![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article 
Molecular and Cellular Biology, November 2007, p. 7718-7726, Vol. 27, No. 21
0270-7306/07/$08.00+0 doi:10.1128/MCB.00180-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Novartis Institutes for BioMedical Research Vienna, Vienna, Austria
Received 31 January 2007/ Returned for modification 6 July 2007/ Accepted 25 August 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
However, the appearance of these already known molecules follows the activation event with a certain delay. We wanted to understand the very early changes on the dendritic cell surface after stimulation, because we reasoned that surface molecules appearing immediately early after stimulation might be involved in controlling the maturation and fate of the DC itself. For example, immediate early activation molecules could amplify the external activation signal, could modify the migratory behavior, or could serve as a stop signal by initiating a negative feedback loop. We searched for such first-line activation markers by comparing naïve and early activated DCs in a differential display analysis. Here we identify EWI-2 as an early induced transcript whose presence on dendritic cells has not been described before. EWI-2 (11) is also known as CD316, PGRL (PG regulatory-like protein), KAI/CD82-associated surface molecule (34), and CD81-binding partner 3 (CD81P3) (10). EWI-2 contains four immunoglobulin domains, a transmembrane region, and a short cytoplasmic tail that does not bear any signature motif for signal transduction. However, work of the Hemler and Rubinstein groups indicated that EWI-2 participates in a multitude of interactions and is also part of the tetraspanin web and that EWI-2 regulates integrin 
3ß1 as well as 4ß1 functions (11, 17, 24).
Our efforts to find a ligand for EWI-2 whose binding would initiate signaling with maturation-modifying properties identified HSPA8, a member of the heat shock protein family, as an EWI-2 ligand. Heat shock proteins are highly conserved and ubiquitously expressed proteins whose expression levels and availabilities are actively regulated in infections and other stressful conditions. Several families of HSPs exist, including the HSP70 subfamily. To date, 12 members of the human HSP70 subfamily have been isolated. The constitutive isoform HSPA8 is also termed HSP73 and HSC70/HSC73. It is expressed in the cytosol, where HSP73 functions as a molecular chaperone for newly synthesized proteins. However, HSPA8 can also be found extracellularly in a membrane-bound form, for example, on the surfaces of Epstein-Barr virus-transformed B cells and cancer cells (14). HSPA8 was also reported to be a putative cell surface marker for undifferentiated human embryonic stem cells (22). Barreto and colleagues (4) showed the release of HSC70, corresponding to HSPA8, from human tumor cells upon stress. High levels were detected following heat shock or bacterial infection. HSPA8 can also be found at the surfaces of tumor T cells and epithelial cancer cells and also as a soluble molecule in the synovial fluid of rheumatoid arthritis patients (21). The functions of these membrane-bound and secreted hsp forms are still mostly unknown.
We also show that the interaction between EWI-2 and HSPA8 has functional consequences on the behavior of activated dendritic cells. In fact, these two molecules may be members of a broader regulatory circle that fine-tunes the transition between innate and adaptive immune responses.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
; gamma interferon; Ig, immunoglobulin; IL, interleukin; IPTG, isopropyl-ß-D-thiogalactopyranoside; LC, Langerhans cell; LPS, lipopolysaccharide; LTA, lipoteichoic acid; MAb, monoclonal antibody; MALP-2, macrophage-activating lipopeptide from Mycoplasma fermentans; MoDC, monocyte-derived dendritic cell; PAMP, pathogen-associated molecular pattern; PBMC, peripheral blood mononuclear cell; PBS, phosphate-buffered saline; PE, phycoerythrin; rh, rhesus; RT-PCR, reverse transcription-PCR; sEWI-2, soluble EWI-2; siRNA, small interfering RNA; TCC, T-cell clones; TGF-ß, transforming growth factor ß; TLR, Toll-like receptor; TNF-, tumor necrosis factor alpha.
Antibodies and reagents.
Monoclonal anti-EWI-2 antibodies were generated by immunization of BALB/c and ABH/Biozzi mice with irradiated EWI-2 transfectants and/or sEWI-2 protein. Spleen cells were fused with SP2/0 mouse myeloma cells by use of standard techniques. The following antibodies (MAb clones) were used in this study: anti-CD86 PE (BU63, IgG1) (Cymbus Biotechnology, NH); IgG1 PE (G18-145), anti-CD11c (B-ly6, IgG1), and IgG1-biotin (MOPC-31C) (BD, NJ); anti-TLR2 (TL2.1, IgG2a) and anti-TLR4 (HTA125, IgG2a) (eBioscience, CA); IgG2a (MCA929XZ) (Serotec, Germany); anti-CD123/IL-3R PE (AC145, IgG2a) (Miltenyi Biotec, Bergisch Gladbach, Germany); hIgG sera (Sigma, MO); and mouse IgG sera (Pierce). Second-step reagents were anti-mouse PE (Biosource, CA) and streptavidin-allophycocyanin (BD, NJ). Recombinant human cytokines used were as follows: rhGM-CSF, rhIL-4, and rhIL-3 (Novartis AG, Basel, Switzerland); rhSCF (R&D Systems, Minneapolis MN); rhTNF- (30 ng/ml) (Sigma, MO); IL-1ß; FLT3L, and TGF-ß (R&D Systems, Minneapolis MN); and IFN- (Strathmann Biotec, Germany). Reagents that were used for stimulation were as follows: LPS, LTA, poly(I:C), zymosan, peptidoglycan, TNF-, and ionomycin (Sigma, MO); CpG (TIB Molbio, Germany); flagellin (Alexis, Oxford, United Kingdom), and fibronectin (BD, CA); HKLM, MALP-2, and Pam3CSK4 (InvivoGen, CA); and imiquimod (SeqChem, United Kingdom).
Purification and preparation of DC subsets.
Lymphocyte-enriched peripheral blood concentrates derived from healthy donors were obtained from the Vienna General Hospital. PBMCs were isolated by centrifugation over a Ficoll-Paque Plus (Amersham Bioscience, Uppsala, Sweden) gradient. Monocytes were purified from PBMCs by negative sorting using a monocyte isolation kit (all magnetic isolation kits from Miltenyi Biotec, Bergisch Gladbach, Germany). MoDCs were generated by culturing monocytes in RPMI complete medium supplemented with 100 ng/ml rhGM-CSF and 80 ng/ml rhIL-4 for 5 days at 0.5 x 106 cells/ml. Myeloid DCs were generated from PBMCs by use of a BDCA-1 positive isolation kit. Myeloid DCs were stimulated directly after isolation. Plasmacytoid DCs were obtained from PBMCs by positive sorting using anti-BDCA-2-conjugated magnetic microbeads. Plasmacytoid DCs were cultured and activated in RPMI complete medium supplemented with 100 ng/ml rhIL-3. LCs were generated from umbilical cord blood samples according to the method of Caux et al. (9) as follows. CD34+ cells were isolated from mononuclear fractions by positive selection using anti-CD34-conjugated magnetic microbeads. LC cultures were established in RPMI complete medium supplemented with 50 ng/ml GM-CSF, 50 ng/ml FLT3L, and 20 ng/ml SCF. Cells were then washed on day 2 and cultured in RPMI complete medium containing 50 ng/ml GM-CSF, 100U/ml TNF-, and 5 ng/ml TGF-ß for 3 days.
Migration assay.
DC migration was evaluated using a 24-well, 5.0-µm-pore-size Transwell plate (Costar, Cambridge, MA). DCs were washed once with PBS and adjusted to 2 x 106 cells/ml in assay medium (RPMI 1640 without phenol red, 0.1% BSA). An aliquot (50 µl) of this cell suspension was placed in the top Transwell chamber. Optimal concentrations of chemokines were determined first in preexperiments (500 ng/ml of SLC/CCL21, 200 ng/ml of MIP-3ß/CCL19, 100 ng/ml SDF-1/CXCL12, or 100 ng/ml SDF-1ß/CXCL12; R&D Systems, Minneapolis MN). Optimal chemokine concentrations were then added to the bottom chamber. Antibodies were added to the top as well as the bottom chamber. After 180 min of incubation at 37°C in a 5% CO2 atmosphere, the top chamber was removed, and cells that migrated into the bottom chamber were counted.
Cell culture and cell lines. The following cell lines were purchased from the American Type Culture Collection (Manassas, VA): CEM (CCL-119), HeLa (CCL-2), HuT78 (TIB-161), U266 (TIB-196), U937 (CRL-1593), and PA-1 (CRL-1572). PEER (ACC6) and SP2/0 (ACC125) were from DSMZ (Braunschweig, Germany). Adherent cells were cultured in Dulbecco minimal essential H21 medium, and cells in suspension were cultured in RPMI 1640 complete medium containing 10% FCS, 1% penicillin, and 1% streptomycin (InvivoGen, CA) at 37°C and 5% CO2.
The CD4+ human TCC, referred to as CFTS4:3.1, CFTS4:2.15, and CFTS4:2.20, were established from punch biopsy samples of clinically noninvolved skin from an atopic dermatitis patient, taken 24 h after epicutaneous challenge with a protein extract of house dust mites as previously described (31). The TCC recognize peptides of major allergen Der p1 of Dermatophagoides pteronyssinus in association with the major histocompatibility complex class II restriction molecule HLA-DPw4 (allele HLA-DPB1*0401) (5). For expansion, the T cells were activated every 14 days via anti-CD3 MAb (MAb clone HIT3a; Pharmingen, San José, CA) immobilized via plastic-surface-bound goat anti-mouse IgG-specific antibodies and cultured in RMPI 1640 medium supplemented with 5% FCS, 5% human serum (PAA Laboratories, Linz, Austria), rhIL-2, and rhIL-4 (50 U/ml each).
For antigen-specific stimulation, DCs were incubated overnight in culture medium containing 50 µg/ml Dermatophagoides pteronyssinus protein extract (Dpt; ARTU Biologicals NV, Lelystad, The Netherlands). The content of major allergen Der p1 in the lot used was 18.5 µg/mg extract. DCs incubated without antigen served as negative controls. Following washing to remove excess antigen, DCs and 105 Der p1-specific T cells of clone 4.3.1 were mixed and seeded into 96-well culture plates at a DC/T-cell ratio of 1/40.
Generation and screening of cDNA expression library. A Jurkat cDNA library was generated using the SMART approach (Clontech) with the modifications of Wellenreuther et al. (33) Briefly, poly(A)+ RNA was isolated (QIAGEN) and first-strand cDNA was synthesized using a Creator SMART cDNA library construction kit (Clontech, CA). Double-stranded cDNA synthesis was performed by a primer extension method, and the resulting cDNA was size fractionated on a 0.8% agarose gel. Four pools of cDNA were extracted and separately PCR amplified. The amplified cDNA was SfiI digested for 1 h at 50°C and ligated into a modified pCX4 retroviral vector (kind gift of Tsuyoshi Akagi, Osaka Bioscience Institute [1]). Each sublibrary comprised more than 250,000 primary clones. The libraries were introduced by retroviral transfection in the mouse SP2/0 cell line. EWI-2 binding cells were enriched with repeated rounds of magnetic and FACS steps with sEWI-2-hIg protein in combination with mouse anti-hIg microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and anti-hFc FITC reagent (Sigma, MO), respectively. hIgG served as the negative control (Sigma, MO). Retroviral inserts were retrieved by a two-step nested PCR amplification with vector-specific primers from genomic DNA isolated from single-cell clones.
Expression and purification of recombinant proteins. The sEWI-2-hIg protein comprised four extracellular domains, including amino acids 1 to 574 fused to the J-CH2-CH3 domains of the hIgG heavy chain. The sEWI-2-hIg protein was expressed in Sf9 insect cells and purified from the supernatant on either recombinant protein A (Amersham Biosciences, Uppsala, Sweden)- or anti-hFc-specific affinity columns (Sigma, MO). Protein concentration was determined in an anti-hIg ELISA. For the generation of the HSPA8-His protein, the HSPA8 cDNA retrieved from the Jurkat expression library was C-terminally tagged and expressed in BL21(LysS) cells. Expression was induced with 0.5 mM IPTG for 4 h at 28°C, and the HSPA8-His protein was extracted in a buffer containing 10 mM imidazole, 10% glycerol, and 0.5% Triton X-100. HSPA8-His protein was purified on Ni-nitrilotriacetic acid agarose (QIAGEN), and residual endotoxin was removed on a polymyxin B column (Sigma, Missouri). HSPA8 was quantified using Bradford analysis, and LPS content was measured by Limulus amebocyte lysate assay. The purities and identities of both proteins were determined by use of sodium dodecyl sulfate-polyacrylamide gel electrophoresis and immunoblots that were developed with specific antibodies.
Flow cytometric analysis. Cells were prepared in FACS buffer (PBS containing 0.05% sodium azide, 1 mM EDTA, and 2% FCS) and labeled with a combination of antibodies and their appropriate isotype-matched control antibodies. The binding of unlabeled antibodies was detected by fluorochrome-labeled second-step reagents. Samples were analyzed using a FACSCalibur flow cytometer (BDIS) with CellQuest acquisition software (BDIS) or the WinMDI2.8 program. The percentage of positive cells was calculated as the percentage of cells stained with specific antibodies compared to background staining, which was evaluated with corresponding isotype controls.
siRNA treatment. HSPA8-specific siRNA duplexes were from the HiPerformance series from QIAGEN (Hildesheim, Germany) with the target sequences AAGGACCTAAATTCGTAGCAA (Hs_HSPA8_6_HP) and AACACTGTATTGTAAGTGGAA (Hs_HSPA8_8_HP). AllStars negative control siRNA was from the same supplier. Jurkat cells in the log growth phase were harvested and resuspended at 8 x 106 cells/ml in 200 µl Cytomix buffer (30) containing annealed siRNA at a 200 nM final concentration. Within 10 min, samples were transferred to a 2-mm electroporation cuvette (Bio-Rad) and treated with a single pulse of 175 V and 1,000 µF by use of a Bio-Rad electroporation apparatus. Cells were rested in 12-well plates in complete medium for 1 h and then washed with PBS and incubated in PBS containing 2% BSA and 2 mM EDTA for 15 min at room temperature. Cells were then washed again in this medium and subsequently transferred into fresh wells in complete culture medium and incubated until their analysis.
Quantitative RT-PCR.
Total RNA was isolated from cells by use of an Absolut RNA RT-PCR miniprep kit (Stratagene, CA). RT-PCR was performed with 700 ng of total RNA by use of TaqMan reverse transcription reagents (Applied Biosystems, CA) and a TaqMan Universal PCR master mix, NoAmpErase (Applied Biosystems, CA). The following primers and their corresponding probes were purchased from Applied Biosystems: CD86 forward, 5'-TTC TGA ATG AGG TAT ACT TAG GCA AAG AG-3'; CD86 reverse, 5'-GCC CTT GTC CTT GAT CTG AAG A-3'; CD86 probe, 5'-CGG ACA GTT GGA CCC TGA GAC TTC ACA-3'; EF-1 forward, 5'-TTT GAG ACC AGC AAG TAC TAT GTG ACT-3'; EF-1 reverse, 5'-TCA GCC TGA GAT GTC CCT GTA A-3'; EF-1 probe, 5'-TCA TTG ATG CCC CAG GAC ACA GAG AC-3'; and EWI-2 primer and probe set Hs00364603_m1 (Applied Biosystems).
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
As reagents were not readily available, MAbs were raised in order to investigate the expression, localization, and function of EWI-2. Three antibodies were selected which showed specific binding in ELISA using purified protein and in FACS analysis using BaF/3 transfectants. Among them, clone 5E8 also recognized the EWI-2 protein in Western blotting (Fig. 1a to d). Although EWI-2 was not previously described to be expressed on DCs, our differential display data predicted that the protein will appear on the surfaces of DCs upon activation. Therefore, various DC subsets were isolated and tested before and after LPS-plus-IFN- treatment. Confirming the prediction, EWI-2 was absent on unstimulated monocytes, MoDCs, and myeloid DCs, but each of these cell types substantially upregulated EWI-2 expression upon stimulation (Fig. 1j to l). On plasmacytoid DCs and on cord blood-derived Langerhans-like cells, EWI-2 was constitutively expressed (Fig. 1 h and i).
|
|
|
|
|
|
Since it is known that the surface levels of HSPA8 decrease after heat shock (4), one can expect that heat-treated HSPA8-carrying cells will lose or decrease their ability to bind sEWI-2-hIg. We thus tested Jurkat cells before and after heat shock and found that the binding of sEWI-2-hIg was significantly downregulated. At the same time, the expression of EWI-2 itself was not affected (Fig. 7a and b). The reactivity of THP-1 control cells remained unchanged (Fig. 7c and d).
|
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
First, DCs receive (co)activation signals upon the recognition of PAMPs via TLRs. The responsiveness of PAMPs is linked to the expression of TLRs. We found that TLR1, TLR2, and TLR4 were highly expressed on MoDCs, whereas all other TLRs were expressed at very low levels. EWI-2 upregulation was observed using different TLR2 and TLR4 binding reagents, including LPS. Commercially available anti-TLR2- or TLR4-blocking antibodies or their combination (29) was only partially able to abrogate EWI-2 upregulation. One possible explanation is the known promiscuity of ligands binding several TLR receptors; another is that TLR2 forms heterodimers with either TLR1 or TLR6, either of which can maintain its function despite the antibody blockade (18). The molecular mechanisms by which TLRs induce gene expression are now rapidly being elucidated (25). Further experiments can thus precisely define how the induction of EWI-2 expression is connected to the signaling pathways downstream of TLRs.
The central molecule in this proposed early local feedback loop is EWI-2. EWI-2 was found by Charrin et al. (10) to be expressed in various immune cells, most prominently in unstimulated T, B, and NK cells, and we now identify EWI-2 as an activation marker of mature monocytes and DC subsets. Our time course expression experiments showed that EWI-2 is upregulated even earlier than CD86. A very similar expression pattern was also found for chemokines/cytokines and their receptors (28). Given the apparently synchronized kinetics of distinct functional groups, we propose that EWI-2 is part of a broader "early regulatory" system and that interactions with or through EWI-2 influence or fine-tune the final outcome of the DC maturation process.
For transmitting a signal, an external ligand is required. Three lines of evidence indicate that HSPA8 is a ligand of EWI-2: (i) direct expression cloning, (ii) genetic complementation (transfection) of a nonbinder host cell line by use of an independent HSPA8 encoding cDNA and loss of EWI-2 binding upon HSPA8-specific siRNA treatment, and (iii) direct demonstration of protein-protein interaction. HSPA8 has been described as an intracellular chaperone that is present in the cytosols of all prokaryotic and eukaryotic organisms. Although the HSPA8 molecule lacks both a signal sequence and a transmembrane domain, HSPA8 was found to be overexpressed on the cell surface by many different cells, including leukemia lines, thyroid cancer cells, and primary melanoma cells (4, 12). HSPs from other classes, including HSP60 (7) and gp96, were also found at the cell surface.
In recent years, several hsp70 receptors, including CD14, TLR2, TLR4, CD40, CD91, and LOX-1 have been identified (8). The LPS receptors CD14 and TLR4 were implicated in binding hsp60/65 (16, 20). These receptors were also reported to bind the human hsp70, but the significance of these findings is under debate, as CD14 and TLR2/4 are also simultaneously LPS receptors. CD91 has also been shown to be a receptor for hsp70, hsp90, and calreticulin (6). Due to its large size, however, no experiments were performed that would directly have confirmed the binding of hsp70 to CD91-transfected cells. LOX-1, another scavenger receptor, was identified as a receptor for endocytic uptake of the hsp70 class and their chaperoned peptides by human DCs (13). In contrast to EWI-2, LOX-1 is present on immature DCs. These data can be interpreted to indicate that different hsp receptors might have correspondingly different functions: the big, multipurpose scavenger-type receptors, like LOX1 and CD91, are involved in the early phase, when antigen uptake is facilitated by hsp (26), and are also responsible for the delivery of hsp-associated antigens for presentation (19), while the ligand-specific inducible receptors, like EWI-2, would have primarily regulatory roles. The most unique property of EWI-2 is that it seems to have a restricted repertoire of hsp ligands or at least displays a certain preference in this regard: we found exclusive binding towards HSPA8, while the homologous HSPA1 and HSPD1 and the unrelated mycobacterial hsp65 were not recognized. Although the overall structure of the hsp70 class is generally highly conserved, it is important to note that there are significant amino acid differences between HSPA8 and other family members. We mapped HSPA8 to a consensus model based on the 1YUW and 1S3X crystal structures representing HSPA1 and found that there is a prominent string of divergent amino acids near the peptide binding domain. In addition, variations in conformation could also account for selectivity. ATP, which causes such changes, was indeed interfering with the EWI-2-HSPA8 interaction.
We hypothesized that rapid changes in the gene expression pattern of DCs after the initial activation would lead to the appearance of new surface receptors, which in turn could offer a possibility for in situ fine-tuning of DC behavior. In this study we (i) identified EWI-2/CD316 as one of the earliest molecules upregulated upon activation on several subtypes of DCs; (ii) showed that HSPA8 is a ligand for EWI-2; and (iii) demonstrated that through EWI-2-mediated interactions, the migratory and antigen-presenting capacities of DCs are altered. In conclusion, interactions of EWI-2 with its newly identified ligand, HSPA8, may have multiple opportunities to influence the downstream behavior of DCs and thereby control the ensuing adaptive immune response. Interfering with this pathway therefore may have possible therapeutic utility in the treatment of autoimmune diseases. It will be important to clarify the contribution of this pathway in pathological settings, especially in situations where both high levels of HSPA8 and local accumulation of DCs were observed, like in rheumatoid arthritis.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Published ahead of print on 4 September 2007.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Banchereau, J., F. Briere, C. Caux, J. Davoust, S. Lebecque, Y. J. Liu, B. Pulendran, and K. Palucka. 2000. Immunobiology of dendritic cells. Annu. Rev. Immunol. 18: 767-811.[CrossRef][Medline]
3. Banchereau, J., and R. M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392: 245-252.[CrossRef][Medline]
4. Barreto, A., J. M. Gonzalez, E. Kabingu, A. Asea, and S. Fiorentino. 2003. Stress-induced release of HSC70 from human tumors. Cell. Immunol. 222: 97-104.[CrossRef][Medline]
5. Baselmans, P. J., E. Pollabauer, F. C. van Reijsen, H. C. Heystek, A. Hren, P. Stumptner, M. G. Tilanus, W. C. Vooijs, and G. C. Mudde. 2000. IgE production after antigen-specific and cognate activation of HLA-DPw4-restricted T-cell clones, by 78% of randomly selected B-cell donors. Hum. Immunol. 61: 789-798.[CrossRef][Medline]
6. Basu, S., R. J. Binder, T. Ramalingam, and P. K. Srivastava. 2001. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14: 303-313.[CrossRef][Medline]
7. Belles, C., A. Kuhl, R. Nosheny, and S. R. Carding. 1999. Plasma membrane expression of heat shock protein 60 in vivo in response to infection. Infect. Immun. 67: 4191-4200.
8. Binder, R. J., R. Vatner, and P. Srivastava. 2004. The heat-shock protein receptors: some answers and more questions. Tissue Antigens 64: 442-451.[CrossRef][Medline]
9. Caux, C., C. Dezutter-Dambuyant, D. Schmitt, and J. Banchereau. 1992. GM-CSF and TNF-alpha cooperate in the generation of dendritic Langerhans cells. Nature 360: 258-261.[CrossRef][Medline]
10. Charrin, S., F. Le Naour, V. Labas, M. Billard, J. P. Le Caer, J. F. Emile, M. A. Petit, C. Boucheix, and E. Rubinstein. 2003. EWI-2 is a new component of the tetraspanin web in hepatocytes and lymphoid cells. Biochem. J. 373: 409-421.[CrossRef][Medline]
11. Charrin, S., F. Le Naour, M. Oualid, M. Billard, G. Faure, S. M. Hanash, C. Boucheix, and E. Rubinstein. 2001. The major CD9 and CD81 molecular partner. Identification and characterization of the complexes. J. Biol. Chem. 276: 14329-14337.
12. Deichmann, M., M. Polychronidis, A. Benner, C. Kleist, M. Thome, B. Kahle, and B. M. Helmke. 2004. Expression of the heat shock cognate protein HSP73 correlates with tumour thickness of primary melanomas and is enhanced in melanoma metastases. Int. J. Oncol. 25: 259-268.[Medline]
13. Delneste, Y., G. Magistrelli, J. F. Gauchat, J. F. Haeuw, J. P. Aubry, K. Nakamura, N. Kawakami-Honda, L. Goetsch, T. Sawamura, J. Y. Bonnefoy, and P. Jeannin. 2002. Involvement of LOX-1 in dendritic cell-mediated antigen cross-presentation. Immunity 17: 353-362.[CrossRef][Medline]
14. Hantschel, M., K. Pfister, A. Jordan, R. Scholz, R. Andreesen, G. Schmitz, H. Schmetzer, W. Hiddemann, and G. Multhoff. 2000. Hsp70 plasma membrane expression on primary tumor biopsy material and bone marrow of leukemic patients. Cell Stress Chaperones 5: 438-442.[CrossRef][Medline]
15. Kammerer, R., D. Stober, P. Riedl, C. Oehninger, R. Schirmbeck, and J. Reimann. 2002. Noncovalent association with stress protein facilitates cross-priming of CD8+ T cells to tumor cell antigens by dendritic cells. J. Immunol. 168: 108-117.
16. Kol, A., A. H. Lichtman, R. W. Finberg, P. Libby, and E. A. Kurt-Jones. 2000. Heat shock protein (HSP) 60 activates the innate immune response: CD14 is an essential receptor for HSP60 activation of mononuclear cells. J. Immunol. 164: 13-17.
17. Kolesnikova, T. V., C. S. Stipp, R. M. Rao, W. S. Lane, F. W. Luscinskas, and M. E. Hemler. 2004. EWI-2 modulates lymphocyte integrin {alpha}4{beta}1 functions. Blood 103: 3013-3019.
18. Lee, J. Y., L. Zhao, H. S. Youn, A. R. Weatherill, R. Tapping, L. Feng, W. H. Lee, K. A. Fitzgerald, and D. H. Hwang. 2004. Saturated fatty acid activates but polyunsaturated fatty acid inhibits Toll-like receptor 2 dimerized with Toll-like receptor 6 or 1. J. Biol. Chem. 279: 16971-16979.
19. Noessner, E., R. Gastpar, V. Milani, A. Brandl, P. J. Hutzler, M. C. Kuppner, M. Roos, E. Kremmer, A. Asea, S. K. Calderwood, and R. D. Issels. 2002. Tumor-derived heat shock protein 70 peptide complexes are cross-presented by human dendritic cells. J. Immunol. 169: 5424-5432.
20. Ohashi, K., V. Burkart, S. Flohe, and H. Kolb. 2000. Heat shock protein 60 is a putative endogenous ligand of the Toll-like receptor-4 complex. J. Immunol. 164: 558-561.
21. Schett, G., K. Redlich, Q. Xu, P. Bizan, M. Groger, M. Tohidast-Akrad, H. Kiener, J. Smolen, and G. Steiner. 1998. Enhanced expression of heat shock protein 70 (hsp70) and heat shock factor 1 (HSF1) activation in rheumatoid arthritis synovial tissue. Differential regulation of hsp70 expression and hsf1 activation in synovial fibroblasts by proinflammatory cytokines, shear stress, and antiinflammatory drugs. J. Clin. Investig. 102: 302-311.[Medline]
22. Son, Y. S., J. H. Park, Y. K. Kang, J. S. Park, H. S. Choi, J. Y. Lim, J. E. Lee, J. B. Lee, M. S. Ko, Y. S. Kim, J. H. Ko, H. S. Yoon, K. W. Lee, R. H. Seong, S. Y. Moon, C. J. Ryu, and H. J. Hong. 2005. Heat shock 70-kDa protein 8 isoform 1 is expressed on the surface of human embryonic stem cells and downregulated upon differentiation. Stem Cells 23: 1502-1513.
23. Stipp, C. S., T. V. Kolesnikova, and M. E. Hemler. 2001. EWI-2 is a major CD9 and CD81 partner and member of a novel Ig protein subfamily. J. Biol. Chem. 276: 40545-40554.
24. Stipp, C. S., T. V. Kolesnikova, and M. E. Hemler. 2003. EWI-2 regulates alpha3beta1 integrin-dependent cell functions on laminin-5. J. Cell Biol. 163: 1167-1177.
25. Takeda, K., and S. Akira. 2004. TLR signaling pathways. Semin. Immunol. 16: 3-9.[CrossRef][Medline]
26. Theriault, J. R., H. Adachi, and S. K. Calderwood. 2006. Role of scavenger receptors in the binding and internalization of heat shock protein 70. J. Immunol. 177: 8604-8611.
27. Triantafilou, K., M. Triantafilou, and R. L. Dedrick. 2001. A CD14-independent LPS receptor cluster. Nat. Immunol. 2: 338-345.[CrossRef][Medline]
28. Tureci, O., H. Bian, F. O. Nestle, L. Raddrizzani, J. A. Rosinski, A. Tassis, H. Hilton, M. Walstead, U. Sahin, and J. Hammer. 2003. Cascades of transcriptional induction during dendritic cell maturation revealed by genome-wide expression analysis. FASEB J. 17: 836-847.
29. Uehori, J., M. Matsumoto, S. Tsuji, T. Akazawa, O. Takeuchi, S. Akira, T. Kawata, I. Azuma, K. Toyoshima, and T. Seya. 2003. Simultaneous blocking of human Toll-like receptors 2 and 4 suppresses myeloid dendritic cell activation induced by Mycobacterium bovis bacillus Calmette-Guérin peptidoglycan. Infect. Immun. 71: 4238-4249.
30. van den Hoff, M. J., A. F. Moorman, and W. H. Lamers. 1992. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Res. 20: 2902.
31. van Reijsen, F. C., C. A. Bruijnzeel-Koomen, F. S. Kalthoff, E. Maggi, S. Romagnani, J. K. Westland, and G. C. Mudde. 1992. Skin-derived aeroallergen-specific T-cell clones of Th2 phenotype in patients with atopic dermatitis. J. Allergy Clin. Immunol. 90: 184-193.[CrossRef][Medline]
32. Vidal-Laliena, M., X. Romero, S. March, V. Requena, J. Petriz, and P. Engel. 2005. Characterization of antibodies submitted to the B cell section of the 8th Human Leukocyte Differentiation Antigens Workshop by flow cytometry and immunohistochemistry. Cell. Immunol. 236: 6-16.[CrossRef][Medline]
33. Wellenreuther, R., I. Schupp, A. Poustka, and S. Wiemann. 2004. SMART amplification combined with cDNA size fractionation in order to obtain large full-length clones. BMC Genomics 5: 36.[CrossRef][Medline]
34. Zhang, X. A., W. S. Lane, S. Charrin, E. Rubinstein, and L. Liu. 2003. EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63: 2665-2674.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| J. Bacteriol. | J. Virol. | Eukaryot. Cell |
|---|
| Microbiol. Mol. Biol. Rev. | Clin. Vaccine Immunol. | All ASM Journals |
|---|
65 kDa, as indicated by the black arrow. (e to n) Expression of EWI-2 was analyzed by FACS on monocytes (e and j), MoDCs (f and k), myeloid DCs (g and l), plasmacytoid DCs (h and m), and in vitro generated Langerhans-like cells (i and n) before (upper row) and after (lower row) stimulation. Filled profiles, mAb 5E8; empty profiles, isotype controls.
indicates a P value of <0.05 in comparison to the medium control value.