![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,¶
Christian J. Nievera,1,
Enbo Liu,1,
Alan Yueh-Luen Lee,1
Longchuan Chen,2 and
Xiaohua Wu1*
Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, California 92037,1 Department of Pathology, VA Medical Center, Long Beach, California 908222
Received 27 March 2007/ Returned for modification 14 May 2007/ Accepted 8 June 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The phenotypic resemblance of NBS, ATLD, and AT cells implies that MRN and ATM participate in similar biological pathways. This is supported by recent findings that MRN acts both upstream and downstream of ATM to mediate the damage response when double-strand breaks (DSBs) are generated (32). MRN migrates to DSB sites immediately after damage in an ATM-independent manner (44, 47) and is required for ATM activation, especially in response to low doses of ionizing radiation (IR) (6, 8, 25, 35, 63). MRN is also a direct substrate of ATM. Multiple ATM phosphorylation sites on Nbs1 have been identified, and these phosphorylation events play important roles in mediating the intra-S and G2/M checkpoints, although the mechanism by which Nbs1 phosphorylation regulates these pathways is not well defined (8, 22, 36, 69, 75).
Mre11 is the core of the MRN complex and interacts with both Rad50 and Nbs1 (24, 34, 62). Mre11 carries 3' to 5' exonuclease activity and single-strand endonuclease activity and acts on various types of DSB ends and hairpins (49, 61). These nuclease activities are believed to be involved in processing of DNA ends for DSB repair (18, 37, 50). In multiple organisms, it has been shown that MRN is essential for DNA repair by homologous recombination (27, 59, 70).
The radioresistant DNA synthesis (RDS) phenotype of NBS and ATLD cells suggests an important role of MRN in the S-phase checkpoint (53, 54). ATM activates the S-phase checkpoint, and two distinct pathways, ATM-Chk2-Cdc25A-Cdk2 and ATM-MRN-SMC1, have been suggested to mediate the S-phase checkpoint downstream of ATM (16). The ATM-Chk2 pathway modulates Cdc25A stability by Chk2-mediated phosphorylation and ultimately regulates Cdc45 chromatin loading (15, 16). In NBS and ATLD cells, Chk2 activation, Cdc25A degradation, and Cdc45 chromatin loading are indistinguishable from those of normal cells after IR, suggesting that the ATM-Chk2-Cdc25A-Cdk2 pathway is intact and that the RDS phenotype observed in NBS and ATLD cells is due to a defect independent from the regulation of Cdc45 chromatin loading (16). SMC1 has been shown to be phosphorylated in the ATM-Nbs1 pathway in response to IR in an ATM- and Nbs1-dependent manner (28, 71). The IR-induced phosphorylation of SMC1 is important for mediating the S-phase checkpoint; thus, SMC1 was proposed as a downstream effector of the ATM-Nbs1 pathway. However, the details of the mechanisms by which SMC1 inhibits DNA synthesis are not clear.
A connection of MRN to DNA replication was illustrated by its colocalization with proliferating cell nuclear antigen (PCNA) and BrdU incorporation sites in the S phase (45). Chromatin immunoprecipitation (ChIP) also revealed that MRN binds to replication-origin-proximal sites in mammalian cells in a manner similar to that seen with E2F family members (38). However, it remains unclear how MRN is recruited to replication centers and origin-proximal sites.
An association of replication protein A (RPA) and MRN after replication fork blockage induced by hydroxyurea has been previously described (52), but the biological significance of this interaction has not been elucidated. We independently detected this interaction and found that, in fact, a subset of nuclear MRN and RPA form stable complexes through a direct interaction in unperturbed cells. This interaction increases at the G1-to-S transition with a peak in S phase and is regulated by cyclin-dependent kinase (CDK)-mediated phosphorylation. We also demonstrated that through this interaction, MRN is recruited to replication centers and origin-proximal sites in S phase. Importantly, the Mre11 mutants specifically defective in RPA binding exhibit a profound RDS phenotype, although phosphorylation of Nbs1 and SMC1 remains unaffected. These studies suggest that recruitment of MRN to replication-proximal sites by RPA is critical for MRN to suppress DNA replication initiation in response to IR, thereby suggesting a new mechanism of the ATM-Nbs1 pathway to mediate the S-phase checkpoint.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Different Nbs1 and Mre11 alleles were introduced into the GM07166, ATLD, or U2OS cell line by infection of retroviruses followed by selection of puromycin- or G418-resistant cells. Silencing of endogenous Mre11 in U2OS cells complemented by shRNA-resistant wild-type Mre11, Mre11-NAAIRS, or Mre11-DD alleles was accomplished by two rounds of retroviral infection using pMKO vector (39) expressing two different Mre11 shRNA target sequences, GATGAGAACTCTTGGTTTAAC and GAGTATAGATTTAGCAGAACA.
MRN complex purification. Nuclear extracts were prepared from 5g of BJAB cells and were fractionated by using phosphocellulose resin P11 followed by DEAE-Sephacel resin as previously described (19). Columns were loaded with 0.1 M KCl in BC buffer (20 mM Tris [pH 7.3], 0.2 mM EDTA) and eluted with 0.75 M KCl (BC buffer). Eluted fractions from DEAE were pooled, dialyzed, and applied to a Superose 6 (Pharmacia) column in BC buffer with 0.1 M KCl.
Plasmids and mutagenesis. Full-length Mre11 and Nbs1, fragments of Mre11 and Nbs1, and Mre11 internal-deletion alleles were subcloned into pcDNA3ß, a mammalian expression vector containing the sequence encoding the myc epitope (9). Glutathione S-transferase-Mre11 (GST-Mre11) (amino acids 360 to 708) and GST-Nbs1 (amino acids 476 to 754) were constructed by cloning PCR products into pGEX4T-1 (Pharmacia). His-tagged RPA1/3/2, RPA1/3, and RPA3/2 were made by cloning PCR products generated by using p11d-tRDS RPA (23) (a generous gift from Marc Wold) as a template with pET28b (Novagen). Mre11 and Nbs1 mutations were generated by site-directed mutagenesis (Stratagene).
Immunoprecipitation, in vitro binding, and immunofluorescence. Immunoprecipitation (IP) and Western blot analysis were performed as previously described (9). IP in the presence of protein phosphatase was conducted by incubating cell lysates prepared from each 10-cm dish with 400 U of lambda phosphatase (NEB) for 30 min at room temperature followed by immunoprecipitation at 4°C.
Flag-Nbs1, Flag-Mre11, and Flag-Mre11 mutants were expressed in insect cells and purified using anti-Flag M2 agarose (Sigma) followed by elution with 3xFlag peptide (sigma). His-tagged RPA was purified from Escherichia coli on nickel-nitrilotriacetic acid resin (QIAGEN), and GST-Mre11 (amino acids 360 to 708) was purified using glutathione Sepharose (GE). In vitro binding was performed with NETN buffer (20 mM Tris [pH 8.0], 1 mM EDTA, 150 mM NaCl, 0.5% NP-40).
For immunostaining of S-phase foci, IMR90 cells were fixed with a modified Streck Tissue fixative for 30 min at room temperature and then permeabilized for 15 min at room temperature as previously described (47). After blocking with 5% goat serum in phosphate-buffered saline (PBS), cells were stained with primary antibody at 4°C overnight followed by staining for 1 h at room temperature with either fluorescein isothiocyanate-conjugated anti-mouse or rhodamine-conjugated anti-rabbit secondary antibodies (Jackson ImmunoResearch Laboratories). For ATLD fibroblast cells, fixation and immunostaining were performed 5 h after release from a double thymidine (2 mM) block. To detect damage foci, asynchronized cells were fixed by 70% methanol and 30% acetone at –20°C for 15 min followed by immunostaining analysis as previously described (68).
Antibodies. The polyclonal antibodies against Nbs1 (D29), and Mre11 (D27) and the monoclonal antibody against Nbs1 (EE15) were described previously (67, 69). Antiserum to GST was raised in rabbits by use of purified GST. The other antibodies used were purchased from Oncogene (ATM, Mre11, Nbs1, RPA1, and RPA2), Upstate (Rad50), Cell Signaling Technology (pT68-Chk2 and pS343Nbs1), Novus (pS1981-ATM), Bethyl (pS966-SMC1), and Santa Cruz Biotechnology (Chk2 and Ku70).
ChIP. ChIP was performed as previously described (48) with the following modifications. T98G and its derivative cell lines were synchronized by serum starvation in the presence of 0.1% fetal bovine serum (FBS) for 48 h and released into the cell cycle by the addition of 10% FBS into the culture medium. At specified time points after release, cells were cross-linked with 5 mM dimethyl-3,3'-dithiobispropionimidate-2HCl (DTBP) in PBS for 30 min on ice (21) followed by 1% formaldehyde in PBS at 37°C for 10 min. Chromatin was sheared to obtain DNA fragments approximately 1 kb in length. IP was performed using anti-Myc antibody at 4°C overnight. IP with rabbit anti-mouse immunoglobulin G (IgG) antibody was used as a negative control. After washing, the immunoprecipitates were eluted, incubated at 65°C overnight to reverse the cross-links, and then analyzed by PCR using primers specific to B2-lamin, heat shock protein 70 (HSP70), and c-myc loci (2).
Radioresistant DNA synthesis. Inhibition of DNA synthesis following IR was performed as previously described (46, 54). Cells were grown in the presence of 20 nCi/ml (U2OS) or 50 nCi/ml (ATLD and GM07166) [14C]thymidine for 24 h. After removal of [14C]thymidine, cells were either mock treated or treated with 10 Gy of IR, allowed to recover for 1 h, and then labeled with 2.5 µCi/ml [3H]thymidine for 15 min (U2OS) (46) or 2 h (ATLD and GM07166) (54). Cells were spotted onto Whatman glass microfiber filters and washed with trichloroacetic acid and 100% ethanol. The filters were allowed to dry, and radioactivity was measured using a liquid scintillation counter and a dual energy program.
Sensitivity to ionizing radiation. ATLD cells complemented with vector, Mre11, Mre11-NAAIRS, or Mre11-DD were plated in triplicate at 3.5 x 105 cells per dish. Cells were treated with 0, 2, 5, or 10 Gy of IR. Seven days later, cells were stained with trypan blue and counted.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
The observation that MRN and RPA were colocalized in S-phase-specific foci prompted us to examine whether the interaction of MRN and RPA was cell cycle regulated. T98G cells were synchronized by serum starvation, and at different time points after release, the interaction of MRN with RPA was determined. Although the association was detected throughout the cell cycle, the interaction increased when cells were at the G1-to-S transition, with a peak in the S phase (Fig. 2A). Similar results were obtained when HeLa cells were synchronized by release from nocodazole-mediated mitotic arrest (data not shown). Increased association of MRN/RPA right before the onset of S phase and the colocalization of MRN and RPA S-phase foci suggest a potential role of MRN/RPA complexes in regulating DNA replication and/or sensing and repairing DSBs at replication forks.
|
Overexpression of p27 in asynchronized cells also inhibited the association of MRN and RPA (Fig. 2C, right panel), suggesting that CDK activity is required to mediate the interaction of MRN and RPA not only for cells exiting from G0 but also for normal cycling cells. To more directly examine whether CDKs are involved in regulating the MRN/RPA interaction, T98G cells were released from G0 and arrested at the G1/S boundary by aphidicolin when the interaction reached relatively high levels. Inhibition of CDK activity by the presence of roscovitine significantly reduced the interaction of MRN with RPA (Fig. 2D). Similar results were obtained when HeLa cells were used. These data suggest that CDK activity is not only important for stimulating the cell-cycle-dependent association of MRN and RPA but is also required for maintaining the increased association.
A specific site at the C terminus of Mre11 directly interacts with RPA1. Obtaining MRN mutants specifically defective in RPA binding would help to clarify the biological role(s) of the interaction of MRN and RPA. To do this, a series of Myc-tagged Mre11 fragments was expressed in 293T cells and immunoprecipitated. Only the carboxy-terminal fragment Mre11493-708 interacted with endogenous RPA1 and RPA2 (Fig. 3A). This fragment also interacted with endogenous Nbs1 and Rad50. However, the Mre11338-546 fragment bound to Rad50 but did not interact with RPA. These data suggest that either Mre11 or Nbs1, but not Rad50, mediates the binding of MRN with RPA. Consistently, the Nbs1 carboxy-terminal region required for Mre11 association interacted with RPA (data not shown).
|
To further narrow down the RPA-binding region on Mre11, a series of Mre11 deletion alleles was analyzed. Among them, two internal deletion alleles (lacking residues 521 to 543 and 543 to 569) failed to coimmunoprecipitate RPA, whereas another internal deletion allele (lacking residues 494 to 521) still associated with RPA (Fig. 3D, bottom left panel). This result defined the RPA-binding domain on Mre11 as being between amino acids 521 and 569. To identify the precise amino acid sequence required for RPA binding to Mre11, the six-amino-acid sequence NAAIRS was used to replace the most conserved sequences within this region in vertebrates (Fig. 3D). The NAAIRS peptide is a flexible linker sequence that would minimize the conformational changes in the mutant protein (65). When expressed in cells, the Mre11-p540 NAAIRS mutant (changing amino acids 540 to 545) failed to bind RPA, whereas the other two Mre11-NAAIRS mutants (p522 and p529) still associated with RPA (Fig. 3D, bottom left panel). Within the sequence replaced by the p540 NAAIRS, two acidic residues at positions 543 and 544 of the human protein are conserved in several eukaryotic species (Fig. 3D). Mutation of these two aspartic acid residues to alanine residues (Mre11-DD
AA) completely abolished the binding of Mre11 to RPA (Fig. 3D, bottom right panel). The interaction of the NAAIRS and DD mutants with Nbs1 and Rad50 was not affected (Fig. 3D and data not shown). Introducing p540 NAAIRS or the DD mutation into full-length Mre11 also abolished the in vitro direct binding of Mre11 with RPA (Fig. 3B). These data suggest that residues D543 and D544 in Mre11 are required for Mre11 to directly bind to RPA.
The interaction of MRN and RPA is required for correct localization of MRN to replication centers. Colocalization of MRN and RPA in S-phase foci (Fig. 1D) suggests a possible role of the MRN/RPA complex in S phase. To determine whether MRN recruitment to S-phase foci is dependent upon its interaction with RPA, we examined Mre11 colocalization with RPA in S-phase foci when the binding between Mre11 and RPA was disrupted. Mre11-deficient ATLD cells immortalized by hTERT (43) were complemented with vector, wild-type Mre11, or the RPA binding mutants Mre11-NAAIRS and Mre11-DD. Immunostaining without extraction showed that more than 80% of ATLD cells were reconstituted (data not shown) and that the Mre11 wild type as well as the DD and NAAIRS mutants were all correctly located in the nucleus (see Fig. S2A in the supplemental material). Mre11, Mre11-DD, and Mre11-NAAIRS, as well as Rad50 and Nbs1, were also restored to similar protein levels in the reconstituted ATLD cells (Fig. 4A, top row). To enrich the S-phase population, cells were synchronized by a double thymidine block. Five hours after release from thymidine block, approximately 20% of the cells from each ATLD cell line were in the S phase, as judged by RPA and PCNA S-phase foci (Table 1 and data not shown). At this time point, cells were extracted and immunostained with antibodies specific to Mre11 and RPA2 (Fig. 4A). While the Mre11-NAAIRS and the Mre11-DD proteins formed S-phase foci, there were two major differences when these foci were compared with wild-type Mre11 foci. First, a higher percentage of S-phase cells (as judged by RPA foci) contained faint-staining Mre11 foci (Fig. 4A, panels d and f versus panel a, and Table 1) in the Mre11-NAAIRS and the Mre11-DD cell lines. Second, the S-phase foci of Mre11-NAAIRS and Mre11-DD, both faint and bright, were not colocalized with RPA, unlike the foci of wild-type Mre11 (Fig. 4A, panels c to f versus panel a). These results suggest that the interaction between Mre11 and RPA is required for MRN to correctly localize to replication centers in S phase. The remaining S-phase foci of the Mre11 RPA-binding mutants are apparently not at sites of DNA replication, as defined by the presence of RPA, PCNA, and BrdU incorporation (Fig. 4A; see Fig. S2B in the supplemental material; data not shown). Considering the multiple activities of MRN, including its repair function in S phase, MRN is possibly anchored to chromatin by other mechanisms when it loses its ability to associate with RPA.
|
|
The interaction of MRN with RPA is required for mediating the S-phase checkpoint. RPA plays an essential role in DNA replication (5). The observation that RPA-binding mutants of Mre11 specifically lose their interaction with DNA replication centers suggests that the association between MRN and RPA may be required for replication control or replication-related events. This idea is also supported by the cell-cycle-regulated association of MRN and RPA. Since ATLD cells reconstituted with Mre11, Mre11-NAAIRS, Mre11-DD, or vector grew at approximately the same rate (data not shown), the interaction of MRN with RPA does not appear to affect normal DNA replication under nonstressed conditions. We further examined whether the interaction of MRN with RPA might be important for mediation of the intra-S-phase checkpoint response by suppressing DNA replication after IR. The RDS phenotype of ATLD cells was corrected when wild-type Mre11 was expressed in these cells. Strikingly, ATLD cells complemented with Mre11-NAAIRS and Mre11-DD mutants failed to suppress the RDS phenotype (Fig. 5A, left panel). The down-regulation of DNA synthesis upon IR was also compromised in U2OS cells expressing Myc-Mre11-NAAIRS or Mre11-DD but not wild-type Mre11 when the expression of endogenous Mre11 was silenced (Fig. 5A, middle and right panels). Since RDS in the ATLD cells expressing Mre11-NAAIRS and Mre11-DD mutants reached levels similar to those seen with vector-complemented ATLD cells, these data suggest that the interaction of MRN and RPA is required in a major pathway for MRN to mediate the S-phase checkpoint.
|
Since the interaction of MRN and RPA is important for suppression of DNA replication following IR, we examined whether this interaction is regulated by DNA damage. Multiple cell lines, including U2OS, HeLa, and T98G, were lysed before and after IR (10 Gy), and the interaction was assayed by coimmunoprecipitation. The interaction of MRN and RPA remained at similar levels before and after IR (Fig. 5C and data not shown). To minimize the possibility that the interaction is regulated in the presence of chromatin, we performed coimmunoprecipitation after extraction of cell lysate pellets with high levels of salt and detergent; the interaction of RPA and MRN in untreated cells and after IR were similar (see Fig. S3 in the supplemental material). Since both Nbs1 and Mre11 are phosphorylated after IR, these data also suggest that IR-induced phosphorylation of Nbs1 and Mre11 is not involved in regulating the interaction between MRN and RPA.
The MRN/RPA complex is likely a downstream effector in mediating the S-phase checkpoint. ATM-mediated phosphorylation of Nbs1 at S343 plays a critical role in down-regulating DNA replication following IR. Although loss of the interaction between MRN and RPA led to an RDS phenotype, IR-induced phosphorylation of Nbs1 at S343 in ATLD cells expressing wild-type Mre11 or the RPA-binding mutants (Mre11-DD and -NAAIRS) was at similar levels (Fig. 5D, left panel). Furthermore, in similarity to the results seen with wild-type Mre11, both Mre11-DD and Mre11-NAAIRS mutants bound to phosphorylated Nbs1 following IR (Fig. 5D, right panel). These data suggest that association with RPA is not required for Nbs1 to be phosphorylated at S343 by ATM. Since the S-phase checkpoint is impaired when the interaction of MRN and RPA is disrupted, even though Nbs1 is perfectly phosphorylated by ATM at S343 in the MRN mutant complexes, Nbs1 phosphorylation must occur prior to the step that requires the MRN-RPA interaction for mediation of the S-phase checkpoint. These data are consistent with a scenario in which MRN/RPA is a downstream effector in the ATM-Nbs1 branch of the S-phase checkpoint pathway such that the interaction between MRN and RPA is required for ATM-phosphorylated Nbs1 to suppress DNA replication.
According to previous studies, SMC1 is a downstream effector in the ATM/Nbs1 pathway for the S-phase checkpoint (28, 29, 71). IR-induced SMC1 phosphorylation is Nbs1 dependent and is required for mediating the S-phase checkpoint. We showed that although ATM-directed phosphorylation of SMC1 at S966 was impaired in Mre11-deficient cells, it was normal when Mre11-DD and Mre11-NAAIRS mutants were expressed (Fig. 5D, left panel). These data suggest that the interaction between MRN and RPA is not required for IR-induced SMC1 phosphorylation. The MRN/RPA complex is situated downstream of ATM-dependent phosphorylation of SMC1, or it acts in a separate pathway to mediate the S-phase checkpoint.
MRN is tethered to replication-proximal sites via its interaction with RPA and acts to suppress origin firing upon IR to mediate the S-phase checkpoint. Our studies have shown that the interaction of MRN with RPA is required for the inhibition of DNA synthesis following IR. Previous studies have shown that IR-induced down-regulation of replication is mainly caused by blocking new origin firing whereas fork movement is minimally affected (31, 33, 42). However, the nature of the mechanisms that mediate the inhibition of origin firing during the intra-S-phase checkpoint in mammalian cells is still not clear. We investigated whether the MRN complex and the interaction of MRN with RPA would contribute to the prevention of origin firing after IR. We used a DNA fiber-labeling assay to quantitatively assess replication origin firing before and after IR. ATLD cells complemented with wild-type Mre11, Mre11-NAAIRS, Mre11-DD, or vector were pulse labeled with CldU, a modified nucleotide precursor, and subsequently treated with IR or left untreated followed by pulse labeling with IdU, another nucleotide precursor (Fig. 6A). After immunostaining of chromatin fibers with antibodies recognizing CldU and IdU, DNA that is being actively synthesized during the labeling time is visualized as labeled tracks, which could be interpreted as (i) newly fired origins, (ii) ongoing forks, or (iii) terminating forks. We counted origins fired during IdU labeling in comparison to the total number of forks. As shown in Fig. 6A, the percentage of newly fired origins after IR in the wild-type Mre11-reconstituted ATLD cell line was greatly reduced, suggesting that new origin firing was inhibited following IR. However, the IR-mediated inhibition of new origin firing was severely compromised in the vector and the Mre11-NAAIRSi-expressing and Mre11-DD-expressing ATLD cell lines. These data suggest that Mre11, as well as the interaction of Mre11 with RPA, is required for preventing new origin firing following IR.
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The interaction of MRN and RPA is cell cycle regulated. A previous study showed that MRN forms S-phase-specific foci colocalized with sites of BrdU incorporation (45). Our studies further demonstrated that MRN also colocalizes with RPA in the S phase, and importantly, that the interaction of RPA with Mre11 is critical for the recruitment of MRN to the replication centers, revealing an important mechanism for MRN for localization to S-phase-specific foci.
The interaction of MRN with RPA appears to be regulated by CDKs. p27 overexpression or roscovitine treatment leads to a decrease in the association between MRN and RPA. Phosphatase treatment abolishes cell-cycle-dependent MRN-RPA association, suggesting that CDK activities are not only required for stimulating but are also important for maintaining the interaction between MRN and RPA. Active DNA replication is seemingly not the cause for inducing the MRN/RPA interaction, since overexpression of a dominant-negative MCM7 helicase mutant, unlike overexpression of p27, does not lead to an inhibition of the interaction between MRN and RPA, although DNA replication is significantly suppressed. These results disfavor the idea that MRN and RPA association is induced by spontaneous DNA damage occurring during replication in the S phase. Increased association of MRN and RPA at the G1-to-S transition and in the S phase is most likely due to a rise in CDK activities. Although MRN and RPA association is regulated during the cell cycle in a phosphorylation-dependent manner, the association remained at similar levels before and after IR. These data suggest that DSBs generated after IR- and ATM-mediated phosphorylation events, including Nbs1 phosphorylation, do not play a major role in regulating the interaction between MRN and RPA.
The interaction of RPA and MRN is direct and mediated by a specific site in Mre11. Since a direct interaction of MRN and RPA can be achieved by using purified Mre11 and RPA expressed in insect cells and bacteria, respectively, it seems that CDK-mediated phosphorylation events stimulate the interaction but are not absolutely required for initiation of the interaction. Interestingly, two DD residues at the RPA-binding site are critical for Mre11 to bind RPA, which is analogous to the requirement of DD/EE residues in conserved motifs in Nbs1, ATRIP, and Ku80 to mediate the interaction of Nbs1/ATM, ATRIP/ATR, and Ku80/DNA-PK (see Fig. S5 in the supplemental material) (14). This raises the possibility that a general mechanism may be involved in mediating protein-protein interactions for DNA damage responses. The nature of the exact mechanism by which CDKs regulate the interaction between MRN and RPA is not clear. The increased association of MRN and RPA could be caused by direct phosphorylation of MRN, RPA, or both by CDKs. Previous studies have shown that RPA is phosphorylated by CDKs at multiple sites during the cell cycle (12, 17, 20). In vivo mass spectrometry analysis also identified phosphorylation of Nbs1 at CDK conserved sites in unperturbed cells (reference 69 and data not shown). CDK activity is important for activation of homologous recombination in the S phase when DSBs are generated (3, 13, 26). Our findings indicating that CDK activity is also required for stimulation of the interaction between MRN and RPA to mediate S-phase checkpoint control suggest an interesting mechanism to couple S-phase checkpoint control with DNA repair.
The interaction of MRN and RPA is essential for mediating the S-phase checkpoint. The ATM/Chk2 and ATM/Nbs1 pathways are two parallel pathways required to mediate the intra-S-phase checkpoint (16). After ATM activation, the ATM/Chk2 pathway inhibits Cdc45 chromatin loading (15), thus preventing MCM-mediated DNA unwinding at origins (Fig. 7B). What is the mechanism by which the ATM/Nbs1 complex inhibits replication after DNA damage? Our studies suggest that when ATM-phosphorylated MRN is recruited to origin-proximal sites by RPA, it acts there to prevent replication initiation.
At the onset of replication initiation, DNA at origins is unwound by MCM proteins, forming single-stranded DNA (ssDNA) that is subsequently bound by RPA (57) and probably at the same time MRN is recruited by RPA to replication origins. This idea is supported by the ChIP analysis results showing that MRN binds to replication origin-proximal sites in a manner similar to that seen with RPA, while Mre11 mutants defective in RPA binding fail to do so.
The ATLD cell line expressing Mre11 mutants defective in RPA binding do not show obvious growth defects, suggesting that the presence of MRN at replication origin-proximal sites in a complex with RPA does not affect DNA replication per se in a normal cell cycle. However, loss of this interaction causes a severe defect in down-regulation of DNA replication following IR. Since MRN/RPA complexes associate with origin-proximal sites similarly before and after IR, damage-induced inhibition of replication initiation likely occurs after RPA origin loading. One possible scenario is that ATM phosphorylates MRN after IR and that it is only when phosphorylated MRN is recruited by RPA to origins that replication initiation is prevented (Fig. 7B).
The phosphorylation of Nbs1 at S343 is critical for the S-phase checkpoint (36, 75). Our studies showed that in the Mre11 mutant cell lines defective in RPA binding, IR-induced Nbs1 phosphorylation at S343 was not affected. Mre11-DD and Mre11-NAAIRS form complexes with phosphorylated Nbs1 (S343) in a manner similar to that seen with wild-type Mre11, but those mutant cell lines exhibit a profound RDS phenotype. These data support the idea that MRN/RPA complexes are a downstream effector for mediation of the S-phase checkpoint after Nbs1 S343 is phosphorylated by ATM; this is consistent with the observation that the association of MRN with RPA is not required for ATM activation. In the ATM/Nbs1 branch of the S-phase checkpoint pathway, SMC1 is downstream of Nbs1 (28, 71). SMC1 phosphorylation is Nbs1 dependent and is important for mediating the S-phase checkpoint. Although IR-induced SMC1 phosphorylation depends on MRN, disruption of the interaction of MRN and RPA does not influence this ATM-mediated SMC1 phosphorylation. This again suggests that the MRN/RPA complex is a downstream effector situated downstream of ATM-directed SMC1 phosphorylation events for mediation of replication inhibition following IR.
It is still unclear what step in DNA replication following RPA loading is disrupted by ATM-mediated phosphorylation of MRN at origin-proximal sites. Given the critical role of RPA in replication initiation, MRN may directly inhibit RPA replication activity to inhibit replication initiation in response to IR. For instance, RPA is required for recruiting DNA polymerase 
/primase and is also needed for replication factor C to load PCNA onto primed origins to initiate DNA replication (74). A conformational change of MRN/RPA may be induced by ATM-directed phosphorylation of MRN following IR, which in turn would lead to an inhibition of RPA function in replication initiation. Alternatively, phosphorylation of MRN may interfere with the association of MRN/RPA with other replication factors at origins, causing the suppression of replication initiation. Nevertheless, our results suggest a direct communication of MRN with the cellular replication machinery at replication-proximal sites to mediate the intra-S-phase checkpoint. While the ATM/Chk2 pathway inhibits Cdc45 origin binding before DNA unwinding, the ATM/Nbs1 pathway likely prevents replication initiation after phosphorylated MRN is recruited by RPA to replication origins when RPA binds to ssDNA generated through MCM-mediated DNA unwinding (Fig. 7B). Since inactivation of either of the two pathways (ATM/Chk2 and ATM/Nbs1) leads to a partial RDS phenotype, both of these mechanisms are required for sufficient inactivation of replication initiation following IR.
The MRN/RPA complex and DSB repair. DSB repair via the homologous recombination pathway requires both MRN and RPA complexes (10, 66), which raises a question as to whether the interaction of MRN/RPA is also involved in mediating the repair process. The radiation survival assay demonstrated that Mre11 deficiency causes severe radiation sensitivity whereas the RPA-binding mutants of Mre11 exhibited only a minor defect. This suggests that the MRN/RPA complex is not involved in the major pathways mediated by MRN for repair of DSBs after IR, although a minor role cannot be excluded. In this aspect, DSB recognition by MRN seemingly does not require its association with RPA, since ATM activation that requires MRN at DSBs is not dependent on the interaction of MRN with RPA. The Mre11 mutants defective in RPA binding also migrate to DSBs to form damage foci similar to those seen with wild-type Mre11. Partial radiation sensitivity of Mre11 mutants defective in RPA binding is likely caused by a severe defect in the S-phase checkpoint, leading to inefficient repair of DSBs generated by IR in the S phase.
MRN forms multiple protein complexes to mediate various cellular functions. Forming MRN/RPA complexes is essential for the S-phase checkpoint. Upon ATM activation, MRN is phosphorylated, conceivably in different protein complexes. Phosphorylated MRN at DSB sites may stimulate the repair process, while phosphorylated MRN/RPA that is recruited to replication-proximal sites acts to prevent origin firing. Through S-phase checkpoint activation, ATM-mediated phosphorylation of MRN may provide an important mechanism to link DNA repair with replication and thus ensure the delay of DNA replication until the completion of DNA repair.
|
ACKNOWLEDGMENTS |
|---|
This work was supported by NIH grant CA102361, an Ellison Medical Foundation New Scholar award (AG-NS-0251-04) to X.W., and NIH training grant 5 T32 DK007022 to E.O.
|
FOOTNOTES |
|---|
Published ahead of print on 25 June 2007.
¶ Supplemental material for this article may be found at http://mcb.asm.org/.
E.O. and C.J.N. contributed equally to this work.
Present address: Signal Transduction Program, Burnham Institute for Medical Research, La Jolla, CA 92037.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Avni, D., H. Yang, F. Martelli, F. Hofmann, W. M. ElShamy, S. Ganesan, R. Scully, and D. M. Livingston. 2003. Active localization of the retinoblastoma protein in chromatin and its response to S phase DNA damage. Mol. Cell 12:735-746.[CrossRef][Medline]
3. Aylon, Y., B. Liefshitz, and M. Kupiec. 2004. The CDK regulates repair of double-strand breaks by homologous recombination during the cell cycle. EMBO J. 23:4868-4875.[CrossRef][Medline]
4. Biamonti, G., G. Perini, F. Weighardt, S. Riva, M. Giacca, P. Norio, L. Zentilin, S. Diviacco, D. Dimitrova, and A. Falaschi. 1992. A human DNA replication origin: localization and transcriptional characterization. Chromosoma 102:S24-S31.[CrossRef][Medline]
5. Binz, S. K., A. M. Sheehan, and M. S. Wold. 2004. Replication protein A phosphorylation and the cellular response to DNA damage. DNA Repair (Amsterdam) 3:1015-1024.[CrossRef]
6. Buscemi, G., C. Savio, L. Zannini, F. Micciche, D. Masnada, M. Nakanishi, H. Tauchi, K. Komatsu, S. Mizutani, K. Khanna, P. Chen, P. Concannon, L. Chessa, and D. Delia. 2001. Chk2 activation dependence on Nbs1 after DNA damage. Mol. Cell. Biol. 21:5214-5222.
7. Carney, J. P., R. S. Maser, H. Olivares, E. M. Davis, M. Le Beau, J. R. Yates III, L. Hays, W. F. Morgan, and J. H. Petrini. 1998. The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 93:477-486.[CrossRef][Medline]
8. Carson, C. T., R. A. Schwartz, T. H. Stracker, C. E. Lilley, D. V. Lee, and M. D. Weitzman. 2003. The Mre11 complex is required for ATM activation and the G2/M checkpoint. EMBO J. 22:6610-6620.[CrossRef][Medline]
9. Chen, J., D. P. Silver, D. Walpita, S. B. Cantor, A. F. Gazdar, G. Tomlinson, F. J. Couch, B. L. Weber, T. Ashley, D. M. Livingston, and R. Scully. 1998. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Mol. Cell 2:317-328.[CrossRef][Medline]
10. D'Amours, D., and S. P. Jackson. 2002. The Mre11 complex: at the crossroads of DNA repair and checkpoint signalling. Nat. Rev. Mol. Cell Biol. 3:317-327.[CrossRef][Medline]
11. Dimitrova, D. S., and D. M. Gilbert. 2000. Stability and nuclear distribution of mammalian replication protein A heterotrimeric complex. Exp. Cell Res. 254:321-327.[CrossRef][Medline]
12. Dutta, A., and B. Stillman. 1992. cdc2 family kinases phosphorylate a human cell DNA replication factor, RPA, and activate DNA replication. EMBO J. 11:2189-2199.[Medline]
13. Esashi, F., N. Christ, J. Gannon, Y. Liu, T. Hunt, M. Jasin, and S. C. West. 2005. CDK-dependent phosphorylation of BRCA2 as a regulatory mechanism for recombinational repair. Nature 434:598-604.[CrossRef][Medline]
14. Falck, J., J. Coates, and S. P. Jackson. 2005. Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 434:605-611.[CrossRef][Medline]
15. Falck, J., N. Mailand, R. G. Syljuasen, J. Bartek, and J. Lukas. 2001. The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 410:842-847.[CrossRef][Medline]
16. Falck, J., J. H. Petrini, B. R. Williams, J. Lukas, and J. Bartek. 2002. The DNA damage-dependent intra-S phase checkpoint is regulated by parallel pathways. Nat. Genet. 30:290-294.[CrossRef][Medline]
17. Fang, F., and J. W. Newport. 1993. Distinct roles of cdk2 and cdc2 in RP-A phosphorylation during the cell cycle. J. Cell Sci. 106:983-994.[Abstract]
18. Farah, J. A., E. Hartsuiker, K. Mizuno, K. Ohta, and G. R. Smith. 2002. A 160-bp palindrome is a Rad50.Rad32-dependent mitotic recombination hotspot in Schizosaccharomyces pombe. Genetics 161:461-468.
19. Flores, O., H. Lu, and D. Reinberg. 1992. Factors involved in specific transcription by mammalian RNA polymerase II. Identification and characterization of factor IIH. J. Biol. Chem. 267:2786-2793.
20. Fotedar, R., and J. M. Roberts. 1992. Cell cycle regulated phosphorylation of RPA-32 occurs within the replication initiation complex. EMBO J. 11:2177-2187.[Medline]
21. Fujita, N., and P. A. Wade. 2004. Use of bifunctional cross-linking reagents in mapping genomic distribution of chromatin remodeling complexes. Methods 33:81-85.[CrossRef][Medline]
22. Gatei, M., D. Young, K. M. Cerosaletti, A. Desai-Mehta, K. Spring, S. Kozlov, M. F. Lavin, R. A. Gatti, P. Concannon, and K. Khanna. 2000. ATM-dependent phosphorylation of nibrin in response to radiation exposure. Nat. Genet. 25:115-119.[CrossRef][Medline]
23. Henricksen, L. A., C. B. Umbricht, and M. S. Wold. 1994. Recombinant replication protein A: expression, complex formation, and functional characterization. J. Biol. Chem. 269:11121-11132.
24. Hopfner, K. P., A. Karcher, L. Craig, T. T. Woo, J. P. Carney, and J. A. Tainer. 2001. Structural biochemistry and interaction architecture of the DNA double-strand break repair Mre11 nuclease and Rad50-ATPase. Cell 105:473-485.[CrossRef][Medline]
25. Horejsi, Z., J. Falck, C. J. Bakkenist, M. B. Kastan, J. Lukas, and J. Bartek. 2004. Distinct functional domains of Nbs1 modulate the timing and magnitude of ATM activation after low doses of ionizing radiation. Oncogene 23:3122-3127.[CrossRef][Medline]
26. Ira, G., A. Pellicioli, A. Balijja, X. Wang, S. Fiorani, W. Carotenuto, G. Liberi, D. Bressan, L. Wan, N. M. Hollingsworth, J. E. Haber, and M. Foiani. 2004. DNA end resection, homologous recombination and DNA damage checkpoint activation require CDK1. Nature 431:1011-1017.[CrossRef][Medline]
27. Khanna, K. K., and S. P. Jackson. 2001. DNA double-strand breaks: signaling, repair and the cancer connection. Nat. Genet. 27:247-254.[CrossRef][Medline]
28. Kim, S. T., B. Xu, and M. B. Kastan. 2002. Involvement of the cohesin protein, Smc1, in Atm-dependent and independent responses to DNA damage. Genes Dev. 16:560-570.
29. Kitagawa, R., C. J. Bakkenist, P. J. McKinnon, and M. B. Kastan. 2004. Phosphorylation of SMC1 is a critical downstream event in the ATM-NBS1-BRCA1 pathway. Genes Dev. 18:1423-1438.
30. Lai, J. S., and W. Herr. 1992. Ethidium bromide provides a simple tool for identifying genuine DNA-independent protein associations. Proc. Natl. Acad. Sci. USA 89:6958-6962.
31. Larner, J. M., H. Lee, R. D. Little, P. A. Dijkwel, C. L. Schildkraut, and J. L. Hamlin. 1999. Radiation down-regulates replication origin activity throughout the S phase in mammalian cells. Nucleic Acids Res. 27:803-809.
32. Lavin, M. F. 2004. The Mre11 complex and ATM: a two-way functional interaction in recognising and signaling DNA double strand breaks. DNA Repair (Amsterdam) 3:1515-1520.[CrossRef]
33. Lee, H., J. M. Larner, and J. L. Hamlin. 1997. A p53-independent damage-sensing mechanism that functions as a checkpoint at the G1/S transition in Chinese hamster ovary cells. Proc. Natl. Acad. Sci. USA 94:526-531.
34. Lee, J. H., R. Ghirlando, V. Bhaskara, M. R. Hoffmeyer, J. Gu, and T. T. Paull. 2003. Regulation of Mre11/Rad50 by Nbs1: effects on nucleotide-dependent DNA binding and association with ataxia-telangiectasia-like disorder mutant complexes. J. Biol. Chem. 278:45171-45181.
35. Lee, J. H., and T. T. Paull. 2004. Direct activation of the ATM protein kinase by the Mre11/Rad50/Nbs1 complex. Science 304:93-96.
36. Lim, D. S., S. T. Kim, B. Xu, R. S. Maser, J. Lin, J. H. Petrini, and M. B. Kastan. 2000. ATM phosphorylates p95/nbs1 in an S-phase checkpoint pathway. Nature 404:613-617.[CrossRef][Medline]
37. Lobachev, K. S., D. A. Gordenin, and M. A. Resnick. 2002. The Mre11 complex is required for repair of hairpin-capped double-strand breaks and prevention of chromosome rearrangements. Cell 108:183-193.[CrossRef][Medline]
38. Maser, R. S., O. K. Mirzoeva, J. Wells, H. Olivares, B. R. Williams, R. A. Zinkel, P. J. Farnham, and J. H. Petrini. 2001. Mre11 complex and DNA replication: linkage to E2F and sites of DNA synthesis. Mol. Cell. Biol. 21:6006-6016.
39. Masutomi, K., E. Y. Yu, S. Khurts, I. Ben Porath, J. L. Currier, G. B. Metz, M. W. Brooks, S. Kaneko, S. Murakami, J. A. DeCaprio, R. A. Weinberg, S. A. Stewart, and W. C. Hahn. 2003. Telomerase maintains telomere structure in normal human cells. Cell 114:241-253.[CrossRef][Medline]
40. Matsuura, S., J. Kobayashi, H. Tauchi, and K. Komatsu. 2004. Nijmegen breakage syndrome and DNA double strand break repair by NBS1 complex. Adv. Biophys. 38:65-80.[CrossRef][Medline]
41. Matsuura, S., H. Tauchi, A. Nakamura, N. Kondo, S. Sakamoto, S. Endo, D. Smeets, B. Solder, B. H. Belohradsky, K. Der, V., M. Oshimura, M. Isomura, Y. Nakamura, and K. Komatsu. 1998. Positional cloning of the gene for Nijmegen breakage syndrome. Nat. Genet. 19:179-181.[CrossRef][Medline]
42. Merrick, C. J., D. Jackson, and J. F. Diffley. 2004. Visualization of altered replication dynamics after DNA damage in human cells. J. Biol. Chem. 279:20067-20075.
43. Meyerson, M., C. M. Counter, E. N. Eaton, L. W. Ellisen, P. Steiner, S. D. Caddle, L. Ziaugra
521-543, -Mre11-p540NAAIRS, or -Mre11-DD that was expressed and purified from baculovirus-producing insect cells. Immunoprecipitates were immunoblotted with anti-RPA1, -RPA2, and -Flag antibodies. Input, total input of RPA; No, RPA alone with no Mre11 or Nbs1 protein added. (C) GST-Mre11360-708 or GST was expressed in E. coli and purified with glutathione Sepharose beads. GST-Mre11360-708 or GST on beads was incubated with imidazole-eluted His-tagged RPA complexes purified from E. coli. After the mixture was washed, RPA1 and RPA2 retained on the GST-Mre11360-708 beads were detected by Western blotting. Input, 50% of the total input of various RPA complexes. (D) The amino acid sequence from positions 521 to 560 of the human Mre11 protein was aligned with Mre11 from other indicated species. Black boxes indicate conserved residues, and gray boxes indicate similar residues. The positions of the three NAAIRS mutations that were introduced into Mre11 are indicated above the sequence at the positions at which each mutation occurred. The two aspartic acid residues represented in white bold characters are essential for the interaction between the human Mre11 protein and RPA. Three Myc-tagged Mre11-NAAIRS mutants (p522 [changing amino acids 522 to 527], p529 [changing amino acids 529 to 534], and p540 [changing amino acids 540 to 545]), wild-type (WT) Mre11, and empty vector were transiently transfected into 293T cells and immunoprecipitated using an anti-Myc antibody (9E10) followed by immunoblotting as indicated (left panel). Similar experiments were performed using the Myc-tagged Mre11-DD to -AA mutant (aspartic acid residues 543 and 544 mutated to alanine residues), p540NAAIRS, and wild-type Mre11 (right panel). C. elegans, Caenorhabditis elegans.
