virbasius, and R. C. Scarpulla. 1995. Four structurally distinct, non-DNA-binding subunits of human nuclear respiratory factor 2 share a conserved transcriptional activation domain. Mol. Cell. Biol. 15:102-111.[Abstract]
11. Herbst, R., E. Avetisova, and S. J. Burden. 2002. Restoration of synapse formation in Musk mutant mice expressing a Musk/Trk chimeric receptor. Development 129:5449-5460.
12. Hippenmeyer, S., N. A. Shneider, C. Birchmeier, S. J. Burden, T. M. Jessell, and S. Arber. 2002. A role for neuregulin1 signaling in muscle spindle differentiation. Neuron 36:1035-1049.[CrossRef][Medline]
13. Jaworski, A., and S. J. Burden. 2006. Neuromuscular synapse formation in mice lacking motor neuron- and skeletal muscle-derived Neuregulin-1. J. Neurosci. 26:655-661.
14. Kelly, D. P., and R. C. Scarpulla. 2004. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 18:357-368.
15. Kishi, M., T. T. Kummer, S. J. Eglen, and J. R. Sanes. 2005. LL5beta: a regulator of postsynaptic differentiation identified in a screen for synaptically enriched transcripts at the neuromuscular junction. J. Cell Biol. 169:355-366.
16. Koike, S., L. Schaeffer, and J. P. Changeux. 1995. Identification of a DNA element determining synaptic expression of the mouse acetylcholine receptor delta-subunit gene. Proc. Natl. Acad. Sci. USA 92:10624-10628.
17. Lacazette, E., S. Le Calvez, N. Gajendran, and H. R. Brenner. 2003. A novel pathway for MuSK to induce key genes in neuromuscular synapse formation. J. Cell Biol. 161:727-736.
18. LaMarco, K., C. C. Thompson, B. P. Byers, E. M. Walton, and S. L. McKnight. 1991. Identification of Ets- and notch-related subunits in GA binding protein. Science 253:789-792.
19. Martin, M. E., Y. Chinenov, M. Yu, T. K. Schmidt, and X. Y. Yang. 1996. Redox regulation of GA-binding protein-alpha DNA binding activity. J. Biol. Chem. 271:25617-25623.
20. Miniou, P., D. Tiziano, T. Frugier, N. Roblot, M. Le Meur, and J. Melki. 1999. Gene targeting restricted to mouse striated muscle lineage. Nucleic Acids Res. 27:e27.
21. Mishina, M., T. Takai, K. Imoto, M. Noda, T. Takahashi, S. Numa, C. Methfessel, and B. Sakmann. 1986. Molecular distinction between fetal and adult forms of muscle acetylcholine receptor. Nature 321:406-411.[CrossRef][Medline]
22. Nichols, P., R. Croxen, A. Vincent, R. Rutter, M. Hutchinson, J. Newsom-Davis, and D. Beeson. 1999. Mutation of the acetylcholine receptor epsilon-subunit promoter in congenital myasthenic syndrome. Ann. Neurol. 45:439-443.[CrossRef][Medline]
23. Ohno, K., B. Anlar, and A. G. Engel. 1999. Congenital myasthenic syndrome caused by a mutation in the Ets-binding site of the promoter region of the acetylcholine receptor epsilon subunit gene. Neuromuscul. Disord. 9:131-135.[CrossRef][Medline]
24. O'Leary, D. A., D. Koleski, I. Kola, P. J. Hertzog, and S. Ristevski. 2005. Identification and expression analysis of alternative transcripts of the mouse GA-binding protein (Gabp) subunits alpha and beta1. Gene 344:79-92.[CrossRef][Medline]
24. O'Leary, D. A., P. G. Noakes, N. A. Lavidis, I. kola, P. J. Hertzog, and S. Ristevski. 2007. Targeting of the ETS factor Gabp disrupts Neuromuscular junction synapstic function. Mol. Cell. Biol. 27:3470-3480.
25. Ongwijitwat, S., and M. T. Wong-Riley. 2005. Is nuclear respiratory factor 2 a master transcriptional coordinator for all ten nuclear-encoded cytochrome c oxidase subunits in neurons? Gene 360:65-77.[CrossRef][Medline]
26. Ristevski, S., D. A. O'Leary, A. P. Thornell, M. J. Owen, I. Kola, and P. J. Hertzog. 2004. The ETS transcription factor GABP is essential for early embryogenesis. Mol. Cell. Biol. 24:5844-5849.
27. Rosmarin, A. G., K. K. Resendes, Z. Yang, J. N. McMillan, and S. L. Fleming. 2004. GA-binding protein transcription factor: a review of GABP as an integrator of intracellular signaling and protein-protein interactions. Blood Cells Mol. Dis. 32:143-154.[CrossRef][Medline]
28. Sanes, J. R., and J. W. Lichtman. 2001. Induction, assembly, maturation and maintenance of a postsynaptic apparatus. Nat. Rev. Neurosci. 2:791-805.[Medline]
29. Sapru, M. K. 2001. Neuregulin-1 regulates expression of the Ets-2 transcription factor. Life Sci. 69:2663-2674.[CrossRef][Medline]
30. Savoysky, E., T. Mizuno, Y. Sowa, H. Watanabe, J. Sawada, H. Nomura, Y. Ohsugi, H. Handa, and T. Sakai. 1994. The retinoblastoma binding factor 1 (RBF-1) site in RB gene promoter binds preferentially E4TF1, a member of the Ets transcription factors family. Oncogene 9:1839-1846.[Medline]
31. Sawa, C., M. Goto, F. Suzuki, H. Watanabe, J. Sawada, and H. Handa. 1996. Functional domains of transcription factor hGABP beta1/E4TF1-53 required for nuclear localization and transcription activation. Nucleic Acids Res. 24:4954-4961.
32. Schaeffer, L., A. de Kerchove d'Exaerde, and J. P. Changeux. 2001. Targeting transcription to the neuromuscular synapse. Neuron 31:15-22.[CrossRef][Medline]
33. Schaeffer, L., N. Duclert, M. Huchet-Dymanus, and J. P. Changeux. 1998. Implication of a multisubunit Ets-related transcription factor in synaptic expression of the nicotinic acetylcholine receptor. EMBO J. 17:3078-3090.[CrossRef][Medline]
34. Schmalbruch, H., and U. Hellhammer. 1977. The number of nuclei in adult rat muscles with special reference to satellite cells. Anat. Rec. 189:169-175.[CrossRef][Medline]
35. Si, J., D. S. Miller, and L. Mei. 1997. Identification of an element required for acetylcholine receptor-inducing activity (ARIA)-induced expression of the acetylcholine receptor epsilon subunit gene. J. Biol. Chem. 272:10367-10371.
36. Simon, A. M., P. Hoppe, and S. J. Burden. 1992. Spatial restriction of AChR gene expression to subsynaptic nuclei. Development 114:545-553.[Abstract]
37. Sowa, Y., Y. Shiio, T. Fujita, T. Matsumoto, Y. Okuyama, D. Kato, J. Inoue, J. Sawada, M. Goto, H. Watanabe, H. Handa, and T. Sakai. 1997. Retinoblastoma binding factor 1 site in the core promoter region of the human RB gene is activated by hGABP/E4TF1. Cancer Res. 57:3145-3148.
38. Sunesen, M., M. Huchet-Dymanus, M. O. Christensen, and J. P. Changeux. 2003. Phosphorylation-elicited quaternary changes of GA binding protein in transcriptional activation. Mol. Cell. Biol. 23:8008-8018.
39. Thompson, C. C., T. A. Brown, and S. L. McKnight. 1991. Convergence of Ets- and notch-related structural motifs in a heteromeric DNA binding complex. Science 253:762-768.
40. Virbasius, J. V., C. A. Virbasius, and R. C. Scarpulla. 1993. Identity of GABP with NRF-2, a multisubunit activator of cytochrome oxidase expression, reveals a cellular role for an ETS domain activator of viral promoters. Genes Dev. 7:380-392.
41. Watanabe, H., J. Sawada, K. Yano, K. Yamaguchi, M. Goto, and H. Handa. 1993. cDNA cloning of transcription factor E4TF1 subunits with Ets and notch motifs. Mol. Cell. Biol. 13:1385-1391.
42. White, J. K., W. Auerbach, M. P. Duyao, J. P. Vonsattel, J. F. Gusella, A. L. Joyner, and M. E. MacDonald. 1997. Huntingtin is required for neurogenesis and is not impaired by the Huntington's disease CAG expansion. Nat. Genet. 17:404-410.[CrossRef][Medline]
43. Xue, H. H., J. Bollenbacher, V. Rovella, R. Tripuraneni, Y. B. Du, C. Y. Liu, A. Williams, J. P. McCoy, and W. J. Leonard. 2004. GA binding protein regulates interleukin 7 receptor alpha-chain gene expression in T cells. Nat. Immunol. 5:1036-1044.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
