This Article Abstract Full Text (PDF) Other Versions of this Article: MCB.02273-06v1 27/17/5957    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bai, L. Articles by Wang, D. Search for Related Content PubMed PubMed Citation Articles by Bai, L. Articles by Wang, D.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, September 2007, p. 5957-5967, Vol. 27, No. 17
0270-7306/07/$08.00+0     doi:10.1128/MCB.02273-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Phospholipase C2 Contributes to Light-Chain Gene Activation and Receptor Editing

Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226,¹ Dali University, Dali, Yunnan 671000, People's Republic of China,² School of Preclinical Medicine, Sun Yat-Sen University, Guangzhou, Guangdong 510080, People's Republic of China,³ State Key Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093, People's Republic of China,⁴ Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin 53226⁵

Received 5 December 2006/ Returned for modification 17 January 2007/ Accepted 24 May 2007

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Phospholipase C2 (PLC2) is critical for pre-B-cell receptor (pre-BCR) and BCR signaling. Current studies discovered that PLC2-deficient mice had reduced immunoglobulin (Ig) light-chain usage throughout B-cell maturation stages, including transitional type 1 (T1), transitional type 2 (T2), and mature follicular B cells. The reduction of Ig rearrangement by PLC2 deficiency was not due to specifically increased apoptosis or decreased proliferation of mutant Ig⁺ B cells, as lack of PLC2 exerted a similar effect on apoptosis and proliferation of both Ig⁺ and Ig⁺ B cells. Moreover, PLC2-deficient Ig^HEL transgenic B cells exhibited an impairment of antigen-induced receptor editing among both the endogenous and loci in vitro and in vivo. Importantly, PLC2 deficiency impaired BCR-induced expression of IRF-4 and IRF-8, the two transcription factors critical for and light-chain rearrangements. Taken together, these data demonstrate that the PLC2 signaling pathway plays a role in activation of light-chain loci and contributes to receptor editing.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
During B-cell development, pro-B cells begin the process of immunoglobulin (Ig) heavy (H) gene rearrangement (1, 8, 38, 50). Successful rearrangement of Ig H-chain variable (V), diversity (D), and joining (J) gene segments leads to the formation of the pre-B-cell receptor (pre-BCR), which contains the newly generated H chain in complex with the Vpre-B/5 surrogate light (L) chain. Signals from the pre-BCR instruct pre-B cells to expand and halt further H-chain VDJ rearrangement to ensure allelic exclusion (15, 30, 39). Subsequently, the rapidly proliferating pre-B cells exit the cell cycle and undergo rearrangement of Ig L-chain V and J gene segments. The Ig L chain is encoded by the and loci. Rearrangements within the and L-chain loci occur independently with a sequential activation of the and loci (2, 10, 39, 72). In mice, the locus comprises 70 to 90 functional V and four functional J gene segments whereas the locus contains three functional V and three functional J segments (2, 55). It is believed that the kinetics and efficiency of gene segment rearrangements as well as the number of functional V and V gene segments largely determine the ratio of Ig⁺ to Ig⁺ mature B cells (2, 10, 14, 72). In mice, the ratio is 95% to 5% (14, 61). A successfully rearranged L chain in combination with the previously rearranged H chain generates a surface IgM form of the BCR. B cells with a functional BCR quickly progress into immature B cells and emerge from bone marrow (BM) into the spleen (16, 20). In the spleen, signals emanating from the BCR direct immature B cells to mature through transitional B cells of type 1 (T1) and type 2 (T2) stages and thereafter to long-lived follicular B cells (34). Deletion of the BCR not only arrests B-cell development but also causes apoptosis (25, 27).

To establish B-cell tolerance, immature B cells expressing a self-reactive BCR are negatively selected during maturation by several distinct mechanisms, including clonal deletion, clonal anergy, and receptor editing (20, 42, 45, 49, 50, 56). The BCR signaling threshold appears to regulate the negative selection process. Highly self-reactive cells recognizing membrane-bound self antigens are eliminated by clonal deletion (17, 43), whereas self-reactive cells recognizing soluble self antigens become unresponsive to antigens, a state termed anergy (13). Moreover, self-reactive immature B cells can initiate new rearrangements of V genes, mainly at L-chain loci, to change receptor specificity by receptor editing (5, 7, 12, 48, 63). However, the mechanism that regulates the sequential activation of the and loci for recombination and the initiation of receptor editing in self-reactive B cells is not clear. Elevation of RAG1 and RAG2 mRNA levels has been observed during receptor editing in B cells (21, 36, 37). Although signals from the BCR have been shown to be involved (33, 67), the basis of this RAG up-regulation is not known. IRF-4 and IRF-8 are two members of the interferon regulatory factor (IRF) family of transcription factors whose expression can be induced by BCR engagement (9, 35, 62). Studies have implied important roles for both IRF-4 and IRF-8 in regulating L-chain rearrangements (4, 40, 46, 59). Importantly, lack of both IRF-4 and IRF-8 prevents rearrangements of Ig L-chain but not H-chain genes during B-cell development (31).

The BCR initiates signaling cascades via the two transmembrane molecules Ig and Igß and sequential activation of members of three distinct families of cytoplasmic protein tyrosine kinases, including Lyn, Syk, and Btk (22, 24, 64). Subsequent recruitment and tyrosine phosphorylation of the adapter protein, B-cell linker protein (BLNK), and transmembrane protein CD19 facilitate activation of the lipid kinase phosphatidylinositol 3-kinase (22, 26, 44, 51). An important outcome of these events is activation of phospholipase C2 (PLC2), which hydrolyzes phosphatidylinositol 4,5-bisphosphate to generate diacylglycerol and inositol 1,4,5-trisphosphate, both of which are required second messengers for cellular responses (53, 54). PLC2-deficient mice exhibit impaired early and late B-cell development, and PLC2-deficient B cells are unable to respond to antigens, demonstrating that PLC2 plays an essential role in B-cell development and function (18, 68-70). Our current studies demonstrate that PLC2 plays an important role in activation of the L-chain loci for recombination and receptor editing of self-reactive B cells.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Mice. PLC2-deficient mice were generated previously (68) and have been backcrossed to the C57BL/6 background. Ig^HEL transgenic mice (C57BL/6 MD4), which bear rearranged Ig H- and Ig L-chain genes that encode a hen egg lysozyme (HEL)-specific BCR, and sHEL transgenic mice (C57BL/6 ML5), which express soluble HEL (sHEL), were obtained from the Jackson Laboratory. These transgenic mice were bred with heterozygous PLC2^+/– mice to ultimately generate wild-type Ig^HEL, PLC2-deficient Ig^HEL, wild-type Ig^HEL sHEL, and PLC2-deficient Ig^HEL sHEL mice. Mice used for the experiments were generally 8 to 12 weeks of age except where specifically indicated.

Induction of receptor editing in vitro. BM cells were isolated from the indicated mice and were depleted of red blood cells by lysis with Gey's solution (0.15 M NH₄Cl, 1 mM KHCO₃, and 0.1 mM Na₂EDTA). The cells (2 x 10⁶ cells/ml) were cultured in complete medium RPMI 1640 containing 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 ng/ml interleukin-7 (IL-7) (R&D Systems) for 5 days. Then, cells were washed extensively with phosphate-buffered saline (PBS) and recultured at 1 x 10⁶ cells/ml in complete medium without IL-7 and in the presence or absence of HEL (500 ng/ml) (lysozyme-biotin-caproyl; lot no. 071k1567; Sigma). After a further 2-day culture, the cells were harvested for analysis of chain protein expression and chain gene rearrangements.

Splenocytes (2 x 10⁶/ml) from the indicated mice were cultured in complete medium in the presence or absence of freshly added HEL (500 ng/ml). After a 2-day culture, the cells were harvested for analysis of chain protein expression and chain gene rearrangements.

Detection of and chain gene rearrangements. Genomic DNA was isolated from the indicated cells and was quantified by semiquantitative PCR amplification of the ß-actin gene (5' primer, ACTCCTATGTGGGTGACGAG; 3' primer, CAGGTCCAGACGCAGGATGGC). The genomic DNA then was subjected to semiquantitative PCR analysis of endogenous or chain gene rearrangement. Primers employed in the PCR were the same as previously described (41, 73). Specifically, V1/2 (AGAAGCTTGTGACTCAGGAATCTGCA) and J1 (CAGGATCCTAGGACAGTCAGTTTGGT) primers were used to amplify 1 rearrangements, V2 (ACTGGTCTAATCGGTGGTACCAG) and C2 (AGGAAGCTGCTGGCCATGAACTTGTTGC) primers were used to amplify 2 rearrangements, and Vx (GAGCTTAAGAAAGATGGAAGCCA) and C2 primers were used to amplify x rearrangements. The V degenerate primer (GGCTGCAGSTTCAGTGGCAGTGGRTCW) and the reverse primer downstream of the J1 coding region (GTTCTTTGCCTTGGAGAGTGCCAGAATC) were used to amplify V-J1 rearrangement (11, 21). PCRs were performed as previously described (47, 65). Briefly, the PCR was carried out in a 25-µl final volume containing 0.5 µl of deoxynucleoside triphosphate (10 mM), 1 µl of the primers (10 µM), 2.5 µl of 10x PCR buffer, 5 µl 5x Q solution, 2.5 units of Taq enzyme (QIAGEN), and a serial dilution of template (25 to 1 ng). For detection of chain gene rearrangement, cycling conditions were 94°C for 4 min followed by 42 cycles of 94°C for 20 s, 60°C for 30 s, and 72°C for 90 s and a final extension step at 72°C for 5 min. For detection of V-J1 rearrangement, cycling conditions were 97°C for 45 s, 70°C for 1 min, and 72°C for 2.5 min for five cycles; followed by 94°C for 45 s, 70°C for 1 min, and 72°C for 2.5 min for another 29 to 32 cycles; and final extension at 72°C for 6 min.

PCR detection of recombination sequence (RS) rearrangement in the genomic DNA from the indicated cells was performed as previously described (19). Briefly, the primers within the J intron (CTGACTGCAGGTAGCGTGGTCTTCTAG) and downstream of the recombination signal sequence (RSS) (TTGACTGTTTGCTACTTCAGCTCACTG) were used. Cycling conditions were 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min for 35 cycles. Products were separated by electrophoresis in a 1% agarose gel, transferred to a nylon membrane, and hybridized with ³²P-labeled 3' primer. Genomic DNA was quantified by semiquantitative PCR amplification of the ß-actin gene.

Flow cytometry. Single-cell suspensions of spleen and BM cells were treated with Gey's solution to remove red blood cells. Freshly isolated or cultured cells were resuspended in PBS supplemented with 2% fetal bovine serum and then stained with a combination of fluorescence-conjugated antibodies. CyChrome-conjugated anti-B220 (150452) and allophycocyanin-conjugated anti-IgM (17-5790-82) antibodies were purchased from eBioscience. Phycoerythrin (PE)-conjugated anti-IgD (1120-09L), PE-conjugated anti-Ig (1170-09), and PE-conjugated anti-Ig (1175-09L) antibodies were purchased from Southern Biotechnology. Fluorescein isothiocyanate (FITC)-conjugated anti-Ig (553434) antibodies were purchased from BD Biosciences. Samples were applied to a flow cytometer (LSRII; BD Biosciences), and data were collected and analyzed using CellQuest software (BD Biosciences). For all analyses, forward and side scatter gates were set to include viable cells and to exclude dead cells and debris.

TUNEL assay. Single-cell suspensions of spleen and BM cells were stained with a combination of CyChrome-conjugated anti-B220 and PE-conjugated anti-Ig or PE-conjugated anti-Ig antibodies. Then, the cells were washed with PBS, fixed for 2 h in 4% paraformaldehyde in PBS at room temperature, permeabilized with 0.1% Triton X-100 and 0.1% sodium citrate for 2 min on ice, and labeled with FITC-conjugated terminal deoxynucleotidyltransferase dUTP nick-end labeling (TUNEL) enzyme for 1 h in moist darkness at 37°C according to the manufacturer's instructions (In Situ Cell Death Detection Kit; Roche). The degree of TUNEL positivity in the gated B220⁺ Ig⁺ or B220⁺ Ig⁺ subpopulation was analyzed by flow cytometry using CellQuest software.

BrdU incorporation assay. The in vivo 5-bromo-2'-deoxyuridine (BrdU) staining assay was performed as previously described (71). Briefly, mice were injected intraperitoneally with 1 mg BrdU in 200 µl PBS at 12-h intervals for 5 days. Single-cell suspensions of spleen and BM cells were stained with a combination of CyChrome-conjugated anti-B220 and PE-conjugated anti-Ig or PE-conjugated anti-Ig antibodies at 4°C for 30 min. The cells were washed with PBS, resuspended in ice-cold 0.15 M saline, and incubated on ice for 30 min with the addition of 95% ethanol. After washing, the cells were fixed with 1% paraformaldehyde containing 0.01% Tween 20 for 1 h at room temperature. Lastly, the cells were incubated with 50 Kunitz units/ml DNase at 37°C for 10 min, washed with PBS, and stained with FITC-conjugated anti-BrdU antibody (34783; BD Biosciences). The degree of BrdU positivity in the gated B220⁺ Ig⁺ or B220⁺ Ig⁺ subpopulation was analyzed by flow cytometry using CellQuest software.

Real-time quantitative RT-PCR analysis. Total RNA was isolated from the indicated cells, and first-strand cDNA was synthesized from the total RNA with the OneStep reverse transcription-PCR (RT-PCR) kit (210210; QIAGEN) using random primers (HFR704; Gibco) according to the manufacturer's protocols. Real-time PCR was performed to quantitate germ line transcription of V and V using the following primers (23, 57): germ line 5' primer, AGGAGGGTTTTTGTACAGCCAGA; germ line 3' primer, TGGATGGTGGGAAGATGGAT; 2 germ line 5' primer, GCTGTGAGAGAACAGGACCA; 2 germ line 3' primer, CTCGGGGAAAAGTTGGAAAT. Levels of V and V germ line transcription were normalized to ß-actin abundance. The primers used for ß-actin were as follows: 5' primer, CCACAGCTGAGAGGGAAATC, and 3' primer, CTTCTCCAGGGAGGAAGAGG. Real-time PCR was performed to analyze IRF-4 and IRF-8 gene expression using the following primers: IRF-4 5' primer, AGATTCCAGGTGACTCTGTG; IRF-4 3' primer, CTGCCCTGTCAGAGTATTTC; IRF-8 5' primer, GGGAAGTTTAAAGAGGGAGA; IRF-8 3' primer, GATCAGCTCCTCAATCTCTG. Levels of IRF-4 and IRF-8 transcript were normalized to CD19 abundance. The primers used for CD19 were as follows: 5' primer, AATCCACGCATTCAAGTCCAG, and 3' primer, GAGCCCTCCTCGCTGTCTG. Real-time PCR was carried out in duplicate or triplicate at 50°C for 2 min and then 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min in an iCycler-iQ (Bio-Rad) in 25-µl reaction volumes containing cDNA, primers, and IQ Supermix (170-8862; Bio-Rad). SYBR green was used as the detection reagent. Data were analyzed using standard curves generated for each sample by a series of four consecutive 10-fold dilutions (1 x 10¹ to 1 x 10⁴) of the cDNA template and using iQ Cycler analyzing software and relative transcription calculated using the threshold cycle method. The specificity of the RT-PCR was controlled by the generation of melting curves, PCR efficiencies were 100% ± 15%, and correlation coefficients were 0.988 to 1.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
PLC2-deficient mice have reduced Ig L-chain usage throughout B-cell maturation. To determine whether PLC2 plays a role in L-chain gene rearrangement, we examined the expression of Ig and Ig L chains in PLC2-deficient mice, which were generated previously (68). First, BM cells were stained with an antibody specific for the Ig or Ig L-chain constant regions in conjunction with anti-B220 antibody. The proportion of BM B cells that expressed Ig L chain was markedly reduced in PLC2-deficient mice relative to wild-type mice (Fig. 1A and B). In contrast, the proportion of BM B cells that expressed Ig L chain was comparable or slightly increased in PLC2-deficient mice relative to wild-type mice (Fig. 1A). Next, the expression of Ig or Ig L chain in splenic B cells was examined. Again, the fraction of splenic B cells expressing Ig was markedly reduced in PLC2-deficient mice relative to wild-type mice (Fig. 1C and D), whereas the fraction of splenic B cells expressing Ig was comparable between PLC2-deficient and wild-type mice (Fig. 1C). Therefore, PLC2 deficiency reduces the subpopulation of B cells that express Ig.

View larger version (28K): [in this window] [in a new window]   FIG. 1. Reduction of Ig chain expression in PLC2-deficient B cells. (A) BM cells were isolated from wild-type (PLC2+/+) and PLC2-deficient (PLC2–/–) mice and stained with a combination of anti-B220 and anti-Ig or anti-Ig antibodies. Percentages indicate Ig+ or Ig+ B cells in the gated live B220+ lymphoid population. Data are representative of 10 mice per genotype. (B) Statistical analysis of the percentages of Ig+ B cells in the gated live BM B220+ lymphoid population from panel A (n = 10; *, P < 0.01). (C) Splenocytes were isolated from PLC2+/+ and PLC2–/– mice and stained with a combination of anti-B220 and anti-Ig or anti-Ig antibodies. Percentages indicate Ig+ or Ig+ B cells in the gated live B220+ lymphoid population. Data are representative of 10 mice per genotype. (D) Statistical analysis of the percentages of Ig+ B cells in the gated live splenic B220+ lymphoid population from panel C (n = 10; *, P < 0.01).

View larger version (33K): [in this window] [in a new window]   FIG. 2. Reduction of Ig chain expression during B-cell development in PLC2-deficient mice. (A) BM cells were isolated from wild-type (PLC2+/+) and PLC2-deficient (PLC2–/–) mice and stained with a combination of anti-B220, anti-IgM, anti-IgD, and anti-Ig antibodies. Based on expression of IgM and IgD, late BM B cells were defined as IgM+ IgD– immature B-cell (I), IgM+ IgDlow transitional B-cell (II), and IgM+ IgD+ mature B-cell (III) subpopulations (top). The expression of B220 and Ig in the gated B-cell subpopulations (I, II, and III) was analyzed (bottom). Percentages indicate Ig+ B cells in the gated B-cell subpopulation. Data are representative of eight mice per genotype. (B) Statistical analysis of the percentages of Ig+ B cells in the gated B-cell subpopulation from panel A (n = 8; *, P < 0.01). (C) Splenocytes were isolated from wild-type and PLC2-deficient mice and stained with a combination of anti-B220, anti-IgM, anti-IgD, and anti-Ig antibodies. Based on expression of IgM and IgD, splenic B cells were defined as IgMhi IgD– T1 B-cell (I), IgMhi IgD+ T2 B-cell (II), and IgMlo IgD+ mature B-cell (III) subpopulations (top). The expression of B220 and Ig in the gated B-cell subpopulations (I, II, and III) was analyzed (bottom). Percentages indicate Ig+ B cells in the gated B-cell subpopulation. Data are representative of eight mice per genotype. (D) Statistical analysis of the percentages of Ig+ B cells in the gated B-cell subpopulation from panel C (n = 8; *, P < 0.01).

Reduced Ig usage as a consequence of PLC2 deficiency is not due to increased apoptosis or decreased proliferation of PLC2-deficient Ig⁺ relative to Ig⁺ B cells.

View larger version (23K): [in this window] [in a new window]   FIG. 3. Comparable rates of apoptosis and proliferation of Ig+ and Ig+ B cells in wild-type and PLC2-deficient mice. Freshly isolated BM cells (A) and splenocytes (B) from wild-type (PLC2+/+) and PLC2-deficient (PLC2–/–) mice were stained with a combination of anti-B220 and anti-Ig or anti-Ig antibodies. Apoptotic cells were identified by TUNEL staining, and percentages indicate TUNEL-positive cells in the gated B220+ Ig+ and B220+ Ig+ BM or splenic B-cell populations. BM cells (C) and splenocytes (D) from wild-type (PLC2+/+) and PLC2-deficient (PLC2–/–) mice that were injected with BrdU every 12 h for 5 days (5 days) were stained with a combination of anti-BrdU, anti-B220, and anti-Ig or anti-Ig antibodies. Mice that were not injected with BrdU served as the baseline control (0 day). The degree of BrdU-positive proliferating cells in the gated B220+ Ig+ or B220+ Ig+ BM or splenic B-cell populations was determined by flow cytometry, and percentages indicate BrdU-positive cells in the gated cells. The figure shown is representative of five independent analyses.

PLC2 plays a role in receptor editing. Receptor editing involves new Ig gene rearrangements, particularly at L-chain loci, and is accompanied by increased Ig usage (5, 52, 63). The impaired Ig usage by PLC2-deficient B cells prompted us to examine the role of PLC2 in receptor editing. PLC2-deficient mice were crossed with Ig^HEL transgenic mice, which bear rearranged H- and Ig L-chain genes encoding a BCR that specifically recognizes HEL (13). BM cells from wild-type or PLC2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand the virtually uniform B-cell population that expresses the Ig^HEL BCR (data not shown). Consistent with a previous study (65), BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells from wild-type transgenic mice underwent receptor editing and rearranged endogenous L-chain genes in response to HEL stimulation in vitro, resulting in a detectable fraction of cells expressing Ig. In contrast, following HEL stimulation, BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells from PLC2-deficient mice exhibited a small but constant reduction in the population of cells expressing Ig compared to wild-type cells. Of note, both the wild-type and PLC2-deficient BM-derived (Fig. 4A) and freshly isolated splenic (Fig. 4B) Ig^HEL B cells exhibited low background expression of endogenous Ig when cultured with medium alone. Therefore, PLC2 deficiency reduces antigen-induced expression of Ig associated with receptor editing in vitro.

View larger version (30K): [in this window] [in a new window]   FIG. 4. Impairment of antigen-induced receptor editing in PLC2-deficient B cells. Antigen-induced receptor editing is impaired in PLC2-deficient BM-derived (A) and splenic (B) IgHEL B cells in vitro. BM cells from wild-type or PLC2-deficient IgHEL transgenic mice were initially cultured for 5 days with IL-7, and splenocytes were isolated from wild-type or PLC2-deficient IgHEL transgenic mice. The cells were then recultured without IL-7 and in the absence (medium) or presence (HEL) of HEL. After a further 2-day culture, the cells were harvested and stained with anti-B220 and anti-Ig antibodies. Percentages indicate Ig+ cells in the gated B220+ B lymphocytes. Data are representative of three independent experiments. Antigen-induced receptor editing is impaired in PLC2-deficient BM (C) and splenic (D) IgHEL B cells in vivo. BM cells from 21-week-old wild-type or PLC2-deficient IgHEL sHEL mice were stained with anti-B220, anti-IgM, and anti-Ig antibodies. Fluorescence-activated cell sorting analysis with B220 and Ig staining of IgM+ gated cells is shown. Splenocytes from 21-week-old wild-type or PLC2-deficient IgHEL sHEL mice were stained with anti-B220 and anti-Ig antibodies. Percentages indicate Ig+ cells in the gated B220+ B lymphocytes. Data are representative of three independent analyses. (E) Statistical analysis of the percentages of Ig+ B cells in the gated live BM IgM+ B220+ lymphoid population from panel C (n = 3; *, P < 0.01). (F) Statistical analysis of the percentages of Ig+ B cells in the gated live splenic B220+ lymphoid population from panel D (n = 3; **, P < 0.05).

Impaired antigen-induced rearrangement of endogenous Ig associated with PLC2 deficiency in vivo was further confirmed at the level of genomic DNA. Genomic DNA was isolated from wild-type Ig^HEL, PLC2-deficient Ig^HEL, wild-type Ig^HEL sHEL, and PLC2-deficient Ig^HEL sHEL mice, and levels of endogenous Ig gene rearrangements were determined by semiquantitative PCR. Splenic B cells from wild-type mice served as a positive control, in which rearrangements of V-J1, V-J2, and V-Jx were easily detectable (Fig. 5A). Embryonic stem (ES) cells served as a negative control, in which rearrangements of V-J1, V-J2, and V-Jx were not detectable (Fig. 5A). As expected, both wild-type Ig^HEL and PLC2-deficient Ig^HEL splenic B cells had barely detectable levels of rearrangements of endogenous V-J1, V-J2, and V-Jx (Fig. 5A). Interestingly, whereas splenic B cells from wild-type Ig^HEL sHEL mice exhibited apparent rearrangements of endogenous V-J1, V-J2, and V-Jx, such rearrangements were not detectable in PLC2-deficient Ig^HEL sHEL splenic B cells (Fig. 5A).

View larger version (21K): [in this window] [in a new window]   FIG. 5. Impairment of antigen-induced receptor editing among the endogenous and loci in PLC2-deficient IgHEL B cells. (A) Impairment of antigen-induced receptor editing among the endogenous and loci in PLC2-deficient splenic IgHEL B cells in vivo. Genomic DNA was isolated from the splenocytes derived from wild-type IgHEL, PLC2-deficient IgHEL, wild-type IgHEL sHEL, or PLC2-deficient IgHEL sHEL mice. Subsequently, the genomic DNA was subjected to a semiquantitative PCR analysis of the ß-actin gene; of endogenous 1, 2, x, and J1 rearrangements, and of RS rearrangement. Genomic DNA of splenic B cells from wild-type mice served as a positive control, whereas genomic DNA from ES cells served as a negative control. Data are representative of three independent experiments for rearrangements and two independent experiments for J1 and RS rearrangements. (B) Impairment of antigen-induced rearrangements of endogenous and chain in PLC2-deficient BM-derived IgHEL B cells in vitro. BM cells from wild-type or PLC2-deficient IgHEL transgenic mice were cultured for 5 days with IL-7 to expand into a B-cell population that expresses the IgHEL BCR. Following further stimulation with (HEL) or without (medium) HEL for 2 days, genomic DNA was isolated from the cells and subsequently subjected to a semiquantitative PCR analysis of the ß-actin gene and of endogenous 1 and J1 rearrangements. Genomic DNA of BM B cells from wild-type mice served as a positive control, whereas genomic DNA from ES cells served as a negative control. Data are representative of three independent experiments for rearrangements and two independent experiments for J1 rearrangement. WT, wild type.

Impaired antigen-induced rearrangements of Ig and Ig genes in PLC2-deficient B cells were also confirmed at genomic DNA levels in an in vitro receptor editing experiment. BM cells from wild-type or PLC2-deficient Ig^HEL transgenic mice were cultured for 5 days with IL-7 to expand the uniform B-cell population that expresses the Ig^HEL BCR. Following further stimulation with HEL or medium, genomic DNA was isolated from the cells and levels of endogenous gene Ig and Ig rearrangements were determined by semiquantitative PCR. BM B cells from wild-type mice served as a positive control, in which V-J1 rearrangements were easily detectable (Fig. 5B). ES cells served as a negative control, in which V-J1 rearrangements were not detectable (Fig. 5B). Both wild-type and PLC2-deficient BM-derived Ig^HEL B cells had low background levels of rearrangements of endogenous Ig and Ig genes when cultured with medium alone (Fig. 5B). Upon HEL stimulation, wild-type BM-derived Ig^HEL B cells underwent receptor editing such that rearrangements of endogenous V-J1 and V-J1 gene were easily detectable (Fig. 5B), consistent with a previous study (65). In contrast, PLC2-deficient BM-derived Ig^HEL B cells displayed a barely detectable level of rearrangement of V-J1 and a reduced level of rearrangements of V-J1 following HEL stimulation (Fig. 5B). These genomic data further confirm that PLC2 deficiency impairs activation of Ig and Ig locus. Taken together, our results demonstrate that PLC2 plays a role in rearrangements of Ig and Ig, which are associated with receptor editing.

Ig L recombination requires accessibility of both the V region and J region to the recombination machinery, and germ line transcription of V and V positively correlates with their accessibility (3). Thus, we compared germ line transcription of V and V genes in wild-type and PLC2-deficient pro/pre-B cells. B220^low IgM^– pro/pre-B cells were sorted out from BM of wild-type or PLC2-deficient mice. The levels of V and V germ line transcription in these cells were quantitated by real-time PCR. The level of V germ line transcription was markedly decreased in PLC2-deficient pro/pre-B cells compared to wild-type controls (Fig. 6A). Of note, the level of V germ line transcription was also decreased in PLC2-deficient pro/pre-B cells compared to wild-type controls (Fig. 6A). Thus, consistent with an important role for PLC2 in rearrangements of Ig and Ig, PLC2 deficiency reduces the germ line transcription of both V and V genes, especially the former.

View larger version (21K): [in this window] [in a new window]   FIG. 6. Impairment of germ line transcription of light-chain genes and BCR-mediated expression of IRF-4/IRF-8 in PLC2-deficient B cells. (A) Reduction of germ line transcription of and chain in PLC2-deficient pro/pre-B cells. The pro/pre-B (B220low IgM–) cells were sorted from BM of 4-month-old PLC2+/+ and PLC2–/– mice. Then, total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of germ line transcription of and chain. Data are a combination of results from two independent experiments. (B) BCR-induced expression of IRF-4 and IRF-8 is impaired in PLC2-deficient BM-derived IgHEL B cells in vitro. BM cells were isolated from wild-type (PLC2+/+ IgHEL) and PLC2-deficient (PLC2–/– IgHEL) IgHEL mice and were initially cultured with IL-7 for 5 days. The cells were then stimulated with (-IgM) or without (medium) anti-IgM for 2 h. Total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of IRF-4 and IRF-8 gene expression. The figures shown are representative of three independent experiments. (C) Impairment of BCR-induced expression of IRF-4 and IRF-8 in PLC2-deficient splenic IgHEL B cells in vivo. Splenic B cells were isolated from wild-type and PLC2-deficient IgHEL sHEL mice. Total RNA was isolated from the cells and subjected to real-time RT-PCR analysis of IRF-4 and IRF-8 gene expression. The figure shown is representative of four independent experiments.

PLC2 deficiency impairs BCR-induced expression of IRF-4 and IRF-8.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Although previous studies have shown that PLC2 plays an important role in early B-cell development at the pro-B to pre-B transition and is essential for maturation of T2 to follicular B cells (68-70), our current studies discovered that PLC2 deficiency impairs rearrangements of Ig and Ig L-chain genes, resulting in an impairment of antigen-induced receptor editing. Although the impairment of Ig rearrangement is not obvious in nontransgenic PLC2-deficient mice, it is clearly detected in the PLC2-deficient Ig^HEL sHEL transgenic mice. Previous studies have demonstrated that rearrangements of Ig and Ig occur independently with different kinetics, such that the locus is activated and the locus is not subsequently activated until rearrangements of genes fail to yield a functional Ig L chain (2, 10, 39, 72). A different regulation of the activation of these two loci for recombination might explain that differential effect of PLC2 deficiency on the versus the locus. PLC2 provides an important signal involved in the activation of both the and loci, although the signal seems to be more essential for the activation of . Interestingly, the two signaling molecules that are upstream of PLC2 in BCR signaling, the adapter molecule BLNK and the tyrosine kinase Btk, have also been shown to play roles in the activation of the L-chain loci (6, 19). Similar to deficiency of PLC2, lack of BLNK impairs the activation of both Ig and Ig loci, leading to an impairment of antigen-induced receptor editing (19). In contrast, Btk deficiency has no effect on antigen-induced receptor editing, although it severely reduces the expression of Ig chain (6). One possible explanation is that PLC2 and BLNK initiate additional Btk-independent signals that are required for receptor editing.

The ratio of Ig⁺ versus Ig⁺ mature B cells is ultimately determined by the kinetics and efficiency of activation of and loci, the number of functional V and V gene segments, and the survival and proliferation rates of B cells that have undergone L-chain gene rearrangement (28, 72). Although PLC2 is known to be involved in the survival and proliferation of transitional and mature B cells (68, 70), our analysis of apoptosis and proliferation rates in Ig⁺ and Ig⁺ B-cell populations derived from wild-type and PLC2^–/– mice demonstrates that PLC2 deficiency does not specifically increase apoptosis or decrease proliferation of Ig⁺ B cells relative to Ig⁺ B cells. Therefore, the reduced usage of Ig relative to Ig in nontransgenic PLC2-deficient B cells is not due to a shortened life span or decreased proliferative capacity of Ig⁺ B cells relative to Ig⁺ B cells. Instead, the reduced usage of Ig by PLC2-deficient B cells appears to be due solely to the absence of signals from PLC2 that differentially regulate activation of the Ig and Ig loci. Consistently, overexpression of the antiapoptotic molecule Bcl-2 protects Btk-deficient B cells from apoptosis but does not alter the frequency of Ig expression in the mutant B cells (6).

Binding of self antigen to self-reactive B cells can initiate new Ig gene rearrangements, especially at L-chain loci, to replace a self-reactive receptor with a new receptor (5, 7, 12, 48, 63). The BCR signaling pathway that specifically regulates receptor editing is not clear, although BLNK has been shown to play an important role in receptor editing (19). Although development of anergy is a dominant phenotype in the Ig^HEL sHEL transgenic mode, this model can be used to study receptor editing (66). Previous studies have demonstrated that sHEL is able to induce autoreactive Ig^HEL B cells to undergo receptor editing in vitro (65, 66). Consistent with these previous studies, we found that both BM culture-derived and primary splenic B cells from wild-type Ig^HEL mice undergo sHEL-induced Ig expression in vitro. However, sHEL-induced expression of Ig is severely impaired in PLC2^–/– Ig^HEL B cells. Expression of sHEL as a "self antigen" in mice that express Ig^HEL might be expected to induce editing of the "autoreactive" Ig^HEL receptor and consequent expression of endogenous Ig in vivo. Whereas a previous study failed to detect elevated levels of Ig expression in B cells from young (<12 weeks of age) Ig^HEL sHEL double-transgenic mice in vivo (65), we constantly observed Ig expression in B cells from older (>13 weeks of age), but not younger (data not shown), Ig^HEL sHEL double-transgenic mice in vivo. Importantly, Ig expression was much lower in B cells from older PLC2-deficient mice than in B cells from wild-type Ig^HEL sHEL double-transgenic mice. Taken together, our results show that PLC2 signaling downstream of BCR engagement plays a role in receptor editing both in vitro and in vivo.

IRF-4 and IRF-8 are two members of the IRF family of transcription factors that are essential for down-regulation of both surrogate L-chain expression and rearrangement of Ig and Ig chain genes during B-cell development (32). In the absence of IRF-4 and IRF-8, rearrangement of both Ig and Ig chain genes is blocked (32). We show in the present studies that the PLC2 pathway plays a critical role in BCR-induced expression of IRF-4 and IRF-8. Nevertheless, although PLC2 deficiency severely impairs up-regulation of both transcription factors, it more severely impairs rearrangement of Ig than Ig chain genes in nontransgenic mice. One possible explanation for this observation is that high levels of IRF-4 and IRF-8 may be required for Ig chain gene rearrangement whereas low levels of IRF-4 and IRF-8 may be sufficient for Ig chain gene rearrangement. Thus, the complete absence of IRF-4 and IRF-8 caused by targeted gene disruption would be expected to block rearrangement of both Ig and Ig chain genes, whereas reduced expression of IRF-4 and IRF-8, for example as a consequence of PLC2 deficiency, would be expected to affect rearrangement of Ig more than that of Ig. In fact, a recent study has demonstrated that IRF-4 is expressed in a graded manner in differentiating B cells and that different concentrations of IRF-4 regulate expression of distinct genes that coordinate isotype switching during plasma cell differentiation (58). Moreover, both IRF-4 and IRF-8 are essential for germ line transcription of V and V (31). Levels of germ line transcription of V and V positively correlate with their accessibility to the recombination machinery (3). The impaired expression of IRF-4 and IRF-8 as a consequence of PLC2 deficiency should contribute to the reduction of the germ line transcription of V and particularly V genes. Nonetheless, further studies are required to fully understand the mechanism by which the PLC2 pathway regulates L-chain gene rearrangement and receptor editing.

	ACKNOWLEDGMENTS

 
This work is supported in part by NIH grants R01 AI52327 (R.W.) and R01 HL073284 (D.W.) and by American Cancer Society grant RSG CCG-106204 (D.W.).

We gratefully acknowledge the help from Guoping Fu, Yang Xu, Matthew A. Inlay, and Tongxiang Lin. We are grateful to Harinder Singh for providing primers for real-time PCR analysis of IRF-4 and IRF-8. We thank Debra K. Newman for critical review of the manuscript and for helpful discussion.

	FOOTNOTES

 
* Corresponding author. Mailing address: Blood Research Institute, 8727 Watertown Plank Road, Milwaukee, WI 53226. Phone: (414) 937-3874. Fax: (414) 937-6284. E-mail: demin.wang{at}bcw.edu

Published ahead of print on 25 June 2007.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Alt, F. W., T. K. Blackwell, and G. D. Yancopoulos. 1987. Development of the primary antibody repertoire. Science 238:1079-1087.[Abstract/Free Full Text]

2. Arakawa, H., T. Shimizu, and S. Takeda. 1996. Re-evaluation of the probabilities for productive arrangements on the kappa and lambda loci. Int. Immunol. 8:91-99.[Abstract/Free Full Text]

3. Bassing, C. H., W. Swat, and F. W. Alt. 2002. The mechanism and regulation of chromosomal V(D)J recombination. Cell 109:S45-S55.[CrossRef][Medline]

4. Brass, A. L., A. Q. Zhu, and H. Singh. 1999. Assembly requirements of PU.1-Pip (IRF-4) activator complexes: inhibiting function in vivo using fused dimers. EMBO J. 18:977-991.[CrossRef][Medline]

5. Casellas, R., T. A. Shih, M. Kleinewietfeld, J. Rakonjac, D. Nemazee, K. Rajewsky, and M. C. Nussenzweig. 2001. Contribution of receptor editing to the antibody repertoire. Science 291:1541-1544.[Abstract/Free Full Text]

6. Dingjan, G. M., S. Middendorp, K. Dahlenborg, A. Maas, F. Grosveld, and R. W. Hendriks. 2001. Bruton's tyrosine kinase regulates the activation of gene rearrangements at the lambda light chain locus in precursor B cells in the mouse. J. Exp. Med. 193:1169-1178.[Abstract/Free Full Text]

7. Edry, E., and D. Melamed. 2004. Receptor editing in positive and negative selection of B lymphopoiesis. J. Immunol. 173:4265-4271.[Abstract/Free Full Text]

8. Ehlich, A., and R. Kuppers. 1995. Analysis of immunoglobulin gene rearrangements in single B cells. Curr. Opin. Immunol. 7:281-284.[CrossRef][Medline]

9. Eisenbeis, C. F., H. Singh, and U. Storb. 1995. Pip, a novel IRF family member, is a lymphoid-specific, PU.1-dependent transcriptional activator. Genes Dev. 9:1377-1387.[Abstract/Free Full Text]

10. Engel, H., A. Rolink, and S. Weiss. 1999. B cells are programmed to activate kappa and lambda for rearrangement at consecutive developmental stages. Eur. J. Immunol. 29:2167-2176.[CrossRef][Medline]

11. Fang, W., B. C. Weintraub, B. Dunlap, P. Garside, K. A. Pape, M. K. Jenkins, C. C. Goodnow, D. L. Mueller, and T. W. Behrens. 1998. Self-reactive B lymphocytes overexpressing Bcl-xL escape negative selection and are tolerized by clonal anergy and receptor editing. Immunity 9:35-45.[CrossRef][Medline]

12. Gay, D., T. Saunders, S. Camper, and M. Weigert. 1993. Receptor editing: an approach by autoreactive B cells to escape tolerance. J. Exp. Med. 177:999-1008.[Abstract/Free Full Text]

13. Goodnow, C. C., J. Crosbie, S. Adelstein, T. B. Lavoie, S. J. Smith-Gill, R. A. Brink, H. Pritchard-Briscoe, J. S. Wotherspoon, R. H. Loblay, and K. Raphael. 1988. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature 334:676-682.[CrossRef][Medline]

14. Gorman, J. R., N. van der Stoep, R. Monroe, M. Cogne, L. Davidson, and F. W. Alt. 1996. The Ig(kappa) enhancer influences the ratio of Ig(kappa) versus Ig(lambda) B lymphocytes. Immunity 5:241-252.[CrossRef][Medline]

15. Grawunder, U., T. M. Leu, D. G. Schatz, A. Werner, A. G. Rolink, F. Melchers, and T. H. Winkler. 1995. Down-regulation of RAG1 and RAG2 gene expression in preB cells after functional immunoglobulin heavy chain rearrangement. Immunity 3:601-608.[CrossRef][Medline]

16. Hardy, R. R., and K. Hayakawa. 2001. B cell development pathways. Annu. Rev. Immunol. 19:595-621.[CrossRef][Medline]

17. Hartley, S. B., J. Crosbie, R. Brink, A. B. Kantor, A. Basten, and C. C. Goodnow. 1991. Elimination from peripheral lymphoid tissues of self-reactive B lymphocytes recognizing membrane-bound antigens. Nature 353:765-769.[CrossRef][Medline]

18. Hashimoto, A., K. Takeda, M. Inaba, M. Sekimata, T. Kaisho, S. Ikehara, Y. Homma, S. Akira, and T. Kurosaki. 2000. Cutting edge: essential role of phospholipase C-gamma 2 in B cell development and function. J. Immunol. 165:1738-1742.[Abstract/Free Full Text]

19. Hayashi, K., T. Nojima, R. Goitsuka, and D. Kitamura. 2004. Impaired receptor editing in the primary B cell repertoire of BASH-deficient mice. J. Immunol. 173:5980-5988.[Abstract/Free Full Text]

20. Healy, J. I., and C. C. Goodnow. 1998. Positive versus negative signaling by lymphocyte antigen receptors. Annu. Rev. Immunol. 16:645-670.[CrossRef][Medline]

21. Hertz, M., and D. Nemazee. 1997. BCR ligation induces receptor editing in IgM+IgD– bone marrow B cells in vitro. Immunity 6:429-436.[CrossRef][Medline]

22. Hombach, J., T. Tsubata, L. Leclercq, H. Stappert, and M. Reth. 1990. Molecular components of the B-cell antigen receptor complex of the IgM class. Nature 343:760-762.[CrossRef][Medline]

23. Inlay, M. A., T. Lin, H. H. Gao, and Y. Xu. 2006. Critical roles of the immunoglobulin intronic enhancers in maintaining the sequential rearrangement of IgH and Igk loci. J. Exp. Med. 203:1721-1732.[Abstract/Free Full Text]

24. Karasuyama, H., A. Kudo, and F. Melchers. 1990. The proteins encoded by the VpreB and lambda 5 pre-B cell-specific genes can associate with each other and with mu heavy chain. J. Exp. Med. 172:969-972.[Abstract/Free Full Text]

25. Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell-deficient mouse by targeted disruption of the membrane exon of the immunoglobulin mu chain gene. Nature 350:423-426.[CrossRef][Medline]

26. Kurosaki, T. 1999. Genetic analysis of B cell antigen receptor signaling. Annu. Rev. Immunol. 17:555-592.[CrossRef][Medline]

27. Lam, K. P., R. Kuhn, and K. Rajewsky. 1997. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073-1083.[CrossRef][Medline]

28. Lang, J., B. Arnold, G. Hammerling, A. W. Harris, S. Korsmeyer, D. Russell, A. Strasser, and D. Nemazee. 1997. Enforced Bcl-2 expression inhibits antigen-mediated clonal elimination of peripheral B cells in an antigen dose-dependent manner and promotes receptor editing in autoreactive, immature B cells. J. Exp. Med. 186:1513-1522.[Abstract/Free Full Text]

29. Loder, F., B. Mutschler, R. J. Ray, C. J. Paige, P. Sideras, R. Torres, M. C. Lamers, and R. Carsetti. 1999. B cell development in the spleen takes place in discrete steps and is determined by the quality of B cell receptor-derived signals. J. Exp. Med. 190:75-89.[Abstract/Free Full Text]

30. Loffert, D., A. Ehlich, W. Muller, and K. Rajewsky. 1996. Surrogate light chain expression is required to establish immunoglobulin heavy chain allelic exclusion during early B cell development. Immunity 4:133-144.[CrossRef][Medline]

31. Lu, R., K. L. Medina, D. W. Lancki, and H. Singh. 2003. IRF-4,8 orchestrate the pre-B-to-B transition in lymphocyte development. Genes Dev. 17:1703-1708.[Abstract/Free Full Text]

32. Lu, Y. F., M. Singh, and J. Cerny. 2001. Canonical germinal center B cells may not dominate the memory response to antigenic challenge. Int. Immunol. 13:643-655.[Abstract/Free Full Text]

33. Ma, A., P. Fisher, R. Dildrop, E. Oltz, G. Rathbun, P. Achacoso, A. Stall, and F. W. Alt. 1992. Surface IgM mediated regulation of RAG gene expression in E mu-N-myc B cell lines. EMBO J. 11:2727-2734.[Medline]

34. Martin, F., and J. F. Kearney. 2001. B1 cells: similarities and differences with other B cell subsets. Curr. Opin. Immunol. 13:195-201.[CrossRef][Medline]

35. Matsuyama, T., A. Grossman, H. W. Mittrucker, D. P. Siderovski, F. Kiefer, T. Kawakami, C. D. Richardson, T. Taniguchi, S. K. Yoshinaga, and T. W. Mak. 1995. Molecular cloning of LSIRF, a lymphoid-specific member of the interferon regulatory factor family that binds the interferon-stimulated response element (ISRE). Nucleic Acids Res. 23:2127-2136.[Abstract/Free Full Text]

36. Melamed, D., R. J. Benschop, J. C. Cambier, and D. Nemazee. 1998. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor selection. Cell 92:173-182.[CrossRef][Medline]

37. Melamed, D., and D. Nemazee. 1997. Self-antigen does not accelerate immature B cell apoptosis, but stimulates receptor editing as a consequence of developmental arrest. Proc. Natl. Acad. Sci. USA 94:9267-9272.