This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ciesla, M.
Right arrow Articles by Boguta, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ciesla, M.
Right arrow Articles by Boguta, M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, November 2007, p. 7693-7702, Vol. 27, No. 21
0270-7306/07/$08.00+0     doi:10.1128/MCB.01051-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Maf1 Is Involved in Coupling Carbon Metabolism to RNA Polymerase III Transcription{triangledown} ,{dagger}

Malgorzata Ciesla,1 Joanna Towpik,1 Damian Graczyk,1 Danuta Oficjalska-Pham,1,2,{ddagger} Olivier Harismendy,2,§ Audrey Suleau,2 Karol Balicki,1 Christine Conesa,2 Olivier Lefebvre,2 and Magdalena Boguta1*

Department of Genetics, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw, Poland,1 CEA, iBiTecS, Gif Sur Yvette F-91191, France2

Received 14 June 2007/ Returned for modification 4 July 2007/ Accepted 23 August 2007


arrow
ABSTRACT
 
RNA polymerase III (Pol III) produces essential components of the biosynthetic machinery, and therefore its activity is tightly coupled with cell growth and metabolism. In the yeast Saccharomyces cerevisiae, Maf1 is the only known global and direct Pol III transcription repressor which mediates numerous stress signals. Here we demonstrate that transcription regulation by Maf1 is not limited to stress but is important for the switch between fermentation and respiration. Under respiratory conditions, Maf1 is activated by dephosphorylation and imported into the nucleus. The transition from a nonfermentable carbon source to that of glucose induces Maf1 phosphorylation and its relocation to the cytoplasm. The absence of Maf1-mediated control of tRNA synthesis impairs cell viability in nonfermentable carbon sources. The respiratory phenotype of maf1-{Delta} allowed genetic suppression studies to dissect the mechanism of Maf1 action on the Pol III transcription apparatus. Moreover, in cells grown in a nonfermentable carbon source, Maf1 regulates the levels of different tRNAs to various extents. The differences in regulation may contribute to the physiological role of Maf1.


arrow
INTRODUCTION
 
In its natural environment, the budding yeast Saccharomyces cerevisiae is confronted with variations in sugar availability. Fermentation is the pathway by which cells obtain energy in the presence of glucose, even under aerobic conditions. After consuming all the available glucose, yeast cells use ethanol or another nonfermentable carbon source and get energy from mitochondrial respiration. Gradual glucose exhaustion or abrupt withdrawal of fermentable carbon source results in widespread changes in gene expression at both the transcriptional and the translational levels (6, 16, 31).

Yeast growth is controlled by two global nutrient-sensing signal transduction cascades, the RAS and the target of rapamycin (TOR) cascades. In response to glucose, the RAS cascade stimulates the synthesis of cyclic AMP (cAMP), which subsequently activates protein kinase A (PKA), the main player in the pathway. Multiple PKA substrates are known to support growth in glucose and to negatively regulate the physiology of the stationary phase and nutrient starvation and stress (37). The central components of the TOR pathway consist of two TOR kinases and a phosphate switch composed of protein phosphatase 2A and its inhibitor Tap42 (9). TOR signaling controls all three RNA polymerase systems involved in ribosome biogenesis (22, 39, 42). Polymerase II (Pol II)-directed transcription of ribosomal protein genes is regulated by the proteins Fhl1, Ifh1, and Crf1; Fhl1 is controlled by the TOR and Crf1 by the RAS pathway (21, 34). The mode of coordination of the Pol II-dependent transcription of ribosomal protein genes with the activity of Pol I and Pol III is currently unknown. A recent study suggested that Pol I activity is a key factor for this coordination (17).

Pol III transcription is controlled by Maf1, a general negative regulator conserved among organisms from yeast to humans (12, 27, 28). Maf1 of S. cerevisiae specifically inhibits Pol III transcription (25), whereas in human glioblastoma cells, Maf1 is a negative regulator of both Pol I-dependent and Pol III-dependent transcription (14). In yeast, Pol III is repressed in response to diverse stresses, such as nutrient deprivation, rapamycin treatment, secretory defects, or DNA damage, and all these signals are mediated by Maf1 (7, 19, 40). Maf1 is activated by protein phosphatase 2A, a component of the TOR pathway. In response to rapamycin, dephosphorylated Maf1 is transferred into the nucleus and acts as a Pol III transcriptional "brake" (25, 30). Independent studies have identified yeast Maf1 as an in vitro substrate of PKA kinase (3, 23). Maf1-mediated repression of Pol III transcription by rapamycin was decreased by unregulated, high PKA activity (23). It was postulated that PKA inhibited nuclear import of Maf1 following rapamycin stress (23, 43). This indicated that besides its function in TOR signaling, Maf1 also plays a role in transmitting signals via the RAS pathway. However, the mechanism of Pol III transcription repression is more complex; nuclear localization of dephosphorylated Maf1 is not sufficient, and an additional, so-far-unknown step is required for Maf1 activity in the nucleus (23).

Since Maf1 is the only Pol III repressor known in yeast, it was of interest to establish its role under physiological conditions that require transcription inhibition and that are not generally considered as a stress. Here we show that transcription regulation by Maf1 is important for some physiological changes between two types of carbon sources. The control of tRNA synthesis mediated by Maf1 becomes essential when yeast cells adapt to respiration. We show that Maf1 phosphorylation and intracellular distribution differ between cells growing in medium with glucose and cells growing in a nonfermentable carbon source but that these differences are PKA independent. Moreover, in cells grown in a nonfermentable carbon source, Maf1 regulates the levels of different tRNAs to various extents. The respiratory phenotype of the maf1-{Delta} mutant could be suppressed by several mutations in the Pol III apparatus, but apparently decreased transcription was not sufficient for this suppression. Presumably, in the absence of Maf1, a defective Pol III may undergo some unspecified rearrangement to become more transcriptionally active.


arrow
MATERIALS AND METHODS
 
Strains and plasmids. Yeast strains used in this study included maf1-{Delta}, a derivative of YPH500 (MAT{alpha} ade2-101 his3-{Delta}200 leu2-{Delta}1 lys2-801 trp1-{Delta}63 ura3-52), and the maf1-1 mutant strain MT6-7, isogenic to T8-1D (MAT{alpha} SUP11 mod5-1 ade2-1 ura3-1 lys2-1 leu2-3,112 his4-519) (25, 27). Dominant allele RAS2Val19 was constructed from YPH500 by introducing the YCp50/RAS2Val19 plasmid, kindly provided by J. Thevelein. Under our experimental conditions, over 76% of cells saved the YCp50/RAS2Val19 plasmid. The A364A strain (MATa ade1 ade2 lys2-1 his7 tyr1 gal1 ura1) and the isogenic cdc25-1 mutant were obtained from the ATCC collection of yeast strains (Berkeley, CA). rpc128-1007, the second-site suppressor of maf1-{Delta}, was isolated from the MJ9-2B (MAT{alpha} maf1-{Delta} SUP11 ade2-1 ura3-1 lys2-1 leu2-3,112 his3) strain background. A cross to the wild-type strain and subsequent meiosis resulted in MJ15-9C (MATa rpc128-1007 SUP11 ade2-1 ura3-1 lys2-1 leu2-3,112 his3).

Pol III mutants rpc31-236 (38), rpc25-S100P (45), rpc160-112 (8, 33), rpc160-750 (33), rpc11-Sp (4), and YMLF2 with regulated levels of the C17 subunit (11) were obtained from the Service de Biologie Intégrative et Génétique Moléculaire, CEA/Saclay (France). To delete MAF1, a kanamycin cassette surrounded on each side by ~250 bp of MAF1-flanking regions was synthesized by PCR, using specific primers and genomic DNA of YI3945 (maf1::kanX; Euroscarf). Each single mutant was transformed with the 2,079-bp DNA product, and transformants were selected on yeast extract-peptone-dextrose (YPD) medium supplemented with G418 sulfate (Geneticin). In each case, the replacement of MAF1 with the kanamycin cassette was confirmed by PCR.

Preparation of RNA and real-time PCR quantification. Cultures (10 ml) were grown in yeast extract-peptone-glycerol (YPGly) medium at 30°C to log phase (A600 of about 0.8) and then shifted to the restrictive temperature (37°C) for 2.5 h. The cells were harvested by centrifugation and resuspended in 50 mM Na acetate, pH 5.3, 10 mM EDTA. Total RNA was isolated by heating and freezing the cells in the presence of sodium dodecyl sulfate (SDS) and phenol as described previously (35). RNA was treated with DNase I (Fermentas). First-strand cDNA for each sample was synthesized by reverse transcription of total RNA, using RevertAid H minus Moloney murine leukemia virus reverse transcriptase (Fermentas) according to the manufacturer's instructions. Real-time PCR was performed using a LightCycler model 1.5 instrument (Roche Molecular Biochemicals) according to the manufacturer's instructions. Reaction mixtures (10 µl, final volume) were assembled with the following components: 4.8 µl H2O, 1.2 µl 4 mM MgCl2, 1 µl cDNA, 1 µl 0.5 µM of each primer, and 1 µl of 10x LightCycler FastStart DNA Master SYBR Green I (Roche Molecular Biochemicals). The 35S ribosomal DNA (rDNA), amplified with the primers TCGACCCTTTGGAAGAGATG and CTCCGGAATCGAACCCTTAT, served as the reference gene. Primers used to amplify tRNA genes (tDNA) were as follows: to amplify tDNAmet, GCTTCAGTAGCTCAGTAGGAA and TGCTCCAGGGGAGGTTC; to amplify tDNALeu, GGTTGTTTGGCCGAGCG and TGGTTGCTAAGAGATTCGAACTC; and to amplify tDNAGly, GGGCGGTTAGTGTAGTGGTT and TGAGCGGTACGAGAATCGAA. All sets of reactions were conducted in triplicate, and each set included a nontemplate control. The specificity of individual real-time PCR products was assessed by melting-curve analysis carried out immediately after PCR completion. The fit-point method, using LightCycler software version 4.05 (Roche Molecular Biochemicals), was applied for crossing-point determination. Relative tRNA expression levels were calculated using the Pfaffl model and the relative expression software tool (26).

Microarray hybridization. Total RNA (20 µg) supplemented with 200 pg or 20 pg of each control RNA (CAB, RCA, and RbCl from Stratagene) was preincubated for 10 min at 70°C with 1 µl of the primer mixture (2 pM for each specific primer) and 2 µg of poly(dT) oligonucleotide and completed to a final volume of 15.4 µl with RNase-free water. The specific primers were designed to hybridize to the 3' end of all mature tRNAs analyzed. After 5 min on ice, 14.6 µl of reverse transcription mixture was added with amino-allyl dUTP as previously described (10), and the reaction mixture was incubated for 2 h at 42°C. Then, RNA was digested by adding 1.6 U RNase A and 2 U RNase H over 30 min at 37°C. After inactivation of the enzymes for 15 min at 65°C, amino-allylic cDNAs were purified in water with a YM30 ultrafiltration device (Microcon-Amicon). Subsequent labeling with Cy3 and Cy5 dyes (Amersham) and purification were performed as already described (10).

Other methods. Northern analysis, protein extraction, and immunoblotting used in this study are described in the supplemental material.


arrow
RESULTS
 
Upregulation of yeast RNA Pol III activity results in a growth defect in a nonfermentable carbon source. Despite its role as a global regulator of Pol III transcription, Maf1 is not essential in yeast. Inactivation of the MAF1 gene (maf1-{Delta}) results in deregulated Pol III activity regardless of the environmental conditions (40). As previously reported, the absence of functional Maf1 in the maf1-{Delta} or maf1-1 mutant results in elevated tRNA levels under some growth circumstances (27). This observation raises the question of whether the mutant cells can tolerate such an excess of tRNA and other Pol III transcripts under unfavorable growth conditions. One could expect the detrimental effect of high tRNA levels under poor growth conditions. However, at a low temperature (16°C) or in the presence of glucosamine, which inhibits glucose metabolism, the cell growth rate of the maf1-{Delta} and maf1-1 mutants was indistinguishable from that of the respective wild-type isogenic controls (Fig. 1). In contrast, for cells grown in medium with a nonfermentable carbon source (YPGly medium, at 30°C), growth inhibition (compared to growth in medium with a fermentable source) was clearly stronger in cells lacking functional Maf1. This observation pointed to a defect in mitochondrial function, the most common cause of which is the degradation of mitochondrial DNA (mtDNA), resulting in the formation of petite colonies known as [rho]. It is known that inactivation of multiple nuclear genes in yeast leads to [rho] formation, often by an indirect mechanism. The frequency of [rho] formation, however, was unaffected in maf1 mutant cells (Table 1). The maf1-{Delta} as well as the maf1-1 cells stopped growing at 37°C on YPGly medium, while they grew on a fermentable carbon source, YPD medium. The growth deficiency of the maf1 mutants at 37°C was also observed for media with other nonfermentable carbon sources, like ethanol or lactate (data not shown). This phenotype was not due to the loss of mitochondrial DNA (typical for the [rho] mutants) because cell growth could be restored by transferring the plates from 37°C to 30°C (data not shown).


Figure 1
View larger version (61K):
[in this window]
[in a new window]

 
FIG. 1. Growth defect of maf1 mutants grown on media with a nonfermentable carbon source. Tenfold serial dilutions of cells were plated on YPD (rich glucose medium), YPGly (rich glycerol medium), or YPD medium supplemented with glucosamine hydrochloride (GlcN, 10 mg/ml) and incubated at the indicated temperatures. The control wild type (wt) for maf1-{Delta} is YPH500, whereas the control for maf1-1 is T8-1D.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Inactivation of Maf1 does not affect [rho] inductiona

We monitored the effect of growth inhibition in a nonfermentable carbon source on Pol III transcription activity. Total RNA was isolated from yeast grown in glucose or glycerol medium to exponential phase, followed with a shift to a nonpermissive temperature for 2.5 h. RNAs were resolved by electrophoresis in agarose gel and stained with ethidium bromide. To estimate the quantities of tRNA and rRNA, total RNA isolated from equal amounts of cells (0.125 optical density [OD] unit) was loaded onto each lane of the gel. In comparison to growth by fermentation in glucose, the glycerol-based respiratory growth resulted in a dramatic decrease in 28S and 18S rRNA levels, but this decrease was the same as that in the wild-type cells and the maf1-{Delta} mutant (Fig. 2A). Clearly, the rRNA levels were not affected in the maf1-{Delta} cells. In contrast, tRNA levels were decreased in the wild-type but not in the maf1-{Delta} cells grown in a nonfermentable carbon source. For a more precise quantification, RNAs isolated from equal amounts of cells (0.25 OD unit) from the maf1-{Delta} and the parental strains grown either in glucose or in glycerol medium with a shift to the nonpermissive temperature were resolved by urea-polyacrylamide gel electrophoresis (PAGE) and analyzed by Northern blotting with probes specific to individual tRNAs (Fig. 2B). In the control strain grown in glycerol, the tRNALeu level decreased by 33%, but the tRNAGly level did not change. Cells with inactive Maf1 grown in glycerol medium with a shift to 37°C had markedly higher levels of each tested tRNA, although this increase was different for individual tRNA species. Less pronounced differences in tRNA expression were observed for the maf1-{Delta} cultures grown in glycerol medium without a shift to the nonpermissive temperature (results not shown). The same cells grown in glucose exhibited only minor or no increase in tRNA levels compared to that of the wild type. As observed previously (27), the 5S rRNA level was not significantly affected by the absence of Maf1. U3 RNA, synthesized by Pol II, may serve as an internal control since its level was not changed in the maf1-{Delta} cells.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 2. Inactivation of MAF1 leads to tRNA accumulation that is increased when cells grow on nonfermentable carbon sources. Total RNA was isolated from the maf1-{Delta} and wild-type (wt) control strain (YPH500) cells grown in glucose medium (YPD) or glycerol medium (YPGly) after a shift to a nonpermissive temperature (2.5 h at 37°C). (A) RNA from cells at OD 0.125 were separated on 2.8% agarose gels and stained with ethidium bromide. (B) Northern analysis. RNA from 0.25 OD unit of cells were separated on 8 M urea-8% polyacrylamide gels, followed by hybridization using labeled oligonucleotide probes complementary to various tRNAs, 5S rRNA, and U3 snoRNA (described in the supplemental material). Bands were quantified as described in Materials and Methods. In order to determine relative levels, the amount of each RNA present in wt cells grown in YPD medium was set to 1.

Thus, we conclude that under respiratory conditions, the maf1-{Delta} mutant accumulates relatively high levels of tRNA which may be toxic to the cells at high temperatures, especially as the deregulation results in unbalanced levels of different Pol III transcripts.

Maf1 regulation is increased in a nonfermentable carbon source, but the effect varies among different tRNAs. To quantify the Maf1-directed repression, we used a Pol III-specific microarray (unpublished data) harboring all the different tRNA genes (one for each of the 52 different tRNA families described in the Saccharomyces Genome Database) as well as all the other genes transcribed by Pol III. Total RNA was isolated from yeast cells grown in glucose or glycerol medium to exponential phase, followed with a shift to the nonpermissive temperature for 2.5 h. Because of the small number of probes coming from the same functional family (i.e., Pol III transcripts), we assisted the normalization by using control probes (not shown) corresponding to three exogenous gene products, CAB, RCA, and RbCl, from Arabidopsis thaliana (spike RNA; Stratagene). Since the RNA yield per cell was different under glucose and glycerol growth conditions (Fig. 2A), all our data were normalized with the SNR7 gene (encoding U5 RNA transcribed by RNA Pol II) as the reference gene. The gene arrays in Fig. 3A (and Table S1 in the supplemental material) display normalized ratios for each gene according to the red-green color scale.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 3. Pol III genes are not equally regulated by Maf1. (A) Microarray hybridization. Expression ratios of Pol III-transcribed genes in the maf1-{Delta} mutant and the wild-type (wt) control strain (YPH500) grown in glucose medium (YPD) or glycerol medium (YPGly) with a shift to 37°C are shown. Results are presented according to the red-green color scale. Gray bar, not determined. (B) Comparison of expression of selected tDNA genes, tDNAMet (tM[CAU]J1), tDNAGly (tG[UCC]G), and tDNALeu (tL[CAA]A), in the maf1-{Delta} and the wild-type YPH500 cells, determined by real-time PCR. Expression levels were normalized to those of the control 35S rDNA. The relative expression ratios and standard deviations were calculated using the Relative Expression Software Tool.

Class III gene expression levels were mostly similar in the wild-type and the maf1-{Delta} strains grown in YPD medium (Fig. 3A, lane 1, average of the ratios of 0.92). Expression levels were consistent with previous data, indicating that Maf1 phosphorylation and cytoplasmic localization prevented Pol III repression during exponential growth in glucose (25, 30). As shown in Fig. 2 (compare the first two lanes), the temperature shift at 37°C did not induce Maf1-mediated repression of class III genes. In contrast, a change to respiratory growth conditions in the presence of Maf1 induced a decrease in class III gene expression (Fig. 3A, lane 2, average of the ratios of 0.78) that correlated well with that shown in Fig. 2 (compare lane 3 with lane 1). A similar change in the growth medium in the absence of Maf1 (Fig. 3A, lane 3, average of the ratios of 2.70) impaired the repression of class III gene expression, as also shown in Fig. 2 (compare lane 4 with lane 2). A direct comparison of the maf1-{Delta} and the wild-type cells grown in YPGly medium after a shift to the restrictive temperature (Fig. 3A, lane 4, average of the ratios of 4.06) showed that the levels of class III RNAs were substantially higher in the mutant cells.

As noted earlier (Fig. 2B), all tRNAs were not affected by mat1-{Delta} to the same extent (Fig. 3A, Table 2, and Table S1 in the supplemental material). For example, 14 of the 52 tRNA gene families were repressed by more than twofold in cells lacking Maf1 grown in YPD medium with a shift to 37°C (Fig. 3A, lane 1). This effect occurred irrespective of tRNA gene redundancy, but all genes that were repressed in the absence of Maf1 in YPD medium were repressed to similar levels in the presence of Maf1 in YPGly medium (Fig. 3A, compare lane 1 with lane 2). Furthermore, the ratio of tRNA gene levels varied from 1 to 5 upon transference to respiratory growth in cells lacking Maf1 (Fig. 3A, lane 3). This may be the result of differential tRNA stability under respiratory growth conditions or a potential additional Maf1-independent mechanism for regulating tRNA gene transcription by Pol III.


View this table:
[in this window]
[in a new window]

 
TABLE 2. Quantification of microarray hybridization for selected tRNA genesa

An especially high variation in tRNA levels was noted in a comparison of maf1-{Delta} cells and wild-type cells grown in YPGly medium after a shift to the restrictive temperature (Fig. 3A, lane 4). The particularly important initiator tRNACAUMet was affected to a minor extent (2.65- ± 1.23-fold increase in maf1-{Delta}), whereas the elongator tRNACAUMet level was affected more (7.78- ± 3.21-fold increase). The tRNA species most sensitive to Maf1 were two tRNAGAAPhe species, representing different gene families (with 11.16- ± 2.22-fold and 11.46- ± 2.62-fold increases), tRNAAGUThr (8.53- ± 2.15-fold increase), and tRNACCATrp (10.42- ± 4.12-fold increase). Other isoacceptor tRNAsThr levels were less affected. Interestingly, tRNACUULys, known to be imported to mitochondria (15), was sensitive to Maf1 when the cells were grown in glycerol medium (6.03- ± 2.44-fold increase in maf1-{Delta} cells). In contrast, other tRNAs reported as mitochondrially imported, tRNAUUGGln and tRNACUGGln (29), were not affected (Table 2).

Using real-time PCR (Fig. 3B), we confirmed and quantified the effects of maf1-{Delta} on the expression of selected tRNA gene species. RNA was isolated from maf1-{Delta} mutant cells and control wild-type cells grown in glycerol medium with a shift to 37°C. cDNAs synthesized by reverse transcription were used as templates for amplification of tDNAMet (tM[CAU]J1), tDNAGly (tG[UCC]G), and tDNALeu (tL[CAA]A). The 35S rDNA gene served as a reference gene, based on the assumption that maf1-{Delta} does not affect rRNA synthesis. The steady-state levels of tDNAMet, tDNALeu, and tDNAGly were found to be increased, respectively, 6.44 (±1.47)-fold, 3.79 (±0.20)-fold, and 2.70 (±0.69)-fold in the maf1-{Delta} cells with respect to those of the control strain (values were consistent with microarray data shown in Table 2). Thus, the real-time PCR analysis confirmed our observation that individual Pol III genes are repressed by Maf1 to various extents.

Maf1 phosphorylation and intracellular distribution in cells grown in glucose medium differ from those in cells grown in a nonfermentable carbon source. A recurring physiological transition in growing yeast cultures involves a progressive shift from fermentation to respiration. We mimicked this metabolic change by transferring yeast cells from a glucose to a glycerol liquid medium. Wild-type cells in the exponential growth phase in a glucose culture were rapidly pelleted, washed, and suspended in prewarmed medium containing glycerol as the sole carbon source and incubated at 30°C with shaking. According to previous results (25), a slowly migrating phosphorylated form of Maf1 was observed in cells collected in the exponential phase from glucose medium. Transfer of the cells to a glycerol-containing medium caused a rapid dephosphorylation of Maf1 (Fig. 4A). Only the fast-migrating dephosphorylated form of Maf1 was observed after 10 min. Maf1 appears to be a substrate of the cAMP-dependent kinase PKA, and it has been shown recently that increased levels of PKA activity diminish the dephosphorylation of Maf1 under particular stress conditions (23). Thus, one might predict that an increased PKA activity would limit Maf1 dephosphorylation following the transition to a glycerol medium. PKA is under the control of the Ras1 and Ras2 proteins, which stimulate adenylate cyclase to produce cAMP (2). Constitutive activation of PKA can be achieved by the dominant allele RAS2Val19 expressed from a plasmid. Expression of the RAS2Val19 allele, however, did not counteract Maf1 dephosphorylation when cells grew in a glycerol medium (Fig. 4A). Similarly, no effect on Maf1 dephosphorylation following the transfer from a glucose- to a glycerol-containing medium was observed in the cdc25-1 mutant, with a decreased adenylate cyclase activity (Fig. 4A) (32).


Figure 4
View larger version (70K):
[in this window]
[in a new window]

 
FIG. 4. Dephosphorylation and nuclear localization of Maf1 under respiratory conditions. (A) The wild-type strain YPH500 and the RAS2Val19 and cdc25-1 mutants were grown to exponential phase in rich glucose medium (YPD), then transferred to prewarmed rich glycerol medium (YPGly), and further incubated at 30°C. Crude extracts from trichloroacetic acid-precipitated cells were analyzed by SDS-PAGE with a modified acrylamide-bisacrylamide ratio, followed by immunoblotting using polyclonal anti-Maf1 antibodies. The slower-migrating diffuse band corresponds to phosphorylated forms of Maf1. The phosphorylation pattern of Maf1 in the cdc25-1 mutant was identical to that observed for the isogenic A364A control strain (not shown). (B) Maf1 localization was analyzed by immunofluorescence microscopy using polyclonal anti-Maf1 antibodies. Cells were grown in glucose medium (YPD) to exponential phase, then transferred to glycerol medium (YPGly), and incubated for 2 h. Nuclei were stained with DAPI.

Subsequently, we investigated whether the intracellular distribution of Maf1 was affected by a shift to respiratory metabolism. Maf1-specific antibodies were used to localize Maf1 in yeast cells by immunofluorescence. As previously reported (25), under favorable growth conditions in glucose, the fluorescence signal was uniformly distributed throughout the cells. Remarkably, in cells grown under respiratory conditions, the Maf1 signal was concentrated in the nuclear compartment and overlapped with the 4',6'-diamidino-2-phenylindole (DAPI)-stained areas of the wild-type as well as the RAS2Val19 and cdc25-1 mutant cells (Fig. 4B). Therefore, nonfermentative metabolism stimulates Maf1 activity by dephosphorylation and subsequent relocation of Maf1 into the nucleus.

To further investigate the effect of carbon metabolism on Maf1 regulation, in a reciprocal experiment, cells grown in glycerol were transferred to a glucose medium. Such a transition from respiration to fermentation metabolism resulted in Maf1 phosphorylation. Compared to the rapid dephosphorylation process, which was completed in less than 10 min (Fig. 4A), the phosphorylation was relatively slow and took nearly 2 h (Fig. 5A). Similar Maf1 phosphorylation upon transition from a nonfermentable carbon source to a glucose source was also observed in both mutants with altered PKA activity (Fig. 5B).


Figure 5
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 5. Maf1 phosphorylation after cells were transferred from respiratory conditions to glucose. Crude extracts from trichloroacetic acid-precipitated cells cultivated in glycerol medium (YPGly) and transferred to glucose medium (YPD) were analyzed by SDS-PAGE with a modified acrylamide-bisacrylamide ratio, followed by immunoblotting using polyclonal anti-Maf1 antibodies. The slower-migrating diffuse band corresponds to phosphorylated forms of Maf1. (A) Kinetics of Maf1 phosphorylation in wild-type cells (YPH500) harvested at the indicated time after transfer to YPD medium. (B) Maf1 phosphorylation in mutants with altered PKA activity. Wild-type (A364A), RAS2Val19, and cdc25-1 cells were grown in YPGly medium and harvested 2 h after transfer to YPD medium.

In parallel with its slow phosphorylation, Maf1 also gradually relocated out of the nucleus. At 1 h after cells were transferred to glucose medium, almost all cells had Maf1 in the nucleus. After the second hour, the Maf1 signal became distributed uniformly throughout the cell. The kinetics of Maf1 relocation to the cytoplasm was much slower than its nuclear importation in response to rapamycin (25). The rate of phosphorylation and relocation of Maf1 to the cytoplasm in the RAS2Val19 mutant cells upon transfer from a nonfermentable carbon source to a glucose source was similar to that in the wild type (data not shown).

Next, we assessed if mutants with altered PKA activity affected the decrease in Pol III transcription upon the transition from fermentation to respiratory conditions. The RAS2Val19 and cdc25-1 mutants and the isogenic wild-type control cells were grown in glucose medium to exponential phase, transferred to prewarmed glycerol medium, grown for 2 h at the permissive temperature, and used for the isolation of RNA, which was then analyzed by Northern blotting. An intron probe was used to determine the synthesis of the tRNALeu precursor (Fig. 6). The transition to respiratory conditions caused a threefold decrease in pre-tRNALeu synthesis in wild-type cells (Fig. 6, compare lanes 3 and 7 with lanes 1 and 5) but a 10-fold decrease in the cdc25-1 mutant cells (Fig. 6, compare lanes 8 and 6). In contrast, there was no decrease of tRNALeu precursor in the RAS2Val19 mutant with enhanced PKA activity when cells were transferred to glycerol (Fig. 6, compare lanes 4 and 2). Clearly, PKA affects Pol III regulation coupled to a transfer from fermentation to respiration. However, the molecular mechanism probably involves a PKA target protein other than Maf1, since the changes in Maf1 phosphorylation and intracellular distribution in response to a carbon source are independent of the levels of PKA activity.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

 
FIG. 6. PKA is involved in Pol III regulation, coupled to carbon metabolism. Total RNA isolated from the RAS2Val19 and cdc25-1 mutants and isogenic wild-type control cells (YPH500 and A364A, respectively), grown in glucose medium to late exponential phase (YPD medium) or transferred to glycerol medium and grown for 2 h at the permissive temperature (YPGly medium), was hybridized with intron-specific tRNALeu and U3 snoRNA probes. Bands were quantified as described in Materials and Methods. In order to determine relative levels, the amount of tRNALeu present in wild-type (wt) cells grown in YPD medium was set to 1. Lanes are numbered to facilitate explanation in the text.

Genetic interaction of Maf1 with Pol III subunits. As an inhibitor of Pol III transcription, the yeast Maf1 performs a significant role in nonfermentative metabolism. The increased transcription in the maf1 mutants caused a toxic effect under physiological conditions of respiration. According to our previous data, this toxicity can be overcome by a second site mutation in the gene encoding the largest Pol III subunit, C160 (1, 27). This mutation decreased the level of tRNA, enabling genetic suppression of the maf1 phenotype (27). In order to find mutants in other Pol III subunits that overcome the maf1-{Delta} phenotype, we further applied a genetic screen for second-site suppressors that bypass the growth defect in a nonfermentable carbon source. One of the spontaneous suppressors (Fig. 7A) was recessive, not allelic, to rpc160 mutants and gave a cold-sensitive phenotype. When a yeast wild-type centromeric library was introduced into the suppressor strain, a genomic fragment was selected which complemented the cold-sensitive phenotype and was genetically linked to the suppressor locus. Subcloning revealed the RPC128 gene encoding the second largest Pol III subunit. The mutant allele, called rpc128-1007, was isolated from the suppressor strain. It had a single nucleotide change resulting in a substitution of the conserved Gly with Ala, localized close to the nucleotide binding motif in the C terminus of C128 (Fig. 7B) (36). The rpc128-1007 mutant had 1.6-fold-reduced tRNA levels compared to that of 18S rRNA (Fig. 7C). This led to the conclusion that the toxic effect of maf1-{Delta} in a nonfermentable carbon source, resulting from enhanced tRNA levels, could be overcome by decreasing transcription by altering C160 or other Pol III components.


Figure 7
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 7. The mutation in the conserved region of the C128 Pol III subunit is a second-site suppressor of maf1-{Delta}. (A) Growth phenotype. MJ9-2B maf1-{Delta} and MJ9-2B maf1-{Delta} rpc128-1007 cells were grown on YPD medium overnight, replica plated on YPGly medium, and incubated for 3 days at 37°C. (B) Localization of the rpc128-1007 mutation close to the nucleotide binding motif G995X4GK1001. The sequence surrounding the mutation is conserved in the C128 and B150 subunits, the second largest subunits of yeast Pol III and Pol II, respectively, as well as in their prokaryotic homologues, ß subunits from Escherichia coli and Bacillus subtilis. (C) Decreased tRNA level in the rpc128-1007 mutant. Total RNA was isolated from the MJ15-9C rpc128-1007 strain and the control wild-type strain grown in glucose medium after a shift to the nonpermissive temperature (2.5 h at 16°C) and analyzed on 2.4% agarose gel stained with ethidium bromide.

To better understand the biological meaning of maf1 suppression, we decreased Pol III transcription by partial inactivation of the C17 Pol III subunit. We were able to change the C17 level by modulating the expression of the RPC17 gene cloned under the regulated tetO promoter. The addition of doxycycline to the growth medium resulted in a decreased level of C17 protein and a lower basal Pol III activity, whereas in the absence of the antibiotic, Pol III was not affected (11). To create a strain with nonfunctional Maf1 and to monitor Pol III activity, we deleted MAF1 in the strain expressing RPC17 from the tetO promoter. The maf1-{Delta} glycerol-negative phenotype was observed when C17 expression was high. The growth defect of maf1-{Delta} was compensated for in the presence of doxycycline when C17 expression and Pol III activity levels were low (Fig. 8). The suppression of the maf1-{Delta} phenotype appeared as a consequence of the restored lower level of tRNA.


Figure 8
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 8. Suppression of the maf1-{Delta} phenotype on a nonfermentable carbon source upon decreased expression of the C17 Pol III subunit. Growth on glycerol medium was compared for the wild-type (wt) control strain YPH500 and the strain YMLF2 with regulated levels of C17 Pol III subunit (pCMc17) carrying the active MAF1 chromosomal gene or the maf1-{Delta} deletion. Cells were grown on YPD medium overnight, replica plated on YPGly medium, and incubated for 3 days at 37°C. YPGly medium plates were supplemented with doxycycline, as indicated.

However, this conclusion raised another question: would any Pol III defect that lowers tRNA levels allow a bypass of maf1-{Delta} toxicity under respiratory conditions? To answer it, we deleted MAF1 in several Pol III mutants in which the mutations were known to affect the enzyme activity in various ways (Table 3). To test the suppression, these maf1-{Delta} derivatives of Pol III mutants were tested for growth on a nonfermentable carbon source (YPGly medium, at 37°C). Two termination mutants, rpc160-750 and rpc11-Sp (4, 18, 33), and one initiation mutant, rpc31-236 (38), were able to compensate for the toxic defect of the maf1-{Delta} mutant. Other mutants, rpc25-S100P, affecting initiation (45), and rpc160-112, affecting elongation (8, 33), did not suppress the maf1-{Delta} phenotype (Table 3). The decrease of tRNA levels in individual mutants was quantified by analyzing RNA extracted from cells grown in YPD medium at 30°C, which were then shifted to 37°C for 2.5 h (Table 3). Interestingly, the suppression seems to be correlated not with an overall decrease (n-fold change) in tRNA levels but rather with specific defects in Pol III mutants. Moreover, no significant differences in tRNA levels were measured in mutants versus those in wild-type cells grown in glycerol medium with a shift to 37°C (ratio between 1.1 and 1.4; data not shown). Thus, mutations in genes encoding Pol III subunits that were ultimately rate limiting for transcription in cells grown in glucose media appeared to be not limiting for transcription under respiratory growth conditions at a high temperature.


View this table:
[in this window]
[in a new window]

 
TABLE 3. Suppression of the maf1-{Delta} phenotype by various Pol III mutationsa


arrow
DISCUSSION
 
Investigation of the impact of Maf1 on yeast physiology indicates that Maf1 performs a significant inhibitory role in normally growing cells. This new function of Maf1 couples Pol III transcription with metabolic processes and/or energy production that is dependent on the carbon source. It is now obvious that not only the Pol II transcriptome but also the Pol III genes are regulated during the transition from fermentative to glycerol-based respiratory growth and that Maf1 is essential for this regulation. Previous work indicates that dephosphorylation is the way by which nuclear importation and Maf1 activity are regulated in response to rapamycin. Here we show that Maf1 is phosphorylated and localized in a manner that is dependent on the carbon source, which determines yeast metabolism. Glucose depletion and transfer to a nonfermentable carbon source result in Maf1 dephosphorylation and importation into the nucleus. An opposite transition, from a nonfermentable carbon source to a glucose medium, is followed by Maf1 phosphorylation and relocation from the nucleus to the cytoplasm. It is not clear if the phosphorylation occurs before or after Maf1 export to the cytoplasm. Our kinetics studies suggest that relocalization to the cytoplasm is coincident with Maf1 phosphorylation. The mechanism of Maf1 nuclear exportation remains to be determined.

Maf1 of S. cerevisiae is a serine-rich protein (15.7% of serines) and, according to a Swiss-Prot PROSITE search, contains 30 potential phosphorylation sites. The kinase involved in Maf1 phosphorylation following a transfer to glucose is currently unknown. The cAMP-dependent PKA kinase was a potential candidate since Maf1 had already been experimentally confirmed as its substrate in vitro (3, 23). We therefore tested strains carrying the mutations RAS2Val19 and cdc25-1, each of which affected the synthesis of cAMP differently. We found that neither mutation altered the pattern of Maf1 phosphorylation following transfer to a different carbon source. No effect of cdc25-1 on the kinetics of Maf1 phosphorylation upon transfer to glucose medium was observed (data not shown). Moreover, the high PKA activity in the RAS2Val19 mutant did not limit the dephosphorylation and nuclear relocation of Maf1 in response to glucose depletion. In conclusion, we suggest that another, so-far-unknown kinase participates in the regulation of Maf1 activity toward the coupling of Pol III transcription with carbon metabolism.

Having established that an altered level of PKA activity did not affect Maf1 phosphorylation or localization upon transition from glucose to a nonfermentable carbon source, we also expected no effect on the regulation of Pol III activity during such a transition. However, a direct study of pre-tRNA synthesis in the PKA mutants resulted in an opposite conclusion. The high PKA activity in the RAS2Val19 cells grown in glucose medium and transferred to respiratory conditions prevented a decrease in Pol III transcription. Consistently, in the cdc25-1 mutant with a low PKA activity, Pol III activity was more repressed than in the corresponding wild type. A similar effect of altered PKA activity in mutants was previously observed by Moir et al. (23) on the repression of Pol III transcription upon rapamycin stress, but the authors reported an accompanying change in the pattern of Maf1 phosphorylation. Here, we clearly show that the same mutants which do not affect the phosphorylation and cellular localization of Maf1 do affect, under the same conditions, the regulation of Pol III activity. As suggested previously (23), there is another protein involved in Pol III transcription regulation. According to our hypothesis, this unknown protein might be directly regulated by PKA.

Our current results show that not all Pol III genes are regulated by Maf1 to the same extent when cells are grown in a nonfermentable carbon source. This conclusion is confirmed by quantification of a Pol III-specific microarray and by quantitative reverse transcription-PCR with selected tRNA genes. The mechanism and physiological basis of the variable Maf1 regulation of individual tRNAs remain unclear. Assuming a direct influence of Maf1 on the transcription rate, the variable effect of Maf1 on different tRNA genes could be dependent on the potential transcription efficiency of a given tRNA gene. tRNA genes with internal Pol III promoters are homologous, but the flanking sequences are different. This might be the reason for different occupancy of TFIIIB and Pol III (13). It has also been shown that the RSC chromatin remodeling complex is specific to Pol III genes, but not all tRNA genes bind RSC (24). The relative efficiency of transcription of individual tRNA genes is probably not the same, although this problem has not yet been solved. Therefore, we were not able to establish the relationship between the effect of Maf1 and the transcription efficiency of a particular tRNA gene.

The extent of Maf1 regulation does not correlate with the gene copy number for a given tRNA (see Table S1 in the supplemental material). The expression of single-copy tRNA genes is usually not much affected in maf1-{Delta} cells. However, the levels of tRNAVal (tV[AAC]E1, 13 copies) or tRNAAsn (tN[GUU]C, 10 copies) were also affected to a minor extent, whereas those of tRNAPhe (tF[GAA]N, 2 copies) and tRNAArg (tR[ACG]J, 1 copy) were significantly increased in maf1-{Delta} cells grown under respiratory conditions. We also found no correlation between the extent of Maf1 regulation and codon usage corresponding to a given tRNA.

Unbalanced tRNA levels seem a likely reason for the maf1-{Delta} growth defect in glycerol medium. In contrast to some other tRNAs, initiator tRNAMet was not significantly affected by Maf1 since its expression ratio in a nonfermentable carbon source was 2.65 ± 1.23. It is known that depletion of initiator tRNAMet triggers reprogramming of genome expression in several Pol III mutants (5). Assuming that the relatively low level of initiator tRNAMet could be the reason for growth inhibition, its expression was increased by introducing a multicopy plasmid with the IMT1 gene into the cells. However, no effect of the increased dose of initiator tRNAMet on the maf1-{Delta} phenotype was observed (data not shown). In S. cerevisiae, two Pol III-synthesized tRNAs have been reported as mitochondrially targeted, namely tRNALys and tRNAGln (15, 29). The mitochondrial functions of these tRNAs are not fully clear, although there is indirect evidence for their role in mitochondrial translation. Our data show that tRNALys is 6.03- ± 2.44-fold increased in maf1-{Delta}, whereas tRNAGln is not affected. Assuming that the imported tRNAs function in mitochondria in a concerted fashion, their unbalanced levels could be disadvantageous for mitochondrial translation. However, no increased [rho] accumulation, typical for yeast mutants with mitochondrial translation defects, was observed in maf1-{Delta} strains.

Although nuclear Maf1 is known to function as a Pol III transcription repressor, the role of Maf1 in the cytoplasm remains unknown. One possibility, involving the mitochondrial scenario, is a function of cytoplasmic Maf1 in posttranscriptional tRNA control. At least two of the four subunits of the yeast tRNA endonuclease, Sen2 and Sen54, are located on the outer mitochondrial membrane, and this location is important for functional tRNA splicing (44). Although no mitochondrial phenotype of mutants affecting tRNA splicing has been found, one could assume that cytoplasmic Maf1 could somehow be involved. Interestingly, we identified the Sen54-encoding gene in a screen for putative activators of tRNA biosynthesis (M. Ciesla, unpublished). Nonetheless, inactivation of MAF1 is not the first example of a mutation that alters tRNA biogenesis and the ability of yeast cells to grow in respiratory substrates. A partial deletion of the N-terminal domain of {tau}55, a TFIIIC subunit required for tRNA transcription, impairs its function and also cell growth at an elevated temperature in nonfermentable carbon sources (20).

The lethality of the maf1-{Delta} cells under restrictive conditions is caused by increased or unbalanced levels of some Pol III products because it can be overcome by decreased transcription in Pol III mutants. The maf1-{Delta} growth defect could be suppressed by selected mutations affecting Pol III transcription initiation or termination. Suppression of the temperature-sensitive phenotype of maf1-{Delta} in Pol III mutants may reflect simple compensation of the amount of active transcription complexes. Since not all Pol III mutants with similar decreases (n-fold) in tRNA levels suppressed maf1-{Delta}, we propose that only some mutations allow formation of functional Pol III complexes in the absence of Maf1. Interestingly, we found a reciprocal genetic interaction of Maf1 with the C31 Pol III subunit. Truncation of the C31 subunit in the rpc31-236 mutant caused a temperature-sensitive phenotype (38). rpc31-236 counteracted the maf1-{Delta} defect in a nonfermentable carbon source. Interestingly, maf1-{Delta} rpc31-236 was no longer thermosensitive, indicating that in the absence of a negative regulator, the C31 truncation was not detrimental to Pol III transcription activity at an elevated temperature. C31 is part of a subcomplex of three Pol III-specific subunits (C31, C34, and C82) that is thought to interact with TFIIIB (41). The genetic interaction of Maf1 and C31 supports the model in which Maf1 affects the recruitment of Pol III by hampering its interaction with TFIIIB. Moreover, the gene encoding the Ded1 helicase was previously found to be a suppressor of rpc31-236 (38). Ded1 is another putative link since it was immunopurified with Maf1 (25). These preliminary genetic data encourage us to study the mechanism of action of Maf1 on the Pol III transcription apparatus.


arrow
ACKNOWLEDGMENTS
 
We thank André Sentenac for stimulating discussions and critical reading of the manuscript. We also thank Pierre Thuriaux for discussion of genetic results and for providing the yeast Pol III mutants; Giorgio Dieci for providing the IMT1 plasmid; Johan Thevelein for providing the YCp50-RAS2Val19 plasmid; and Xavier Gidrol, Franck Amiot, and Amélie Robert for providing DNA chips (SGF, CEA/Evry). We thank anonymous reviewers for helpful comments.

This work was supported by a FEBS fellowship to J. Towpik and by grants from the Association pour la Recherche contre le Cancer (ARC grant number 3982) and from the Ministry of Education and Science, Poland (grant N301 023 32/1117).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw, Poland. Phone: 4822 592 1312. Fax: 4822 658 4636. E-mail: magda{at}ibb.waw.pl Back

{triangledown} Published ahead of print on 4 September 2007. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back

{ddagger} Present address: Unit of Epigenetic Regulation, Avenir INSERM-FRE2850 CNRS, Fernbach Bldg., Institut Pasteur, 25 rue du Dr-Roux, 75724 Paris CEDEX 15, France. Back

§ Present address: Department of Neurobiology, Scripps Research Institute, 10550 North Torrey Pines Road, San Diego, CA 92037. Back


arrow
REFERENCES
 
    1
  1. Boguta, M., K. Czerska, and T. Zoladek. 1997. Mutation in a new gene MAF1 affects tRNA suppressor efficiency in Saccharomyces cerevisiae. Gene 185: 291-296.[CrossRef][Medline]
  2. 2
  3. Broach, J. R. 1991. RAS genes in Saccharomyces cerevisiae: signal transduction in search of a pathway. Trends Genet. 7: 28-33.[CrossRef][Medline]
  4. 3
  5. Budovskaya, Y. V., J. S. Stephan, S. J. Deminoff, and P. K. Herman. 2005. An evolutionary proteomics approach identifies substrates of the cAMP-dependent protein kinase. Proc. Natl. Acad. Sci. USA 102: 13933-13938.[Abstract/Free Full Text]
  6. 4
  7. Chedin, S., M. Riva, P. Schultz, A. Sentenac, and C. Carles. 1998. The RNA cleavage activity of RNA polymerase III is mediated by an essential TFIIS-like subunit and is important for transcription termination. Genes Dev. 12: 3857-3871.[Abstract/Free Full Text]
  8. 5
  9. Conesa, C., R. Ruotolo, P. Soularue, T. A. Simms, D. Donze, A. Sentenac, and G. Dieci. 2005. Modulation of yeast genome expression in response to defective RNA polymerase III-dependent transcription. Mol. Cell. Biol. 25: 8631-8642.[Abstract/Free Full Text]
  10. 6
  11. DeRisi, J. L., V. R. Iyer, and P. O. Brown. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278: 680-686.[Abstract/Free Full Text]
  12. 7
  13. Desai, N., J. Lee, R. Upadhya, Y. Chu, R. D. Moir, and I. M. Willis. 2005. Two steps in Maf1-dependent repression of transcription by RNA polymerase III. J. Biol. Chem. 280: 6455-6462.[Abstract/Free Full Text]
  14. 8
  15. Dieci, G., S. Hermann-Le Denmat, E. Lukhtanov, P. Thuriaux, M. Werner, and A. Sentenac. 1995. A universally conserved region of the largest subunit participates in the active site of RNA polymerase III. EMBO J. 14: 3766-3776.[Medline]
  16. 9
  17. Duvel, K., and J. R. Broach. 2004. The role of phosphatases in TOR signaling in yeast. Curr. Top. Microbiol. Immunol. 279: 19-38.[Medline]
  18. 10
  19. Fauchon, M., G. Lagniel, J. C. Aude, L. Lombardia, P. Soularue, C. Petat, G. Marguerie, A. Sentenac, M. Werner, and J. Labarre. 2002. Sulfur sparing in the yeast proteome in response to sulfur demand. Mol. Cell 9: 713-723.[CrossRef][Medline]
  20. 11
  21. Ferri, M. L., G. Peyroche, M. Siaut, O. Lefebvre, C. Carles, C. Conesa, and A. Sentenac. 2000. A novel subunit of yeast RNA polymerase III interacts with the TFIIB-related domain of TFIIIB70. Mol. Cell. Biol. 20: 488-495.[Abstract/Free Full Text]
  22. 12
  23. Geiduschek, E. P., and G. A. Kassavetis. 2006. Transcription: adjusting to adversity by regulating RNA polymerase. Curr. Biol. 16: R849-R851.[CrossRef][Medline]
  24. 13
  25. Giuliodori, S., R. Percudani, P. Braglia, R. Ferrari, E. Guffanti, S. Ottonello, and G. Dieci. 2003. A composite upstream sequence motif potentiates tRNA gene transcription in yeast. J. Mol. Biol. 333: 1-20.[CrossRef][Medline]
  26. 14
  27. Johnson, S. S., C. Zhang, J. Fromm, I. M. Willis, and D. L. Johnson. 2007. Mammalian Maf1 is a negative regulator of transcription by all three nuclear RNA polymerases. Mol. Cell. 26: 367-379.[CrossRef][Medline]
  28. 15
  29. Kolesnikova, O. A., N. S. Entelis, H. Mireau, T. D. Fox, R. P. Martin, and I. A. Tarassov. 2000. Suppression of mutations in mitochondrial DNA by tRNAs imported from the cytoplasm. Science 289: 1931-1933.[Abstract/Free Full Text]
  30. 16
  31. Kuhn, K. M., J. L. DeRisi, P. O. Brown, and P. Sarnow. 2001. Global and specific translational regulation in the genomic response of Saccharomyces cerevisiae to a rapid transfer from a fermentable to a nonfermentable carbon source. Mol. Cell. Biol. 21: 916-927.[Abstract/Free Full Text]
  32. 17
  33. Laferte, A., E. Favry, A. Sentenac, M. Riva, C. Carles, and S. Chedin. 2006. The transcriptional activity of RNA polymerase I is a key determinant for the level of all ribosome components. Genes Dev. 20: 2030-2040.[Abstract/Free Full Text]
  34. 18
  35. Landrieux, E., N. Alic, C. Ducrot, J. Acker, M. Riva, and C. Carles. 2006. A subcomplex of RNA polymerase III subunits involved in transcription termination and reinitiation. EMBO J. 25: 118-128.[CrossRef][Medline]
  36. 19
  37. Li, Y., R. D. Moir, I. K. Sethy-Coraci, J. R. Warner, and I. M. Willis. 2000. Repression of ribosome and tRNA synthesis in secretion-defective cells is signaled by a novel branch of the cell integrity pathway. Mol. Cell. Biol. 20: 3843-3851.[Abstract/Free Full Text]
  38. 20
  39. Manaud, N., R. Arrebola, B. Buffin-Meyer, O. Lefebvre, H. Voss, M. Riva, C. Conesa, and A. Sentenac. 1998. A chimeric subunit of yeast transcription factor IIIC forms a subcomplex with {tau}95. Mol. Cell. Biol. 18: 3191-3200.[Abstract/Free Full Text]
  40. 21
  41. Martin, D. E., A. Soulard, and M. N. Hall. 2004. TOR regulates ribosomal protein gene expression via PKA and the Forkhead transcription factor FHL1. Cell 119: 969-979.[CrossRef][Medline]
  42. 22
  43. Martin, D. E., T. Powers, and M. N. Hall. 2006. Regulation of ribosome biogenesis: where is TOR? Cell Metab. 4: 259-260.[CrossRef][Medline]
  44. 23
  45. Moir, R. D., J. Lee, R. A. Haeusler, N. Desai, D. R. Engelke, and I. M. Willis. 2006. Protein kinase A regulates RNA polymerase III transcription through the nuclear localization of Maf1. Proc. Natl. Acad. Sci. USA 103: 15044-15049.[Abstract/Free Full Text]
  46. 24
  47. Ng, H. H., F. Robert, R. A. Young, and K. Struhl. 2002. Genome-wide location and regulated recruitment of the RSC nucleosome-remodeling complex. Genes Dev. 16: 806-819.[Abstract/Free Full Text]
  48. 25
  49. Oficjalska-Pham, D., O. Harismendy, W. J. Smagowicz, D. P. Gonzalez, M. Boguta, A. Sentenac, and O. Lefebvre. 2006. General repression of RNA polymerase III transcription is triggered by protein phosphatase type 2A-mediated dephosphorylation of Maf1. Mol. Cell 22: 623-632.[CrossRef][Medline]
  50. 26
  51. Pfaffl, M. W., G. W. Horgan, and L. Dempfle. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30: e36.[Abstract/Free Full Text]
  52. 27
  53. Pluta, K., O. Lefebvre, N. C. Martin, W. J. Smagowicz, D. R. Stanford, S. R. Ellis, A. K. Hopper, A. Sentenac, and M. Boguta. 2001. Maf1p, a negative effector of RNA polymerase III in Saccharomyces cerevisiae. Mol. Cell. Biol. 21: 5031-5040.[Abstract/Free Full Text]
  54. 28
  55. Reina, J. H., T. N. Azzouz, and N. Hernandez. 2006. Maf1, a new player in the regulation of human RNA polymerase III transcription. PLoS ONE 1: e134.[CrossRef]
  56. 29
  57. Rinehart, J., B. Krett, M. A. Rubio, J. D. Alfonzo, and D. Soll. 2005. Saccharomyces cerevisiae imports the cytosolic pathway for Gln-tRNA synthesis into the mitochondrion. Genes Dev. 19: 583-592.[Abstract/Free Full Text]
  58. 30
  59. Roberts, D. N., B. Wilson, J. T. Huff, A. J. Stewart, and B. R. Cairns. 2006. Dephosphorylation and genome-wide association of Maf1 with pol III-transcribed genes during repression. Mol. Cell 22: 633-644.[CrossRef][Medline]
  60. 31
  61. Roberts, G. G., and A. P. Hudson. 2006. Transcriptome profiling of Saccharomyces cerevisiae during a transition from fermentative to glycerol-based respiratory growth reveals extensive metabolic and structural remodeling. Mol. Genet. Genomics 276: 170-186.[CrossRef][Medline]
  62. 32
  63. Robinson, L. C., J. B. Gibbs, M. S. Marshall, I. S. Sigal, and K. Tatchell. 1987. CDC25: a component of the RAS-adenylate cyclase pathway in Saccharomyces cerevisiae. Science 235: 1218-1221.[Abstract/Free Full Text]
  64. 33
  65. Rozenfeld, S., and P. Thuriaux. 2001. A genetic look at the active site of RNA polymerase III. EMBO Rep. 2: 598-603.[CrossRef][Medline]
  66. 34
  67. Rudra, D., Y. Zhao, and J. R. Warner. 2005. Central role of Ifh1p-Fhl1p interaction in the synthesis of yeast ribosomal proteins. EMBO J. 24: 533-542.[CrossRef][Medline]
  68. 35
  69. Schmitt, M. E., T. A. Brown, and B. L. Trumpower. 1990. A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18: 3091-3092.[Free Full Text]
  70. 36
  71. Shaaban, S. A., B. M. Krupp, and B. D. Hall. 1995. Termination-altering mutations in the second-largest subunit of yeast RNA polymerase III. Mol. Cell. Biol. 15: 1467-1478.[Abstract/Free Full Text]
  72. 37
  73. Thevelein, J. M., and J. H. de Winde. 1999. Novel sensing mechanisms and targets for the cAMP-protein kinase A pathway in the yeast Saccharomyces cerevisiae. Mol. Microbiol. 33: 904-918.[CrossRef][Medline]
  74. 38
  75. Thuillier, V., S. Stettler, A. Sentenac, P. Thuriaux, and M. Werner. 1995. A mutation in the C31 subunit of Saccharomyces cerevisiae RNA polymerase III affects transcription initiation. EMBO J. 14: 351-359.[Medline]
  76. 39
  77. Tsang, C. K., and X. F. Zheng. 2007. TOR-in(g) the nucleus. Cell Cycle 6: 25-29.[Medline]
  78. 40
  79. Upadhya, R., J. Lee, and I. M. Willis. 2002. Maf1 is an essential mediator of diverse signals that repress RNA polymerase III transcription. Mol. Cell 10: 1489-1494.[CrossRef][Medline]
  80. 41
  81. Werner, M., N. Chaussivert, I. M. Willis, and A. Sentenac. 1993. Interaction between a complex of RNA polymerase III subunits and the 70-kDa component of transcription factor IIIB. J. Biol. Chem. 268: 20721-20724.[Abstract/Free Full Text]
  82. 42
  83. Willis, I. M., N. Desai, and R. Upadhya. 2004. Signaling repression of transcription by RNA polymerase III in yeast. Prog. Nucleic Acid Res. Mol. Biol. 77: 323-353.[Medline]
  84. 43
  85. Willis, I. M., and R. D. Moir. 2007. Integration of nutritional and stress signaling pathways by Maf1. Trends Biochem. Sci. 32: 51-53.[CrossRef][Medline]
  86. 44
  87. Yoshihisa, T., K. Yunoki-Esaki, C. Ohshima, N. Tanaka, and T. Endo. 2003. Possibility of cytoplasmic pre-tRNA splicing: the yeast tRNA splicing endonuclease mainly localizes on the mitochondria. Mol. Biol. Cell. 14: 3266-3279.[Abstract/Free Full Text]
  88. 45
  89. Zaros, C., and P. Thuriaux. 2005. Rpc25, a conserved RNA polymerase III subunit, is critical for transcription initiation. Mol. Microbiol. 55: 104-114.[CrossRef][Medline]


Molecular and Cellular Biology, November 2007, p. 7693-7702, Vol. 27, No. 21
0270-7306/07/$08.00+0     doi:10.1128/MCB.01051-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Boisnard, S., Lagniel, G., Garmendia-Torres, C., Molin, M., Boy-Marcotte, E., Jacquet, M., Toledano, M. B., Labarre, J., Chedin, S. (2009). H2O2 Activates the Nuclear Localization of Msn2 and Maf1 through Thioredoxins in Saccharomyces cerevisiae. Eukaryot Cell 8: 1429-1438 [Abstract] [Full Text]  
  • Lee, J., Moir, R. D., Willis, I. M. (2009). Regulation of RNA Polymerase III Transcription Involves SCH9-dependent and SCH9-independent Branches of the Target of Rapamycin (TOR) Pathway. J. Biol. Chem. 284: 12604-12608 [Abstract] [Full Text]  
  • Soragni, E., Kassavetis, G. A. (2008). Absolute Gene Occupancies by RNA Polymerase III, TFIIIB, and TFIIIC in Saccharomyces cerevisiae. J. Biol. Chem. 283: 26568-26576 [Abstract] [Full Text]  
  • Ghavi-Helm, Y., Michaut, M., Acker, J., Aude, J.-C., Thuriaux, P., Werner, M., Soutourina, J. (2008). Genome-wide location analysis reveals a role of TFIIS in RNA polymerase III transcription. Genes Dev. 22: 1934-1947 [Abstract] [Full Text]  
  • Towpik, J., Graczyk, D., Gajda, A., Lefebvre, O., Boguta, M. (2008). Derepression of RNA Polymerase III Transcription by Phosphorylation and Nuclear Export of Its Negative Regulator, Maf1. J. Biol. Chem. 283: 17168-17174 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ciesla, M.
Right arrow Articles by Boguta, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ciesla, M.
Right arrow Articles by Boguta, M.