![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
Ludwig Institute for Cancer Research, Departments of Medicine and Cellular and Molecular Medicine, and Cancer Center, University of California, San Diego School of Medicine, 9500 Gilman Drive, La Jolla, California 92093-0669
Received 15 May 2007/ Returned for modification 15 June 2007/ Accepted 9 July 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The mechanism of mismatch repair is best understood for Escherichia coli, where mismatch repair has been reconstituted in vitro with purified proteins and defined DNA substrates (20, 37, 39). In this reaction, the MutS protein homodimer recognizes the abnormal DNA structure of base-base or insertion/deletion mispairs (24, 46, 49). The MutL homodimer binds to the MutS-DNA complex and activates MutH endonuclease, which nicks the unmethylated DNA strand at a hemimethylated GATC sequence, targeting repair to newly synthesized DNA strands (1, 5, 15, 17, 19, 47, 53). The nicked DNA strand is unwound by UvrD helicase and degraded by a number of exonucleases, resulting in the excision of the mispaired base; repair is completed by resynthesis of the excised strand (6, 27, 34). The detailed molecular mechanisms of many aspects of this reaction are still under investigation (1, 3, 25, 47).
The mismatch repair system in eukaryotes is more complex than, while conserved with, that of bacteria. Nonetheless, many of the proteins involved have been identified, their general biochemical properties have been determined, and at least partial repair reactions resembling those of bacteria have been reconstituted in vitro with purified proteins (10, 55). In eukaryotes, the dimeric MutS mismatch recognition protein has been replaced by two different heterodimers of MutS homologue proteins, the Msh2-Msh6 and Msh2-Msh3 complexes (26). Similarly, the MutL dimer has been replaced by two different heterodimers of MutL homologue proteins, the Mlh1-Pms1 (Pms2 in humans) and Mlh1-Mlh3 complexes (7, 14, 43, 52). In addition, it has been suggested that a third MutL homologue complex, Mlh1-Mlh2 (Pms1 in humans), may play a minor role in mismatch repair, although biochemical studies do not support this suggestion (21, 44). DNA polymerase 
, RPA, PCNA, RFC, and Exo1 have been shown to act in eukaryotic mismatch repair, although evidence suggests that additional proteins may be involved (38).
Current models of eukaryotic mismatch repair suggest that the Msh2-Msh6 complex is the major mismatch recognition complex and functions in the repair of base-base and insertion/deletion mispairs (20, 26, 37-39). The Msh2-Msh3 complex is redundant with the Msh2-Msh6 complex with respect to the repair of small insertion/deletion mispairs and is also able to recognize larger insertion/deletion mispairs (32, 33, 48). A number of genetic results are consistent with this scenario: null mutations in MSH2 result in a strong mutator phenotype characterized by the accumulation of base substitution and frameshift mutations; MSH6 defects result in a strong mutator phenotype with respect to base substitutions, but only a small increase in frameshift mutations; MSH3 defects cause weak mutator phenotypes characterized by the accumulation of frameshift mutations (however, in assays where larger frameshift mutations are analyzed, stronger mutator phenotypes are observed); and lastly, an msh3 msh6 double mutant recapitulates the mutator phenotype of an msh2 single mutant (32, 48).
Similar studies have led to the view that the Mlh1-Pms1 complex is the major MutL homologue complex that functions in eukaryotic mismatch repair, whereas the Mlh1-Mlh3 complex plays a minor role in mismatch repair and is partially redundant with the Mlh1-Pms1 complex (14, 43, 52). Genetic results supporting this view are as follows: null mutations in MLH1 and PMS1 result in a strong mutator phenotype characterized by the accumulation of base substitution and frameshift mutations; MLH3 defects result in a weak mutator phenotype primarily characterized by the accumulation of frameshift mutations; and the deletion of both MLH3 and PMS1 (PMS2 in human and mouse) is required to recapitulate the mutator phenotypes (and cancer prone phenotype in mice) caused by a defect in MLH1 (9, 23). Genetic analysis has also suggested that the Mlh1-Mlh3 complex primarily functions in conjunction with the Msh2-Msh3 complex (7, 14, 43, 44, 52). Biochemical studies are consistent, with the Mlh1-Pms1 complex playing the major role in mismatch repair, whereas the Mlh1-Mlh3 complex, which has been much less studied, has only weak in vitro mismatch repair activity (7, 10).
While the studies establishing the roles of the eukaryotic MutS and MutL homologue complexes in mismatch repair seem quite definitive, it is important to note that they have some limitations. First, the genetic results are based on a few types of assays. Reversion assays can detect only a limited number of mutation types. Forward mutation assays are less biased, but prior mutation spectrum analysis was performed at a time when it was not feasible to sequence large numbers of mutations in large unbiased forward mutation targets like the CAN1 gene. Even with analysis of small forward mutation targets, where large numbers of mutations can be analyzed, it is difficult to control biological variation within mutation spectrum analysis experiments. Second, the mutations observed in a given mutant background are the result of a complex process involving misincorporation errors at individual sites combined with how efficiently other competing pathways, including editing exonucleases, bypass DNA polymerases and the different mismatch repair pathways act on mispairs and mispair-producing errors. Third, because of the low mutation rates caused by defects in MSH3 and MLH3, it has been difficult to genetically characterize the roles of Msh2-Msh3 and Mlh1-Mlh3 in vivo, which is further complicated by the fact that these defects are masked by the activity of the Msh2-Msh6 and Mlh1-Pms1 complexes, respectively (14, 32, 48). Lastly, biochemical studies have used a limited diversity of substrates and mispairs predicted to occur in vivo have generally not been used as substrates, in vitro. Here we have used a genetic approach to identify mutations that arose in the absence of the Saccharomyces cerevisiae protein Msh6 or Msh3 in vivo and then used DNA substrates derived from the mutated sequences to analyze Msh2-Msh3 and Msh2-Msh6 binding affinities in vitro. Our results indicate that Msh2-Msh3 plays a previously unrecognized role in the repair of specific base-base mispairs and imply that the Mlh1-Mlh3 complex may also function in similar repair reactions. Additionally, we demonstrated that Msh2-Msh3 and Mlh1-Mlh3 play a previously unrecognized role in the suppression of homology-mediated duplication and deletion mutations.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
ura3-52 leu2-1 trp1-63 hom3-10 his3-200 lys2-10A (4). The relevant genotypes of these strains are as follows: msh3::hisG for RDKY4149; msh6::hisG for RDKY4151, mlh3::HIS3 for RDKY5295, and mlh1::hisG for RDKY4237. The protease-deficient strain RDKY2418 MAT ura3-52 leu2-1 his3-200 pep4::HIS3 prb1-1.6R can1 msh2::hisG msh6::hisG was used to overexpress proteins for purification (22). Genetic complementation of MSH3 derivatives was measured in S. cerevisiae strain RDKY4234 MAT ura3-52 leu2-1 trp1-63 hom3-10 his3-200 lys2-10A msh3::hisG msh6::hisG. Mutation rates were determined by fluctuation analysis using at least 14 independent colonies from each strain as previously described (2, 4, 11, 45). Genetic complementation. Site-directed mutagenesis of a wild-type MSH3 low-copy-number LEU2 plasmid was performed to mutate the Met codon at position 1 to Ala (M1A) or the Met codon at position 30 to Ala (M30A). Primers to create the msh3-M1A allele were JH67 5'-AATTTTGACAAAGCCAATTTGAACTCCAAAGCTGCCCCAGCTACCCCTAAACTTCTAAGACT and JH68 5'-AGTCTTAGAAGTTTTAGGGGTAGCTGGGGCAGCTTTGGAGTTCAAATTGGCTTTGTCAAAATT. Primers to create the msh3-M30A allele were JH69 5'-GAAAATGGCTCCACATCTTCTCAAAAGAAAGCTAAGCAATCGAGTTTGTTATCTTTTTTCTCA and JH70 5'-TGAGAAAAAAGATAACAAACTCGATTGCTTAGCTTTCTTTTGAGAAGATGTGGAGCCATTTTC. The msh3 mutant plasmids were sequenced to confirm that only the desired mutation was present. Plasmids were then transformed into strain RDKY4234, and transformants were patched onto media lacking Leu to maintain plasmid selection. Patches were then replica plated onto plates lacking Lys and Thr and grown at 30°C for 2 days to select for lys2-10A and hom3-10 revertants so as to visualize the mutator phenotype of the different plasmid-containing strains.
Mutation analysis. Strains of interest were first streaked for single colonies on yeast extract-peptone-dextrose plates, and then individual colonies were patched onto yeast extract-peptone-dextrose plates. The patches were replica plated onto selective media without Arg/with Can, and canavanine-resistant mutants were allowed to grow at 30°C for 2 days. Mutation spectra were analyzed by isolating chromosomal DNA from one Canr mutant per patch, amplifying the CAN1 gene by PCR and sequencing to determine the inactivating mutation in the CAN1 gene (11, 14, 32). The PCR primer pair used for amplification of CAN1 was CAN1FX (5'-GTTGGATCCAGTTTTTAATCTGTCGTC) and CAN1RX (5'-TTCGGTGTATGACTTATGAGGGTG). The three primers used for sequencing CAN1 were CAN1G (5'-CAGTGGAACTTTGTACGTCC), CANSEQ3 (5'-TTCTGTCACGCAGTCCTTGG), and CANSEQ5 (5'-AACTAGTTGGTATCACTGCT). All DNA sequencing was performed by using an Applied Biosystems 3730XL DNA sequencer and standard chemistry. Sequence analysis was performed using Sequencher 4.2.2 (Gene Codes, Ann Arbor, MI).
Statistical analysis.
The significance of the observed overlap between the CAN1 base substitution mutation spectra in different strains was calculated with a Monte Carlo technique. Since the observed base substitution mutations were unlikely to be saturating, the total number of readily mutable CAN1-inactivating mutation sites was estimated by fitting the observed distribution of singly and multiply observed base substitution mutations to a theoretical Poisson distribution. We minimized the root-mean-square error between the expected and observed number of singly and multiply observed mutations using the equation
 |
) is the probability with the parameter = C/N, with C being the number of observed events and N being the total number of possible mutation sites, defined by both the position and the base substitution at that position. Minimization of 
by varying N in the range (1,600) gives the total number of mutations, including those not observed in experimental sampling. By using the Poisson distribution, we assumed that all observed base substitution mutations within a strain occur with equal efficiencies and that mutations in multiple isolates are independent of each other. For the wild-type and msh3 strains, the best fitted Poisson curves used values of N = 159 and N = 259, respectively. Using the total number of inactivating mutations, the results for two different models were calculated. In model 1, the readily mutated CAN1-inactivating mutations are identical in both strains and each strain was allowed to accumulate mutations at any of the 259 or 159 mutation sites (the predicted number of mutations in the msh3 and wild-type strains, respectively). In model 2, the mutational spectra were treated as overlapping but distinct in that the wild-type strain was allowed to accumulate mutations at only 159 of the 259 mutation sites for the msh3 strain. Mutations were then randomly selected for both strains by using each of the two models. The total number of randomly chosen mutations was equal to the number of observed mutations in each strain. The overlap of these theoretical distributions of mutation sites was then calculated. We repeated this process 50,000 times and used a z score test to calculate the significance of the observed overlaps by using the null hypothesis that differences in overlap in base substitution mutation spectra between wild-type and msh3 strains were due to sampling and not due to differences in the specificity of mutation accumulation.
The two-tailed Mann-Whitney test, the chi square "goodness of fit" test, and the Fisher exact probability test were performed on the VassarStats website (http://faculty.vassar.edu/lowry/VassarStats.html).
Overexpression and purification of Msh2-Msh3 complex. The S. cerevisiae Msh2-Msh3 heterodimer was coexpressed from GAL10 promoter plasmids in the protease-deficient yeast strain RDKY2418. The Msh2 expression vector contains a GAL10 promoter fused to the MSH2 gene on a 2µm URA3 Ampr plasmid. The Msh3 expression vector contains a GAL10 promoter fused to the MSH3 FLAG-tagged gene on a 2µm LEU2 Ampr plasmid. The Msh3 expression vector fuses the GAL10 promoter to the methionine at amino acid position 30 according to the Saccharomyces genome database (http://www.yeastgenome.org/) coding sequence using the leader sequence AAGGAGATATACATatg and contains a C-terminal FLAG tag sequence, cacGACTACAAGGACGACGATGACAAGtga, where the last codon of MSH3 (cac 1047) is shown in lowercase and the FLAG codons are shown in uppercase, followed by the stop codon; genetic complementation studies showed that this FLAG tag did not affect the biological function of MSH3 (data not shown). A fermentor was used to grow 10 liters of cells in synthetic dropout medium lacking uracil and leucine and containing 2% raffinose to an optical density of 0.8 at 30°C. The expression of Msh2 and Msh3 was then induced by adding galactose to a final concentration of 2% for 8 h. The cells were harvested by centrifugation, and the resulting cell pellet was resuspended in lysis buffer (500 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 5 mM dithiothreitol, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, leupeptin, benzamidine, pepstatin) and lysed with glass beads (Sigma) in a bead beater (Biospec Products, Inc., Bartlesville, OK). The Msh2-Msh3 heterodimer was purified by sequential chromatography on 30-ml Polybuffer Exchanger 94 resin, 10-ml High Trap Q, 5-ml heparin, 10-ml DNA cellulose, 1-ml SP-Sepharose, and 1-ml DEAE columns. Fractions either were frozen directly in liquid N2 and stored at –80°C or were concentrated by centrifugation in a Centricon YM30 (Millipore, Billerica, MA) and then frozen. Protein concentrations were determined by comparison to known protein concentrations on a Coomassie blue-stained gel. The yield from 10 liters of cells was 15 µg of Msh2-Msh3 protein. Additionally, the purified protein was digested with trypsin and subjected to mass spectrometry to confirm its identity. Msh2-Msh6 was provided by Dan Mazur (35).
DNA substrates. Oligonucleotides were synthesized by Midland Certified Reagent Company (Midland, TX). Double-stranded DNA substrates were constructed by annealing 38-bp complementary oligonucleotides at 95°C for 5 min in annealing buffer (0.5 M NaCl, 10 mM Tris-HCl, pH 7.5, 1 mM EDTA), followed by slowly cooling over 2 h. DNA duplexes were purified by high-pressure liquid chromatography using a Waters GEN-PAK FAX column (33). The sequences of the different oligonucleotides and double-stranded DNA substrates are presented in Table S2 in the supplemental material.
In vitro DNA binding experiments.
Purified DNA substrates were 5' end labeled using [
-32P]ATP and T4 polynucleotide kinase and purified by centrifugation through mini Quick Spin oligonucleotide columns (Roche, Indianapolis, IN). DNA binding assays were performed by combining 16 nM protein (Msh2-Msh6 or Msh2-Msh3 heterodimer) with 14 nM 32P-labeled substrate in a final volume of 10 µl binding buffer (20 mM Tris-HCl, pH 8.0, 110 mM NaCl, 5 mM MgCl2, 1 mM dithiothreitol, 10 µM ADP, 5% glycerol, 70 nM unlabeled GC homoduplex, 100 mM bovine serum albumin). Reaction mixtures were incubated on ice for 15 min and then 500 µM ATP was added as indicated in individual experiments for 15 min before loading dye was added. Gel electrophoresis of the samples was performed on a 4 to 20% gradient TBE (45 mM Tris borate, 1 mM EDTA, pH 8.0) Criterion gel (Bio-Rad, Hercules, CA) run in 0.5x TBE, 5% glycerol for 3 h at 150 V at 4°C. Gels were then soaked for 1 h in 40% MeOH, 10% acetic acid, 5% glycerol before being dried and analyzed using a PhosphorImager and ImageQuant software (Molecular Dynamics, Sunnyvale, CA).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
|
|
Although saturation of the mutation target did not occur, we could analyze the overlap of the mutation spectra for the various strains. By fitting the base substitution mutation spectrum data (specifically the number of unique and recurrent mutations) to Poisson distributions, we estimated that the wild-type strain contains 159 sites available for mutation and the msh3 strain contains 259 sites available for mutation; the larger number of mutable sites in the msh3 mutant is consistent with a defect in repair leading to base substitution mutations. Next we examined the relationship between the 159 wild-type and 259 msh3 mutation sites. We found that (i) it is unlikely that the wild-type and msh3 strains explicitly share the same mutation sites (P was 0.0215, assuming 259 sites available to both strains; P was 7.992 x 10–5, assuming 159 sites available to both strains) and (ii) it is unlikely that the deletion of MSH3 simply added additional mutation sites to a wild-type strain (P = 0.032). Thus, our data suggests that while the spectra of base substitution mutations in both the wild-type and msh3 strains overlap to some degree, they are likely to be different from each other.
To further analyze the spectrum of base substitution mutations seen in the msh3, msh6, and mlh3 mutants, the classes of observed base substitution mutations were compared (Table 3). The msh3, msh6, and mlh3 strains showed statistically different spectra of mutation classes compared to that of the wild type (P = 0.0001, 0.0003, and 0.0147, respectively, two-tailed chi square "goodness of fit" test). Compared to the wild type, the msh3 strain showed increases in base pair mutations of GC to CG and AT to TA and decreases in base pair mutations of GC to AT and AT to CG. Consistent with the known role of Msh6 in the repair of base-base mispairs, the msh6 strain showed distinct differences from the wild-type strain, including a striking absence of base substitutions of GC to CG base pairs. One hypothesis that could explain these data is that the Msh2-Msh3 complex is able to specifically recognize one of the base-base mispairs involved in these two classes of base substitutions seen to increase either a GG or a CC mispair involved in a base substitution of GC to CG base pairs and either an AA or a TT mispair involved in a base substitution of AT to TA base pairs.
Expression of Msh3. We initially attempted to overproduce the Msh2-Msh3 complex by fusing the GAL10 promoter and an optimal Kozak consensus sequence to codon 1 of MSH3 and coexpress it with Msh2 but were unable to detect significant amounts of Msh3-FLAG by Western blotting. Similarly, a reconstructed version of a previously published Msh3 expression vector containing the GAL10 promoter upstream of codon 1 (18) only resulted in low-level Msh3 expression. This led us to consider whether Met codon 1 was in fact the correct translational start codon. By aligning the conserved PCNA binding motif present in various Saccharomyces Msh3 proteins, we found that the equivalent of S. cerevisiae Met codon 30 was conserved among all of the Msh3 proteins analyzed, whereas only S. cerevisiae and Saccharomyces paradoxus MSH3 contained 29 upstream codons, including Met codon 1, suggesting that the start site for translation might be at codon 30 (Fig. 1A). Plasmids were then constructed that contained the native MSH3 promoter and gene to analyze Ala substitution mutations at each position, M1A and M30A. The msh3-M1A allele was able to complement the mutator phenotype of the msh3 msh6 strain to the same level as did wild-type MSH3 (Fig. 1B), but neither the msh3-M30A allele nor the vector control was able to complement. These results indicate that Met codon 30 is the initiation codon for in vivo translation of the S. cerevisiae MSH3 gene. Consistent with this result, fusion of the GAL10 promoter and an optimal Kozak consensus sequence to codon 30 of MSH3 resulted in approximately 10-times-higher levels of Msh3 expression when Msh2 was coexpressed compared to that observed with the longer MSH3 allele (18).
|
|
To extend the above results, binding of Msh2-Msh3 to a greater diversity of CAN1 derived base-base mispairs was analyzed (Table 4); three were at sites found to be mutated in the msh3 spectrum, and two each were at sites found to be mutated in the msh6 or wild-type spectra. The substrates analyzed included sites that were and were not mutated in msh3 mutants and also included mispairs that were and were not predicted to underlie the classes of mutations that were preferentially found in the msh3 mutation spectrum. In these experiments, very strong binding (greater than fourfold over the GC control) was observed for four mispairs (CC 1196, CT 1196, AA 1193, and AC 1193) and binding that was at least twofold above the control binding was observed for an additional seven mispairs (CC 413, AA 1196, AC 1196, GG 1196, AA 1628, AC 807, and AG 1196). Weak or no binding was observed for an additional 14 mispairs. ATP promoted dissociation from the mispair in each case (data not shown). Of the 11 mispairs showing the strongest binding, 6 were of the classes suggested by mutation spectra analysis to undergo Msh2-Msh3-dependent repair, GG or CC and AA or TT. Of the seven total sites analyzed, Msh2-Msh3 did not show high-level mispair binding at the following two sites: 955, found to be mutated in an msh6 mutant and 314 found to be mutated in an msh3 mutant. However, Msh2-Msh3 did show binding at five other sites: 1193 and 1196, found to be mutated in an msh3 mutant; 413 and 1628, found to be mutated in the wild-type strain; and 807, found to be mutated in an msh6 mutant.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Previous studies have analyzed the effect of different mismatch repair defects in a number of mutator assays sometimes combined with sequencing of mutation spectra to infer the role of different proteins in mismatch repair. As noted above, these types of studies have a number of limitations. In the current study, we sequenced larger numbers of independent mutations in a large, relatively unbiased forward mutation target than the numbers in prior studies and found that a msh3 strain appeared to accumulate a spectrum of base substitutions that differed from that of wild-type or msh6 strains; differences in the spectrum of frameshift mutations were also observed, although we did not further analyze these mutations as it is well accepted that Msh2-Msh3 and Msh2-Msh6 both function in the repair of insertion/deletion mispairs (20, 26, 37-39). It is probably difficult to completely saturate the CAN1 mutation spectrum in the strains tested; nonetheless, there was very little overlap in the mutation spectra and there were significant differences between the overall mutation spectra observed as well as in the classes of base substitutions seen. These data support the hypothesis that the Msh2-Msh3 complex functions in the repair of base-base mispairs. However, it is difficult to determine how efficiently the Msh2-Msh3 complex can act in such repair events in vivo because competition by Msh2-Msh6-dependent repair clearly obscures the msh3 mutator phenotype. In mammalian cells, the Msh6 mismatch repair pathway dominates mismatch repair because the Msh2-Msh6 complex is found at 6-fold-higher to 10-fold-higher levels than the Msh2-Msh3 complex is (13, 16). The ratio of the two complexes is not known in S. cerevisiae due to the lack of good Msh3 antibodies. However, the observations that msh3 mutants have detectable mutator phenotypes (32, 48) and that a single-copy MSH3 plasmid can suppress dominant msh6 mutations (11) suggest that the Msh3 pathway plays a significant role in mismatch repair in wild-type S. cerevisiae.
By performing mispair binding studies with oligonucleotide duplexes based on the sequence of the CAN1 gene that contained mispairs that were or were not found at sites mutated in the msh3 mutation spectrum and that were or were not the mispairs predicted to underlie the mutation seen, we were able to demonstrate that the Msh2-Msh3 complex could robustly bind specific base-base mispairs, including ones that were not well recognized by Msh2-Msh6; base-base mispairs that were not bound by Msh2-Msh3 were also found. The Msh2-Msh3 base-base mispair binding was sensitive to ATP addition, upon which Msh2-Msh3 quickly dissociated from the DNA substrate, as predicted for bona-fide mispair binding (36, 54). Significant binding of base-base mispairs by Msh2-Msh3 has not previously been observed; our use of mispairs based on in vivo mutation sites is likely what made it possible to observe binding of base-base mispairs by Msh2-Msh3. These results support the hypothesis that Msh2-Msh3 can function in the repair of base-base mispairs and suggest that such repair augments Msh2-Msh6-dependent repair of base-base mispairs. A considerable amount of structural information is available on how MutS recognizes mispairs, and Msh6 shares the key MutS mispair recognition structural determinants, including the Phe residue that stacks on the mispaired base and other residues that contact the DNA backbone (12, 28, 40). Msh3 lacks this key Phe residue but retains six residues that contact the DNA backbone in MutS and are present in Msh6 as well (29). However, four of these residues have been mutated in Msh3 and only one was found to be important for Msh3-dependent mismatch repair (12, 29). Given our analysis indicating that the Msh2-Msh6 and Msh2-Msh3 complexes can recognize the same classes of mispairs (i.e., base-base and insertion/deletion mispairs), the lack of the mispair-contacting Phe residue and the lack of a requirement for many of the other predicted critical DNA-contacting residues suggest that Msh3 may utilize a distinct structural mechanism for mispair recognition.
Additionally, we found that msh3 and mlh3 mutants exhibit a significant increase in the rate of accumulation of homology-mediated duplication and deletion mutations. This type of mutation has been suggested to arise in rad27 mutants due to errors in processing the ends of Okazaki fragments, leading to double-strand breaks and aberrant repair of the double-strand breaks (51) possibly by single-strand annealing recombination (SSA). However, the deletion and duplication mutations seen in an msh3 mutant (and probably in an mlh3) probably cannot be mediated by SSA because Msh3 is required for SSA and, in particular, for those events that occur by SSA between short homologous DNA sequences like those implicated in the deletion and duplication mutations seen here (50). It seems unlikely that loss of Msh3 and Mlh3 causes the same type of defects as does loss of Rad27 since an msh3 mutation did not cause an increase in the rate of gross chromosomal rearrangements as seen for rad27 mutants (data not shown) (8). It is also unlikely that all errors arising in the absence of Rad27, which result in duplication and deletion events, are normally repaired by mismatch repair since mismatch repair defects do not result in a synergistic increase in mutation rate when combined with a rad27 mutation (unpublished results) (51). More likely possibilities are either that Rad27, Msh2-Msh3, and Mlh1-Mlh3 function together in a subclass of repair events or that only a proportion of the errors induced by the absence of Rad27 are repaired by Msh2-Msh3- and Mlh1-Mlh3-dependent mismatch repair. For example, Msh2-Msh3 and possibly Rad27 could interact with aberrant branched structures that form at stalled or damaged replication forks; additionally, Mlh1-Mlh3 could act in subsequent repair events (50). Additional studies will be required to elucidate the exact mechanisms involved.
In summary, the results presented here indicate a need for modification of the current models of mismatch repair, such that in the early step of mismatch repair, both Msh2-Msh6 and Msh2-Msh3 recognize base-base and insertion/deletion mispairs; this redundancy likely increases the overall efficiency of mismatch repair. In addition, our results have implicated the Msh2-Msh3 and Mlh1-Mlh3 complexes in the suppression of homology-mediated duplication and deletion mutations like those that occur in rad27 mutants, thus expanding current views of the role of mismatch repair in suppressing mutations.
|
ACKNOWLEDGMENTS |
|---|
This work was funded by NIH grant GM50006.
We declare that we have no competing financial interests.
|
FOOTNOTES |
|---|
Published ahead of print on 16 July 2007.
Supplemental material for this article may be found at http://mcb.asm.org/.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Alani, E., R. A. Reenan, and R. D. Kolodner. 1994. Interaction between mismatch repair and genetic recombination in Saccharomyces cerevisiae. Genetics 137:19-39.[Abstract]
3. Allen, D. J., A. Makhov, M. Grilley, J. Taylor, R. Thresher, P. Modrich, and J. D. Griffith. 1997. MutS mediates heteroduplex loop formation by a translocation mechanism. EMBO J. 16:4467-4476.[CrossRef][Medline]
4. Amin, N. S., M. N. Nguyen, S. Oh, and R. D. Kolodner. 2001. exo1-dependent mutator mutations: model system for studying functional interactions in mismatch repair. Mol. Cell. Biol. 21:5142-5155.
5. Au, K. G., K. Welsh, and P. Modrich. 1992. Initiation of methyl-directed mismatch repair. J. Biol. Chem. 267:12142-12148.
6. Burdett, V., C. Baitinger, M. Viswanathan, S. T. Lovett, and P. Modrich. 2001. In vivo requirement for RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair. Proc. Natl. Acad. Sci. USA 98:6765-6770.
7. Cannavo, E., G. Marra, J. Sabates-Bellver, M. Menigatti, S. M. Lipkin, F. Fischer, P. Cejka, and J. Jiricny. 2005. Expression of the MutL homologue hMLH3 in human cells and its role in DNA mismatch repair. Cancer Res. 65:10759-10766.
8. Chen, C., and R. D. Kolodner. 1999. Gross chromosomal rearrangements in Saccharomyces cerevisiae replication and recombination defective mutants. Nat. Genet. 23:81-85.[Medline]
9. Chen, P. C., S. Dudley, W. Hagen, D. Dizon, L. Paxton, D. Reichow, S. R. Yoon, K. Yang, N. Arnheim, R. M. Liskay, and S. M. Lipkin. 2005. Contributions by MutL homologues Mlh3 and Pms2 to DNA mismatch repair and tumor suppression in the mouse. Cancer Res. 65:8662-8670.
10. Constantin, N., L. Dzantiev, F. A. Kadyrov, and P. Modrich. 2005. Human mismatch repair: reconstitution of a nick-directed bidirectional reaction. J. Biol. Chem. 280:39752-39761.
11. Das Gupta, R., and R. D. Kolodner. 2000. Novel dominant mutations in Saccharomyces cerevisiae MSH6. Nat. Genet. 24:53-56.[CrossRef][Medline]
12. Drotschmann, K., W. Yang, F. E. Brownewell, E. T. Kool, and T. A. Kunkel. 2001. Asymmetric recognition of DNA local distortion. Structure-based functional studies of eukaryotic Msh2-Msh6. J. Biol. Chem. 276:46225-46229.
13. Drummond, J. T., J. Genschel, E. Wolf, and P. Modrich. 1997. DHFR/MSH3 amplification in methotrexate-resistant cells alters the hMutSalpha/hMutSbeta ratio and reduces the efficiency of base-base mismatch repair. Proc. Natl. Acad. Sci. USA 94:10144-10149.
14. Flores-Rozas, H., and R. D. Kolodner. 1998. The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations. Proc. Natl. Acad. Sci. USA 95:12404-12409.
15. Galio, L., C. Bouquet, and P. Brooks. 1999. ATP hydrolysis-dependent formation of a dynamic ternary nucleoprotein complex with MutS and MutL. Nucleic Acids Res. 27:2325-2331.
16. Genschel, J., S. J. Littman, J. T. Drummond, and P. Modrich. 1998. Isolation of MutSbeta from human cells and comparison of the mismatch repair specificities of MutSbeta and MutSalpha. J. Biol. Chem. 273:19895-19901.
17. Grilley, M., K. M. Welsh, S. S. Su, and P. Modrich. 1989. Isolation and characterization of the Escherichia coli mutL gene product. J. Biol. Chem. 264:1000-1004.
18. Habraken, Y., P. Sung, L. Prakash, and S. Prakash. 1996. Binding of insertion/deletion DNA mismatches by the heterodimer of yeast mismatch repair proteins MSH2 and MSH3. Curr. Biol. 6:1185-1187.[CrossRef][Medline]
19. Hall, M. C., and S. W. Matson. 1999. The Escherichia coli MutL protein physically interacts with MutH and stimulates the MutH-associated endonuclease activity. J. Biol. Chem. 274:1306-1312.
20. Harfe, B. D., and S. Jinks-Robertson. 2000. DNA mismatch repair and genetic instability. Annu. Rev. Genet. 34:359-399.[CrossRef][Medline]
21. Harfe, B. D., B. K. Minesinger, and S. Jinks-Robertson. 2000. Discrete in vivo roles for the MutL homologs Mlh2p and Mlh3p in the removal of frameshift intermediates in budding yeast. Curr. Biol. 10:145-148.[CrossRef][Medline]
22. Hess, M. T., R. D. Gupta, and R. D. Kolodner. 2002. Dominant Saccharomyces cerevisiae msh6 mutations cause increased mispair binding and decreased dissociation from mispairs by Msh2-Msh6 in the presence of ATP. J. Biol. Chem. 277:25545-25553.
23. Heyer, J., K. Yang, M. Lipkin, W. Edelmann, and R. Kucherlapati. 1999. Mouse models for colorectal cancer. Oncogene 18:5325-5333.[CrossRef][Medline]
24. Joshi, A., S. Sen, and B. J. Rao. 2000. ATP-hydrolysis-dependent conformational switch modulates the stability of MutS-mismatch complexes. Nucleic Acids Res. 28:853-861.
25. Junop, M. S., G. Obmolova, K. Rausch, P. Hsieh, and W. Yang. 2001. Composite active site of an ABC ATPase: MutS uses ATP to verify mismatch recognition and authorize DNA repair. Mol. Cell 7:1-12.[CrossRef][Medline]
26. Kolodner, R. D., and G. T. Marsischky. 1999. Eukaryotic DNA mismatch repair. Curr. Opin. Genet. Dev. 9:89-96.[CrossRef][Medline]
27. Lahue, R. S., K. G. Au, and P. Modrich. 1989. DNA mismatch correction in a defined system. Science 245:160-164.
28. Lamers, M. H., A. Perrakis, J. H. Enzlin, H. H. Winterwerp, N. de Wind, and T. K. Sixma. 2000. The crystal structure of DNA mismatch repair protein MutS binding to a G x T mismatch. Nature 407:711-717.[CrossRef][Medline]
29. Lee, S. D., J. A. Surtees, and E. Alani. 2007. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition. J. Mol. Biol. 366:53-66.[CrossRef][Medline]
30. Lühr, B., J. Scheller, P. Meyer, and W. Kramer. 1998. Analysis of in vivo correction of defined mismatches in the DNA mismatch repair mutants msh2, msh3 and msh6 of Saccharomyces cerevisiae. Mol. Gen. Genet. 257:362-367.[CrossRef][Medline]
31. Lynch, H. T., and A. de la Chapelle. 2003. Hereditary colorectal cancer. N. Engl. J. Med. 348:919-932.
32. Marsischky, G. T., N. Filosi, M. F. Kane, and R. Kolodner. 1996. Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10:407-420.
33. Marsischky, G. T., and R. D. Kolodner. 1999. Biochemical characterization of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 complex and mispaired bases in DNA. J. Biol. Chem. 274:26668-26682.
34. Matson, S. W., and A. B. Robertson. 2006. The UvrD helicase and its modulation by the mismatch repair protein MutL. Nucleic Acids Res. 34:4089-4097.
35. Mazur, D. J., M. L. Mendillo, and R. D. Kolodner. 2006. Inhibition of Msh6 ATPase activity by mispaired DNA induces a Msh2(ATP)-Msh6(ATP) state capable of hydrolysis-independent movement along DNA. Mol. Cell 22:39-49.[CrossRef][Medline]
36. Mendillo, M. L., D. J. Mazur, and R. D. Kolodner. 2005. Analysis of the interaction between the Saccharomyces cerevisiae MSH2-MSH6 and MLH1-PMS1 complexes with DNA using a reversible DNA end-blocking system. J. Biol. Chem. 280:22245-22257.
37. Modrich, P. 1991. Mechanisms and biological effects of mismatch repair. Annu. Rev. Genet. 25:229-253.[CrossRef][Medline]
38. Modrich, P. 2006. Mechanisms in eukaryotic mismatch repair. J. Biol. Chem. 281:30305-30309.
39. Modrich, P., and R. Lahue. 1996. Mismatch repair in replication fidelity, genetic recombination, and cancer biology. Annu. Rev. Biochem. 65:101-133.[CrossRef][Medline]
40. Natrajan, G., M. H. Lamers, J. H. Enzlin, H. H. Winterwerp, A. Perrakis, and T. K. Sixma. 2003. Structures of Escherichia coli DNA mismatch repair enzyme MutS in complex with different mismatches: a common recognition mode for diverse substrates. Nucleic Acids Res. 31:4814-4821.
41. Nicholson, A., M. Hendrix, S. Jinks-Robertson, and G. F. Crouse. 2000. Regulation of mitotic homeologous recombination in yeast. Functions of mismatch repair and nucleotide excision repair genes. Genetics 154:133-146.
42. Peltomäki, P. 2003. Role of DNA mismatch repair defects in the pathogenesis of human cancer. J. Clin. Oncol. 21:1174-1179.
43. Prolla, T. A., Q. Pang, E. Alani, R. D. Kolodner, and R. M. Liskay. 1994. MLH1, PMS1, and MSH2 interactions during the initiation of DNA mismatch repair in yeast. Science 265:1091-1093.
44. Räschle, M., G. Marra, M. Nystrom-Lahti, P. Schar, and J. Jiricny. 1999. Identification of hMutLbeta, a heterodimer of hMLH1 and hPMS1. J. Biol. Chem. 274:32368-32375.
45. Reenan, R. A., and R. D. Kolodner. 1992. Characterization of insertion mutations in the Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate mitochondrial and nuclear functions. Genetics 132:975-985.[Abstract]
46. Schofield, M. J., S. Nayak, T. H. Scott, C. Du, and P. Hsieh. 2001. Interaction of Escherichia coli MutS and MutL at a DNA mismatch. J. Biol. Chem. 276:28291-28299.
47. Selmane, T., M. J. Schofield, S. Nayak, C. Du, and P. Hsieh. 2003. Formation of a DNA mismatch repair complex mediated by ATP. J. Mol. Biol. 334:949-965.[CrossRef][Medline]
48. Sia, E. A., M. Dominska, L. Stefanovic, and T. D. Petes. 2001. Isolation and characterization of point mutations in mismatch repair genes that destabilize microsatellites in yeast. Mol. Cell. Biol. 21:8157-8167.
49. Su, S. S., R. S. Lahue, K. G. Au, and P. Modrich. 1988. Mispair specificity of methyl-directed DNA mismatch correction in vitro. J. Biol. Chem. 263:6829-6835.
50. Surtees, J. A., and E. Alani. 2006. Mismatch repair factor MSH2-MSH3 binds and alters the conformation of branched DNA structures predicted to form during genetic recombination. J. Mol. Biol. 360:523-536.[CrossRef][Medline]
51. Tishkoff, D. X., N. Filosi, G. M. Gaida, and R. D. Kolodner. 1997. A novel mutation avoidance mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair. Cell 88:253-263.[CrossRef][Medline]
52. Wang, T. F., N. Kleckner, and N. Hunter. 1999. Functional specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction. Proc. Natl. Acad. Sci. USA 96:13914-13919.
53. Welsh, K. M., A. L. Lu, S. Clark, and P. Modrich. 1987. Isolation and characterization of the Escherichia coli mutH gene product. J. Biol. Chem. 262:15624-15629.
54. Wilson, T., S. Guerrette, and R. Fishel. 1999. Dissociation of mismatch recognition and ATPase activity by hMSH2-hMSH3. J. Biol. Chem. 274:21659-21664.
55. Zhang, Y., F. Yuan, S. R. Presnell, K. Tian, Y. Gao, A. E. Tomkinson, L. Gu, and G. M. Li. 2005. Reconstitution of 5'-directed human mismatch repair in a purified system. Cell 122:693-705.[CrossRef][Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
