![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institute of Microbiology and Immunology, National Yang-Ming University, Shih-Pai, Taipei, Taiwan, Republic of China,1 Institute of Molecular Biology, Academia Sinica, Nankang, Taipei, Taiwan, Republic of China2
Received 27 February 2007/ Returned for modification 1 April 2007/ Accepted 14 May 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The DEXD/H-box RNA helicase Prp2 is required for the first catalytic reaction (26, 29). Prp2 functions as a molecular motor to restructure the spliceosome by hydrolyzing ATP, and then it leaves the spliceosome (25, 26). Another splicing factor, Spp2, originally identified as a high-copy-number suppressor of prp2-1 mutation, interacts with Prp2 and is required for the function of Prp2, possibly by mediating the binding of Prp2 to the spliceosome (28, 32, 35). After Prp2-dependent conformational rearrangement of the spliceosome, a heat-resistant heparin binding protein factor(s) of unknown identity, HP, is required to promote the step one reaction in an ATP-independent manner (26). Similarly, five protein factors have been shown to be involved in the second catalytic reaction. Hydrolysis of ATP by the DEXD/H-box RNA helicase Prp16 is required for the structural rearrangement of the spliceosome prior to the catalytic reaction (1, 19, 34). Prp17 has also been shown to act in the ATP-dependent step (22). The subsequent catalytic reaction is triggered by Slu7, Prp18, and Prp22 and does not require ATP (1, 19, 21, 33).
The Prp19-associated complex, or NTC (for "nineteen complex"), is associated with the spliceosome and plays an important role in mediating structural rearrangement of the spliceosome during its activation (37, 38). NTC is not required for the dissociation of U4, but it is required for the stabilization of U5 and U6 in the spliceosome during spliceosome activation (6). Stabilization of U5 and U6 by NTC is achieved in part through specifying interactions between U6 and the 5' splice site and between U5 and the pre-mRNA (5, 6). A tertiary U6-pre-mRNA interaction that requires prior destabilization of Sm-like proteins from U6 also requires the presence of NTC (6). Furthermore, deficiency in NTC function affects the biogenesis of U4/U6 snRNP and, as a consequence, results in the failure of spliceosome cycling (7).
Eight NTC components have been identified, including Ntc90/Syf1, Ntc85/Cef1, Ntc77/Clf1, and Prp19, encoded by essential genes, and Ntc31/Syf2, Ntc30/Isy1, Ntc25/Snt309, and Ntc20, encoded by genes not essential for cellular growth (8-10, 41). Ntc25 has been shown to interact with Prp19 to regulate the interaction of Prp19 with other NTC components (11), whereas Ntc31, Ntc30, and Ntc20 form a stable subcomplex with Ntc90 to regulate the function of Ntc90 (9). All of these proteins are associated with the spliceosome at the same time during spliceosome assembly, suggesting that they might function as an integral particle in association with the spliceosome. Analysis of proteomic databases has revealed the possibility that other proteins are associated with NTC (16, 18, 31, 43, 47). Among these proteins, Yju2 was found to copurify with four of the identified components of NTC and other known splicing factors (16). On testing whether Yju2 is a component of NTC, we found that Yju2 is associated with NTC but has a function distinct from that of NTC. Yju2 dynamically interacts with NTC and is associated with the spliceosome at nearly the same time as NTC. Yju2 could bind to the spliceosome in association with NTC or separately from NTC after the activation of the spliceosome. Complementation analysis of the affinity-isolated spliceosome formed in Yju2-depleted extracts revealed that Yju2 functions in concert with an unidentified heat-resistant factor(s), presumably the previously described HP (26), after the ATP-dependent Prp2 step to promote the first catalytic reaction in a Mg2+-dependent and ATP-independent manner.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
gal4 gal80 his3 trp1 ade2 ura3 leu2 met-URA3::GAL-lacZ), PJ69-4A (MATa trp1 leu2 ura3 his3 gal4
gal80 GAL2-ADE2 LYS2::GAL1-HIS3 met::GAL7-lacZ), YSCC1 (MATa prc1 prb1 pep4 leu2 trp1 ura3 PRP19HA), YSCC2 (MATa prc1 prb1 pep4 leu2 trp1 ura3 YJU2HA), YSCC4 (MATa prc1 prb1 pep4 leu2 trp1 ura3 PRP4HA), YSCC12 (MATa his3 his7 ade3 ura3 prp2-1 PRP19HA), YSCC121 (MATa prc1 prb1 pep4 leu2 trp1 PRP19HA URA3::GAL-YJU2), and YSCC224 (MATa prc1 prb1 pep4 leu2 trp1 ura3 YJU2HA PRP2-4V5). Oligonucleotides. The following oligonucleotides were used: H6, GGCCAAGCTTAGGATCCATATGGCTAGCCATCATCATCATCATCATGGTAAACCAATTCCAAATCC; P2-1, GGCCGGATCCGGAAGGTGCTATACGAT; P2-2, CCGGAAGCTTCATGTGTTGCTATACAC; P2-3, CCGGACTAGTTCAAGTATTACATCTGAAAC; P2-4, CCGGCTCGAGGTGCTAGACGTGCCTCA; P2-5, TGTATTGATGTACAGGC; R13, GAGTGACGATTCCTATAG; Y2-1, GGCCGGATCCGAATTCATATGTCTGAAAGAAAAGC; Y2-2, GGCCGACGTCCCAGACTACGCTTGACCTAGAAAAGTAAGGAA; Y2-3, GGCCGACGTCGTATGGGTATTTGAGAGACTTTCCTCGTT; Y2-4, CCGGCTCGAGACCCGATATATCCGCT; and U6-Abio, BioTEG-TCTCTTTGTAAAACGG (QIAGEN).
Antibodies and reagents. The antihemagglutinin (anti-HA) monoclonal antibody 8G5F was produced by immunizing mice with a keyhole limpet hemocyanin-conjugated HA peptide (data not shown). The anti-V5 antibody was purchased from Serotec, Inc. The anti-Yju2 polyclonal antibody was produced by immunizing rabbits with the full-length protein expressed in Escherichia coli. Protein A-Sepharose was from Amersham, Inc., and streptavidin-Sepharose and RNase A were from Sigma, Inc.
Construction of the YJU2-HA-tagged and PRP2-4V5-tagged strains. Construction of the HA-tagged YJU2 strain was performed as described by Tsai et al. (40). For construction of pRS406.YJU2-HA, DNA fragments A and B were generated by PCR using primers Y2-1 and Y2-3 as well as Y2-2 and Y2-4, respectively. Following digestion with BamHI and AatII and with AatII and XhoI, respectively, fragments A and B were ligated with BamHI- and XhoI-digested pRS406. For construction of pRS406.PRP2N-4V5, DNA fragments C and D were generated by PCR using primers P2-1 and P2-2 as well as P2-3 and P2-4, respectively. Fragment C was digested with BamHI and HindIII and ligated with plasmid vector pDK85 digested with BamHI and HindIII. The resulting plasmid was digested with SpeI and XhoI and was ligated with fragment D that had been digested with SpeI and XhoI. Plasmids pRS406.YJU2-HA and pRS406.PRP2-4V5 were linearized and individually transformed into yeast strain BJ2168 to displace the wild-type allele with the tagged allele by the pop-in and pop-out gene displacement method (45).
Splicing extracts, substrates, and splicing assays. Yeast whole-cell extracts were prepared according to the method of Cheng et al. (13), except that 240 µg/ml zymolyase was added and incubated at 25°C for 90 min for spheroplast formation of the prp2-1 mutant strain. The prp2-1 mutant extracts were heat inactivated by incubation of extracts at 37°C for 7.5 min. Actin precursors were synthesized in vitro using SP6 RNA polymerase according to the method of Cheng and Abelson (12). Biotinylated pre-mRNA was synthesized by following the procedure described by Chan et al. (6). Splicing assays were carried out according to the procedure of Cheng and Abelson (12).
Immunodepletion, immunoprecipitation, and precipitation of the spliceosome by streptavidin-Sepharose. Immunodepletion of NTC was performed as described by Chan et al. (6). Immunodepletion of Yju2 was performed by incubation of 100 µl of splicing extracts with 100 µl of the anti-Yju2 antibody coupled to 50 µl of protein A-Sepharose. Immunoprecipitation was performed as described by Tarn et al. (39) with anti-HA, anti-Ntc20, or anti-V5 antibody. Precipitation of the spliceosome with streptavidin Sepharose was carried out according to the procedure of Chan et al. (6).
Purification of Yju2 and Prp2. Histidine (His)-tagged full-length Yju2 was expressed in Escherichia coli under the control of the T7 promoter, and His, V5 double-tagged full-length Prp2 was expressed in yeast strain BJ2168 containing plasmid pYES2.PRP2-4V5 under the control of the GAL1 promoter. For construction of pYES2.PRP2-4V5, DNA generated by PCR using primers H6 and P2-5 and a DNA template isolated from yeast strain YSCC224 were digested with HindIII and ligated with HindIII-digested pYES2.PRP2 (14). His-tagged Yju2 and Prp2 were purified with a Ni affinity column (Novagen) according to the manufacturer's manual and Edwalds-Gilbert et al. (14), respectively. For purification of Yju2-HA from yeast, YJU2-HA extracts (600 µl) were incubated with 50 µl protein A-Sepharose conjugated with 120 µl of the anti-HA antibody at 4°C for 1 h. After unbound materials were washed off, the resin was resuspended in 50 µl of buffer DK (20 mM HEPES, pH 7.9, 60 mM KPO4, pH 7.0, 0.2 mM EDTA, 50 mM NaCl, and 20% glycerol) but without glycerol. The bound materials were then eluted by incubation at room temperature for 5 min with the HA peptide at a final concentration of 0.1 mM in buffer DK.
Dynamic interactions between Yju2 and NTC, spliceosome stability assays, UV cross-linking analysis, and primer extension analysis. For assay of the dynamic interactions between Yju2 and NTC, 200-µl aliquots of Yju2-depleted extracts were treated with 0.1 mg/ml of RNase A at 37°C for 10 min, followed by addition of 50 ng of recombinant Yju2 and incubation at 4°C for 30 min. Immunoprecipitation of HA-tagged proteins by the anti-HA antibody was performed as described by Tarn et al. (39). Spliceosome stability assays and UV cross-linking and primer extension analyses were performed according to the method of Chan et al. (6).
Yeast two-hybrid assays. YJU2, PRP19, NTC90, NTC85, NTC77, NTC31, NTC30, NTC25, and NTC20 were cloned into plasmid vectors pAS2 and pACT2 and individually transformed into yeast strains Y187 and PJ69-4A, respectively. Selected transformants were mated to yield diploid strains containing the pair pAS2-YJU2 and pACT2-NTC as well as pACT2-YJU2 and pAS2-NTC. Diploid cells were examined for Ade2 expression.
Preparation of E and complementation of the affinity-purified spliceosome formed in Yju2-depleted or prp2-1 extracts.
Yju2-depleted extracts were incubated at 100°C for 5 min, and insoluble materials were removed by centrifugation. The supernatant was then transferred to a new Eppendorf tube, and KPO4 (pH 7.0) was added to a final concentration of 60 mM. Heat-resistant extract fractions (E) were concentrated using Amicon Ultra centrifugal filter devices (Millipore) according to the recommended procedure. For complementation of the affinity-purified spliceosome formed in Yju2-depleted extracts, splicing reactions were carried out in Yju2-depleted extracts under normal conditions. Aliquots (20 µl) of the reaction mixture were precipitated with 1 µl of anti-Ntc20 antibody conjugated to 10 µl of protein A-Sepharose. After being washed, the precipitate was incubated at 25°C for 20 min with 30 µl of buffer DK without glycerol but containing 4 mM MgCl2, 0.8 U/µl RNasin, and 50 µg/ml tRNA, with or without 2 mM of ATP and in the presence or absence of 50 to 750 ng of recombinant Yju2, affinity-purified Yju2, or E. The mixture was centrifuged, and supernatant and pellet fractions were collected for further analysis. The method for complementation of the affinity-purified spliceosome formed in prp2-1 extracts was the same as that described above, except that after the splicing reaction, 5 or 10 mM glucose was added and the mixture incubated for 5 min to deplete ATP. Purified Prp2-4V5 was then added and the mixture was incubated for 10 min, and the Prp2-containing spliceosome was precipitated by 1.5 µl anti-V5 antibody conjugated to protein A-Sepharose.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
Yju2 is essential for pre-mRNA splicing in vivo. Sequence alignment of YJU2 orthologs shown in Fig. 2A reveals that although the amino-terminal half of the protein is conserved, the carboxy-terminal half is quite divergent. YJU2 is reported to be essential for yeast vegetative growth (15). The sequence does not have an obvious motif to indicate the possible function of the protein, except for a coiled-coil domain in the middle region of the protein. To see whether Yju2 is essential for splicing in vivo, we constructed a yeast strain in which the YJU2 gene was under the control of an inducible galactose promoter. A shift of cells to glucose-containing medium depleted the Yju2 protein, as shown in Fig. 2C, and led to growth arrest after 16 h, as shown in Fig. 2B. To see whether splicing was affected upon depletion of Yju2, RNA was isolated from cell cultures grown in galactose- or glucose-supplemented medium and subjected to primer extension analysis using a 5'-end-labeled primer complementary to a region in the second exon of the U3 gene (40). Figure 2D shows that two extension products representing pre-mRNA of U3A and U3B accumulated at 12 or 24 h after growth in glucose medium (lanes 5 and 6) but not in galactose medium (lanes 1 to 3) or in the wild-type control (lane 7). Similar extension products were also seen in the prp2-1 temperature-sensitive mutant after growth at restrictive temperatures for 2 h (lane 8). This indicates that in vivo depletion of Yju2 leads to a defect in pre-mRNA splicing and that Yju2 is required for splicing in vivo.
|
|
|
Yju2 is required for splicing after spliceosome activation. To determine whether Yju2 acts in spliceosome assembly before or after NTC, the spliceosome was assembled in NTC- or Yju2-depleted extracts by using biotinylated pre-mRNA, and components of the spliceosome were then isolated by precipitation with streptavidin-Sepharose and examined by Western blotting. Figure 5A shows that NTC components, exemplified by Prp19, Ntc85, Ntc30, and Ntc25, were present on the spliceosome formed in Yju2-depleted extracts (lane 6), while Yju2 was not present on the spliceosome formed in NTC-depleted extracts (lane 4). These results suggest that Yju2 is not required for the binding of NTC to the spliceosome, whereas NTC is required for the binding of Yju2 to the spliceosome. Thus, Yju2 is associated with the spliceosome after or concomitantly with the binding of NTC.
|
Yju2 and heat-resistant factors are required for an ATP-independent step of the first catalytic reaction. To examine how Yju2 is involved in the first catalytic reaction, the spliceosome was formed in Yju2-depleted extracts and was isolated by precipitation with the anti-Ntc20 antibody. Recombinant Yju2 (His-Yju2) was added to the precipitated spliceosome to see whether Yju2 was sufficient to promote the first catalytic reaction on the spliceosome formed in the absence of Yju2. Figure 6A shows that although small amounts of His-Yju2 could restore the splicing activity of the Yju2-depleted extract (lane 3), larger amounts of His-Yju2 failed to promote catalytic reactions on the affinity-isolated spliceosome (lanes 6 to 8). This indicates that Yju2 alone was not sufficient to promote splicing catalysis of the affinity-isolated activated spliceosome formed in Yju2-depleted extracts and that splicing might require another factor(s) to act in concert. Interestingly, affinity-purified Yju2 from Yju2-HA extracts using the anti-HA antibody did support the first catalytic reaction, albeit at a low activity level (lane 9), suggesting that this unidentified factor(s) might have been copurified with Yju2-HA from splicing extracts.
|
A heat-resistant protein factor, HP, was previously shown to be required for the first catalytic reaction after the Prp2 step (26). While HP has been partially purified, its identity has not yet been revealed. Judging from the order of its involvement in the first step, we speculated that Yju2 might be HP or might cooperate with HP to function in the first catalytic reaction after Prp2. To clarify the relationship between Yju2 and HP, extracts depleted of Yju2 were heat treated by boiling for 5 min, and the soluble materials (E) were used to complement the affinity-isolated spliceosome formed in Yju2-depleted extracts. As shown in Fig. 7A, heat-treated Yju2-depleted extracts (lane 4) or recombinant His-Yju2 (lane 5) only barely promoted the catalytic reaction. However, the heat-treated extract was able to promote the reaction when it was in combination with His-Yju2 (lane 6), and it greatly enhanced the activity of Yju2-HA affinity purified from yeast extracts (lanes 7 and 8). This suggests that Yju2 is distinct from HP and that HP is likely a factor copurified with Yju2-HA from splicing extracts that cooperates with Yju2 to promote catalysis following Prp2 action, although the association of Yju2 and HP was not quantitative.
|
E was added to the isolated spliceosome, a minute amount of splicing could be detected, but only in the presence of ATP (lanes 8 and 9). The splicing activity was greatly enhanced when both Yju2 and E were added (lane 10). This confirms that Prp2 binds to the spliceosome prior to the function of Yju2 and HP and that it allows Yju2 and HP to promote the catalytic reaction only after ATP hydrolysis. |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
Although Yju2 can be associated with NTC, Yju2 and NTC are not functionally linked. NTC is required for stabilization of U5 and U6 on the spliceosome through specifying interactions between U6 and the 5' splice site and between U5 and pre-mRNA during spliceosome activation (5, 6). Yju2 was determined to function after NTC, since depletion of Yju2 did not affect NTC-mediated spliceosome activation, as judged by assays for the stable association of U5 and U6 with the spliceosome, specific interactions between U6 and the 5' splice site (Fig. 5C), and destabilization of Sm-like proteins from U6 (data not shown). Complementation analysis of the affinity-isolated spliceosome formed in Yju2-depleted extracts further showed that Yju2 is involved in the first catalytic reaction and can function after the ATP-dependent Prp2 step. It is not unusual for splicing factors to be able to bind to the spliceosome early in the splicing reaction but to function only in later steps. Prp18 was shown to associate with U5 snRNP and presumably can be associated with the spliceosome upon binding of tri-snRNP, but it is involved only in the second step of pre-mRNA splicing (20). The NTR complex, which mediates spliceosome disassembly, is weakly associated with NTC, and it could bind to the spliceosome in association with NTC during spliceosome activation (40).
Unlike the other two identified step-one splicing factors, Spp2 and Prp2 (25, 27, 32), Yju2 appears to be more specifically associated with splicing intermediates. Precipitation of Yju2 from splicing reaction mixtures coprecipitated predominantly splicing intermediates as well as a smaller fraction of pre-mRNA and lariat-intron, suggesting that Yju2 becomes associated with the spliceosome prior to the catalytic step, more stably associated after the first catalytic reaction, and destabilized from the spliceosome as the second catalytic reaction proceeds. Thus, not only is Yju2 not functionally linked to NTC, but also it is distinct from NTC in its spliceosome binding pattern; NTC becomes associated with the spliceosome during spliceosome activation and remains stably associated until the reaction is complete.
Yju2 is involved in the step one reaction, but it interacts with neither Spp2 nor Prp2 in our yeast two-hybrid assays (data not shown). Considering that Prp2 and Spp2 are only transiently associated with the spliceosome during spliceosome assembly, it is unlikely that they are involved in recruiting Yju2 to the spliceosome by interacting with Yju2. In contrast, NTC is stably associated with the spliceosome and interacts with Yju2 in a dynamic manner. Such dynamic interaction might serve to mediate the recruitment of Yju2 to the spliceosome, adding another role for NTC besides its functional role in spliceosome activation. In fact, a component of NTC, Ntc30/Isy1, has also been shown to interact with Prp16, a DEXD/H-box RNA helicase involved in the second catalytic reaction, to regulate the fidelity of pre-mRNA splicing (42). This reveals multiple roles for NTC in the splicing reaction during its association with the spliceosome.
We have demonstrated that Yju2 can function after the Prp2 step, although there is no evidence that Prp2 has to function before Yju2. Yju2 alone is not sufficient to promote the catalytic reaction after the action of Prp2. A heat-resistant factor, analogous to the previously described HP (26), is also required. Yju2 is distinct from HP but might interact with it, since affinity-purified Yju2 from yeast extracts had a low level of activity in complementing the affinity-isolated spliceosome formed in Yju2-depleted extracts. The complementation activity was enhanced by the addition of a soluble fraction of the heat-treated extract, indicating that the amount of HP associated with Yju2 was limiting. It has been speculated that HP might interact with Yju2 in a dynamic manner, which results in the association of HP with a small fraction of Yju2 and vice versa. Thus, it is possible that HP also can bind to the spliceosome early in its association with Yju2. In fact, it has been suggested that HP could be associated with the spliceosome prior to Prp2, since a Prp2-bound spliceosome isolated from a low-salt glycerol gradient can perform the first catalytic reaction when it is incubated with ATP without the addition of any other protein factors (25). Consistent with this view, we found that affinity-purified NTC is also barely able to complement the affinity-isolated spliceosome formed in Yju2-depleted extracts (data not shown). These results strongly suggest that dynamic interactions between Yju2, HP, and NTC (Fig. 8), leading to the formation of a complex containing Yju2, HP, and NTC, play important roles in the recruitment of Yju2 and HP to the spliceosome for the first catalytic reaction.
The function of Yju2 in step one of splicing is not known. Prp2 is presumed to mediate a conformational change in the spliceosome upon hydrolyzing ATP prior to the catalytic reaction. Like HP, Yju2 functions after the Prp2 step and does not require ATP for its action. Yju2 and HP might be required for further structural changes to the spliceosome to juxtapose the 5' splice site and the branch site so that the catalytic reaction can take place. Since both proteins can bind to the spliceosome in association with NTC in a manner independent of their later action, it cannot be distinguished whether they function sequentially or must act in concert in mediating the final structural rearrangement of the spliceosome to allow the catalytic reaction.
The second catalytic reaction also involves ATP-dependent and ATP-independent steps. Prp17 and Prp16 function in an ATP-dependent manner, followed by the ATP-independent, sequential action of Slu7, Prp18, and Prp22 (21, 22). However, precursor mRNAs in which the 3' splice site is close to the branch point can be spliced efficiently in the absence of Slu7, Prp18, or Prp22 (3, 33, 46). When the distance from the branch point to the 3' splice site is greater than 12 nucleotides, Slu7 and Prp18 are required for splicing of such pre-mRNA. Prp22 is required only when the distance is greater than 21 nucleotides (3, 33, 46). These proteins are thus thought to play a role in bringing a distant 3' splice site into the catalytically active site of the spliceosome during the second catalytic reaction. However, the exact part of the pre-mRNA with which each step one factor interacts is unknown. Whether the requirement of Yju2 and HP for the ATP-independent step is dispensable for splicing of selected classes of pre-mRNA remains to be investigated.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by Academia Sinica and National Science Council (Taiwan) Grant NSC94-2321-B-001-021.
|
FOOTNOTES |
|---|
Published ahead of print on 21 May 2007.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Brow, D. A. 2002. Allosteric cascade of spliceosome activation. Annu. Rev. Genet. 36:333-360.[CrossRef][Medline]
3. Brys, A., and B. Schwer. 1996. Requirement for SLU7 in yeast pre-mRNA splicing is dictated by the distance between the branchpoint and the 3' splice site. RNA 2:707-717.[Abstract]
4. Burge, C. B., T. H. Tuschl, and P. A. Sharp. 1999. Splicing of precursors to mRNAs by the spliceosome, p. 525-560. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), RNA world II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
5. Chan, S.-P., and S.-C. Cheng. 2005. The Prp19-associated complex is required for specifying interactions of U5 and U6 with pre-mRNA during spliceosome activation. J. Biol. Chem. 280:31190-31199.
6. Chan, S.-P., D.-I. Kao, W.-Y. Tsai, and S.-C. Cheng. 2003. The Prp19p-associated complex in spliceosome activation. Science 302:279-282.
7. Chen, C.-H., D.-I. Kao, S.-P. Chan, T.-C. Kao, J.-Y. Lin, and S.-C. Cheng. 2006. Functional links between the Prp19-associated complex, U4/U6 biogenesis and spliceosome recycling. RNA 12:765-774.
8. Chen, C.-H., W.-Y. Tsai, H.-R. Chen, C.-H. Wang, and S.-C. Cheng. 2001. Identification and characterization of two novel components of the Prp19p-associated complex, Ntc30p and Ntc20p. J. Biol. Chem. 276:488-494.
9. Chen, C.-H., W.-C. Yu, T. Y. Tsao, L.-Y. Wang, H.-R. Chen, J.-Y. Lin, W.-Y. Tsai, and S.-C. Cheng. 2002. Functional and physical interactions between components of the Prp19p-associated complex. Nucleic Acids Res. 30:1029-1037.
10. Chen, H.-R., S.-P. Jan, T. Y. Tsao, Y.-J. Sheu, J. Banroques, and S.-C. Cheng. 1998. Snt309p, a component of the Prp19p-associated complex that interacts with Prp19p and associates with the spliceosome simultaneously with or immediately after dissociation of U4 in the same manner as Prp19p. Mol. Cell. Biol. 18:2196-2204.
11. Chen, H.-R., T. Y. Tsao, C.-H. Chen, W.-Y. Tsai, L.-S. Her, M.-T. Hsu, and S.-C. Cheng. 1999. Snt309p modulates interactions of Prp19p with its associated components to stabilize the Prp19p-associated complex essential for pre-mRNA splicing. Proc. Natl. Acad. Sci. USA 96:5406-5411.
12. Cheng, S.-C., and J. Abelson. 1987. Spliceosome assembly in yeast. Genes Dev. 1:1014-1027.
13. Cheng, S.-C., A. Newman, R.-J. Lin, G. D. McFarland, and J. N. Abelson. 1990. Preparation and fractionation of yeast splicing extract. Methods Enzymol. 181:89-96.[Medline]
14. Edwalds-Gilbert, G., D.-H. Kim, S.-H. Kim, Y.-H. Tseng, Y. Yu, and R.-J. Lin. 2000. Dominant negative mutants of the yeast splicing factor Prp2 map to a putative cleft region in the helicase domain of DExD/H-box proteins. RNA 6:1106-1119.[Abstract]
15. Forrova, H., J. Kolarov, M. Ghislain, and A. Goffeau. 1992. Sequence of the novel essential gene YJU2 and two flanking reading frames located within a 3.2 kb EcoRI fragment from chromosome X of Saccharomyces cerevisiae. Yeast 8:419-422.[CrossRef][Medline]
16. Gavin, A., M. Bösche, R. Krause, P. Grandi, M. Marzioch, A. Bauer, J. Schultz, J. M. Rick, A. Michon, C. Cruciat, M. Remor, C. Höfert, M. Schelder, M. Brajenovic, H. Ruffner, A. Merino, K. Klein, M. Hudak, D. Dickson, T. Rudi, V. Gnau, A. Bauch, S. Bastuck, B. Huhse, C. Leutwein, M. Heartier, R. R. Copley, A. Edelmann, E. Querfurth, V. Rybin, G. Drewes, M. Raida, T. Bouwmeester, P. Bork, B. Seraphin, B. Kuster, G. Neubauer, and G. Superti-Furga. 2002. Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415:141-147.[CrossRef][Medline]
17. Hartmuth, K., H. Urlaub, H. P. Vornlocher, C. L. Will, M. Gentzel, M. Wilm, and R. Lührmann. 2002. Protein composition of human prespliceosomes isolated by a tobramycin affinity-selection method. Proc. Natl. Acad. Sci. USA 99:16719-16724.
18. Hazbun, T. R., L. Malmström, S. Anderson, B. J. Graczyk, B. Fox, M. Riffle, B. A. Sundin, D. Aranda, W. H. McDonald, C.-H. Chiu, B. E. Snydsman, P. Bradley, E. G. D. Muller, S. Fields, D. Baker, J. R. I. Yates, and T. N. Davis. 2003. Assigning function to yeast proteins by integration of technologies. Mol. Cell 12:1353-1365.[CrossRef][Medline]
19. Horowitz, D. S., and J. Abelson. 1993. Stages in the second reaction of pre-mRNA splicing: the final step is ATP independent. Genes Dev. 7:320-329.
20. Horowitz, D. S., and J. Abelson. 1993. A U5 small nuclear ribonucleoprotein particle protein involved only in the second step of pre-mRNA splicing in Saccharomyces cerevisiae. Mol. Cell. Biol. 13:2959-2970.
21. James, S., W. Tirmer, and B. Schwer. 2002. How Slu7 and Prp18 cooperate in the second step of yeast pre-mRNA splicing. RNA 8:1068-1077.[Abstract]
22. Jones, M. H., D. N. Frank, and C. Guthrie. 1995. Characterization and functional ordering of Slu7p and Prp17p during the second step of pre-mRNA splicing in yeast. Proc. Natl. Acad. Sci. USA 92:9687-9691.
23. Jurica, M. S., L. J. Licklider, S. R. Gygi, N. Grigorieff, and M. J. Moore. 2002. Purification and characterization of native spliceosomes suitable for three-dimensional structural analysis. RNA 8:426-439.[Abstract]
24. Kanehisa, M., S. Goto, S. Kawashima, and A. Nakaya. 2002. The KEGG databases at GenomeNet. Nucleic Acids Res. 30:42-46.
25. Kim, S.-H., and R.-J. Lin. 1993. Pre-mRNA splicing within an assembled yeast spliceosome requires an RNA-dependent ATPase and ATP hydrolysis. Proc. Natl. Acad. Sci. USA 90:888-892.
26. Kim, S.-H., and R.-J. Lin. 1996. Spliceosome activation by PRP2 ATPase prior to the first transesterification reaction of pre-mRNA splicing. Mol. Cell. Biol. 16:6810-6819.[Abstract]
27. King, D. S., and J. D. Beggs. 1990. Interactions of PRP2 protein with pre-mRNA splicing complexes in Saccharomyces cerevisiae. Nucleic Acids Res. 18:6559-6564.
28. Last, R. L., J. R. Maddock, and J. L. J. Woolford. 1987. Evidence for related functions of the RNA genes of Saccharomyces cerevisiae. Genetics 117:619-631.
29. Lin, R.-J., A. J. Lustig, and J. Abelson. 1987. Splicing of yeast nuclear pre-mRNA in vitro requires a functional 40S spliceosome and several extrinsic factors. Genes Dev. 1:7-18.[Medline]
30. Ohi, M. D., and K. L. Gould. 2002. Characterization of interactions among the Cef1p-Prp19p-associated splicing complex. RNA 8:798-815.[Abstract]
31. Ohi, M. D., A. J. Link, L. Ren, J. L. Jennings, W. H. McDonald, and K. L. Gould. 2002. Proteomics analysis reveals stable multiprotein complexes in both fission and budding yeasts containing Myb-related Cdc5p/Cef1p, novel pre-mRNA splicing factors, and snRNAs. Mol. Cell. Biol. 22:2011-2024.
32. Roy, J., K. Kim, J. R. Maddock, J. G. Anthony, and J. Woolford. 1995. The final stages of spliceosome maturation require Spp2p that can interact with the DEAH box protein Prp2p and promote step 1 of splicing. RNA 1:375-390.[Abstract]
33. Schwer, B., and C. H. Gross. 1998. Prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing. EMBO J. 17:2086-2094.[CrossRef][Medline]
34. Schwer, B., and C. Guthrie. 1992. A conformational rearrangement in the spliceosome is dependent on PRP16 and ATP hydrolysis. EMBO J. 11:5033-5040.[Medline]
35. Silverman, E. J., A. Maeda, J. Wei, P. Smith, J. D. Beggs, and R.-J. Lin. 2004. Interaction between a G-patch protein and a spliceosome DEXD/H-box ATPase that is critical for splicing. Mol. Cell. Biol. 24:10101-10110.
36. Staley, J. P., and C. Guthrie. 1998. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92:315-326.[CrossRef][Medline]
37. Tarn, W.-Y., C.-H. Hsu, K.-T. Huang, H.-R. Chen, H.-Y. Kao, K.-R. Lee, and S.-C. Cheng. 1994. Functional association of essential splicing factor(s) with PRP19 in a protein complex. EMBO J. 13:2421-2431.[Medline]
38. Tarn, W.-Y., K.-R. Lee, and S.-C. Cheng. 1993. Yeast precursor mRNA processing protein PRP19 associates with the spliceosome concomitant with or just after dissociation of U4 small nuclear RNA. Proc. Natl. Acad. Sci. USA 90:10821-10825.
39. Tarn, W.-Y., K.-R. Lee, and S.-C. Cheng. 1993. The yeast PRP19 protein is not tightly associated with small nuclear RNAs but appears to associate with the spliceosome after binding of U2 to the pre-mRNA and prior to formation of the functional spliceosome. Mol. Cell. Biol. 13:1883-1891.
40. Tsai, R.-T., R.-H. Fu, F.-L. Yeh, C.-K. Tseng, Y.-C. Lin, Y.-H. Huang, and S.-C. Cheng. 2005. Spliceosome disassembly catalyzed by Prp43 and its associated components Ntr1 and Ntr2. Genes Dev. 19:2991-3003.
41. Tsai, W.-Y., Y.-T. Chow, H.-R. Chen, K.-T. Huang, R.-I. Hong, S.-P. Jan, N.-Y. Kuo, T. Y. Tsao, C.-H. Chen, and S.-C. Cheng. 1999. Cef1p is a component of the Prp19p-asociated complex and essential for pre-mRNA splicing. J. Biol. Chem. 274:9455-9462.
42. Villa, T., and C. Guthrie. 2005. The Isy1p component of the NineTeen Complex interacts with the ATPase Prp16p to regulate the fidelity of pre-mRNA splicing. Genes Dev. 19:1894-1904.
43. Wang, Q., K. Hobbs, B. Lynn, and B. C. Rymond. 2003. The Clf1p splicing factor promotes spliceosome assembly through N-terminal tetratricopeptide repeat contacts. J. Biol. Chem. 278:7875-7883.
44. Will, C. L., and R. Lührmann. 1997. Protein functions in pre-mRNA splicing. Curr. Opin. Biol. 9:320-328.[CrossRef]
45. Winston, F., F. Chumley, and G. R. Fink. 1983. Eviction and transplacement of mutant genes in yeast. Methods Enzymol. 101:211-228.[Medline]
46. Zhang, X., and B. Schwer. 1997. Functional and physical interaction between the yeast splicing factors Slu7 and Prp18. Nucleic Acids Res. 25:2146-2152.
47. Zhou, Z., L. J. Licklider, S. P. Gygi, and R. Reed. 2002. Comprehensive proteomic analysis of the human spliceosome. Nature 419:182-185.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
