Previous Article | Next Article ![]()
Molecular and Cellular Biology, November 2007, p. 7839-7847, Vol. 27, No. 22
0270-7306/07/$08.00+0 doi:10.1128/MCB.00438-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Department of Medicine, Division of Gastroenterology, University of Massachusetts Medical School, Worcester, Massachusetts
Received 14 March 2007/ Returned for modification 24 April 2007/ Accepted 8 September 2007
|
|
|---|
|
|
|---|
NeuroD1 is a member of the tissue-specific class (class B) of bHLH transcription factors. It is expressed in neurons, the anterior pituitary gland, pancreatic islets, and enteroendocrine cells. Thus, NeuroD1 is the only identified protein binding to the secretin enhancer that is expressed in a very limited number of cell types, whereas expression of Sp1 and Finb/RREB1 is widespread.
A number of studies suggest a potentially significant role for NeuroD1 in the terminal differentiation of pancreatic islets (22, 23) and enteroendocrine cells (21, 22) and in the development of various structures in the nervous system (12, 16, 17, 19). Potential target genes that depend on NeuroD1 for expression include the genes for the hormones secretin, insulin, glucagon, and proopiomelanocortin (POMC), as well as the gene encoding the homeodomain protein PDX-1 (4, 21, 23, 26, 30).
Of note, the secretin gene is the only target gene identified thus far that shows an absolute requirement for NeuroD1 for in vivo expression. NeuroD1-null mice fail to develop any secretin-producing enteroendocrine cells. A moderate reduction in the number of glucagon-expressing
cells and insulin-expressing ß cells was noted in the endocrine pancreas, although both insulin and glucagon immunoreactivity were readily detected in the remaining cells (22). Corticotroph differentiation was delayed during fetal development in NeuroD1-null mice with no reduction in POMC-expressing cells in older animals, indicating a nonessential role for NeuroD1 (15).
In addition to its direct effects on secretin gene transcription, NeuroD1 may play a role in coordinating expression of secretin with cell cycle exit as secretin cells terminally differentiate. The effects of NeuroD1 on cell proliferation may result from increased p21 expression (21). NeuroD1-dependent transcription is repressed by cyclin D1 by a mechanism independent of cyclin-dependent kinases (27). The presence of cyclin D1 in the proliferating cells of intestinal crypts may serve to prevent relatively immature, proliferating cells in the intestinal crypts from prematurely differentiating. Thus, NeuroD1 has a central role in the regulation of secretin cell differentiation.
Our earlier work suggested that NeuroD1 is a relatively weak yet essential transcriptional activator of the secretin gene (28). The organization of the secretin enhancer bears little similarity to that of the insulin or POMC enhancers, suggesting that the function of NeuroD1 in transcription of the secretin, insulin, and POMC genes in enteroendocrine cells, pancreatic ß cells, and pituitary corticotrophs, respectively, may depend on other factors recruited to each enhancer.
Finb/RREB1, a ubiquitously expressed DNA binding protein, potentiates transcriptional activation by NeuroD1 despite its lack of an intrinsic activation domain. The effect of Finb/RREB1 on NeuroD1 requires both its binding to the enhancer 5' to the E-box and direct physical association with NeuroD1 (28). We and others previously identified positive cis regulatory elements in the secretin gene enhancer that bind to Sp1 (13, 28). One of the Sp1 sites identified was immediately contiguous to the 3' end of the NeuroD1 binding E-box. Because of the close proximity between these two sites, we examined whether NeuroD1 and Sp1 functionally and physically interact to increase the transcription-activating functions of NeuroD1. Our results suggest that Sp1 and NeuroD1 synergistically activate expression of the secretin gene through physical interactions that stabilize binding of Sp1 to DNA.
|
|
|---|
Plasmid constructions. A secretin-luciferase reporter containing one copy of the secretin enhancer spanning from –209 to +32 has been described previously (34). Transversion point mutations were introduced by site-directed mutagenesis (9) to generate the different mutant secretin reporter plasmids, mGC1 (–119, –117); the E-box mutant mE (–130, –127) (20); a mutant with both Sp1 sites mutated, MutGC (–65, –63, –119, –117); and a promoter with mutations in the E-box and both Sp1 binding sites, MutE/GC. The Ins 6 reporter was generated by inserting 6 bp with a BamHI site between the E-box and the adjacent GC1 Sp1 binding site by PCR using the wild-type secretin promoter (–209 to +32) as a template. The 10-bp insertion between the E-box and the adjacent Sp1 site was generated by digesting the Ins 6 reporter construct with BamHI followed by end filling and religation. The human telomerase reverse transcriptase (hTERT)-luciferase construct extending to –629 used in the present study has been previously described (2). The mammalian expression plasmids for NeuroD1 (23), NeuroD1 in vitro transcription-translation and glutathione S-transferase (GST) fusion plasmids (21), and Sp1-GST fusion plasmids (8) were previously described. pacNeuroD1, an expression plasmid for NeuroD1 in insect cells, was constructed by subcloning NeuroD1 cDNA into BamHI and XhoI sites of the pacU vector (3). The plasmids encoding short hairpin RNAs (shRNAs) for green fluorescent protein (GFP) (32) or NeuroD1 (6) under the control of the U6 promoter and their use for reducing expression of each protein were described earlier.
Transient transfections. Cells were plated at a density of 50,000 per well of 24-well plates 18 h prior to transfection. C33A cells were transfected by calcium phosphate precipitation with a total of 0.82 µg of DNA, consisting of 0.25 µg secretin reporter plasmid, 0.02 µg Renilla luciferase plasmid, 0.05 µg NeuroD1 expression plasmid, and 0.5 µg Sp1 expression plasmid. SL2 cells were transfected similarly except that 0.025 µg of Sp1 expression plasmid pacSp1 (3) and 0.25 µg of NeuroD1 expression plasmid were used. STC-1 cells were transfected with Lipofectamine Plus. Cells were harvested 24 h later. Firefly luciferase activity was normalized to Renilla luciferase activity.
Oligonucleotides. The following oligonucleotides were used in gel shift experiments. The wild-type E-GC1 element encompassing nucleotides –137 to –96 of the rat secretin promoter was made by annealing the complementary oligonucleotides (sense strand, AGCGGACGACAGCTGGGGGGGCGGCCCTGACCTTCCCGCAAT, and antisense strand, CGATTGCGGGAAGGTCAGGGCCGCCCCCCCAGCTGTCGTCCG) followed by end filling. Similarly, for making the E-mGC1 element the oligonucleotides AGCGGACGACAGCTGGGGTGTCGGCCCTGACCTTCCCGCAAT (sense strand) and CGATTGCGGGAAGGTCAGGGCCGCACACCCAGCTGTCGTCCG (antisense strand) were annealed, and for making the mE-GC1 element, AGCGGACGATAGTTGGGGGGGCGGCCCTGACCTTCCCGCAAT (sense strand) and CGATTGCGGGAAGGTCAGGGCCGCCCCCCCAACTATCGTCCG (antisense strand) were annealed. The boldface nucleotides indicate mutations introduced into the respective binding sites. In order to insert a 6-bp sequence within the E-GC1 box the oligonucleotides GCCGGACGACAGCTGGGATCCACGGGGCGGCCCTGACCTT (sense strand) and GGAAGGTCAGGGCCGCCCCGTGGATCCCAGCTGTCGTC (antisense strand) were annealed, and to insert a 10-bp sequence the oligonucleotides GCCGGACGACAGCTGGGATCGATCCACGGGGCGGCCCTGACCTT (sense strand) and GGAAGGTCAGGGCCGCCCCGTGGATCGATCCCAGCTGTCGTC (antisense strand) were annealed.
Gel shift assays. Gel shift assays and nuclear extract preparation were performed as described earlier (28). For reconstitution of DNA-protein complexes using recombinant Sp1 (Promega) or in vitro-translated proteins, 0.25 µg of poly(dI-dC) was used in each assay. Each reaction was initiated by the addition of protein followed by incubation for 20 min at room temperature, and then 7 µl was electrophoresed in 4% native polyacrylamide gels. For immunodetection of proteins in DNA-protein complexes, the extracts were preincubated on ice for 1 h with antibody to NeuroD1 (23), E12 (7), or Sp1 (Santa Cruz Biotechnology).
Coimmunoprecipitation.
NeuroD1 was immunoprecipitated from nuclear extracts (
500 µg protein) from HIT cells with 2 µg of anti-NeuroD1 (Sigma) antibody. Precipitated proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose membrane, and immunoblotted with anti-Sp1 antibody (sc-59; Santa Cruz Biotechnology).
Binding analysis with GST fusion proteins. Bacterially expressed GST fusion proteins were adsorbed to glutathione-Sepharose beads and incubated with [35S]methionine-labeled in vitro-transcribed and -translated proteins, and the bound proteins were analyzed by SDS-PAGE followed by autoradiography (28).
Chromatin immunoprecipitation (ChIP) assays. Chemical cross-linking of nuclear proteins to genomic DNA and chromatin fragmentation have been previously described (33). Cross-linked proteins from precleared chromatin supernatants were immunoprecipitated with anti-NeuroD (Sigma) or anti-Sp1 (sc-59; Santa Cruz Biotechnology) antibody. DNA was purified (QIAquick PCR purification kit) following reversal of cross-links and proteinase K digestion. DNA was amplified with primer pairs described below using semiquantitative PCR and compared to serially diluted input DNA to ensure that the immunoprecipitated DNA was present at a concentration that allowed visualization of different amounts.
The primers used for detecting secretin promoter sequences (forward, 5'-CAGGCTCCGAGGCTTCGC-3', and reverse, 5'-GGCCCCTTTATGGCGGCG-3') have been described earlier (13). For detecting dihydrofolate reductase (DHFR) promoter sequences, the following primers were used: forward, 5'-TGCACCTGTGGAGGAGGA-3', and reverse, 5'-AGAACGCGCGGTCAAGTT-3'. For detection of the transfected secretin promoter, the following primers were used: forward, 5'-GGTACCGCACTACCCT-3', and reverse, 5'-TTGGCGTCTTCCATTTACCA-3' (from the coding sequence of the luciferase gene). The primers used for detecting the hTERT promoter sequences (forward, 5'-GGTACCGACCCCCGGGTCCGCCCGGA-3', and reverse, 5'-AAGCTTGCTGCCTGAAACTCGCGCCG-3') were described earlier (35). For detection of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) coding region, the following primers were used: forward, 5'-TGAAGGTCGGAGTCAACGGATT-3', and reverse, 5'-GTTCACACCCATGACGAACATG-3'. The PCR products were separated in 2% agarose gels stained with ethidium bromide.
|
|
|---|
90% in HIT insulinoma cells and STC-1 enteroendocrine cells, both of which express secretin and NeuroD (20). Introduction of point mutations into the Sp1 binding site (GC1 box) adjacent to the E-box similarly reduced (
84%) transcriptional activity in both cell lines (Fig. 1B). The importance of these two adjacent sites for full transcriptional activity prompted us to investigate whether NeuroD1 and Sp1 functionally cooperate to regulate transcription of the secretin gene.
![]() View larger version (16K): [in a new window] |
FIG. 1. Transcriptional synergism between NeuroD1 and Sp1 on the secretin gene. (A) Conserved alignment of the E-box and Sp1 binding sites in the rat, mouse, and human secretin gene promoters. (B) Loss of transcriptional activity of the secretin reporter in HIT and STC-1 cells, with mutations in the E-box or the adjacent Sp1 binding site. Luciferase activity of the E-box mutant (black bars) and GC1 mutant (striped bars) is expressed as a percentage of the wild-type (white bars) reporter gene activity. Results are shown as the means ± standard errors of the means of three separate experiments done in duplicate. *, P < 0.0001. (C) Secretin reporter gene activity in C33A cells or SL2 cells cotransfected with expression plasmids for NeuroD1, Sp1, or NeuroD1 plus Sp1 and the reporter plasmids indicated in panel B. Results are expressed as luciferase activity relative to the activity in the absence of NeuroD1 or Sp1. The dashed line indicates the sum of transcriptional activities by NeuroD1 and Sp1 expression vectors cotransfected individually with the respective reporter. Results are shown as the means ± standard errors of the means for at least five separate experiments. Significant differences from the additive activities of NeuroD1 and Sp1 are shown by asterisks (*, P < 0.0001; **, P < 0.05). WT, wild type.
|
We confirmed that synergistic transcriptional activation of the secretin gene required the binding sites for both NeuroD1 and Sp1 by expressing both factors with reporter genes containing mutations in either the E-box (20) or GC1 box (28). We observed no synergism between Sp1 and NeuroD1 with either mutant, suggesting that their interaction was dependent on promoter occupancy of their adjacent binding sites (Fig. 1C). The GC1 mutant reporter was weakly activated by Sp1, probably from the binding of Sp1 to a second binding site 48 nucleotides 3' to the GC1 box. However, the effects of Sp1 and NeuroD1 on the GC1 mutant reporter were additive, highlighting the importance of the GC1 site for synergism (Fig. 1C).
To further assess the function of Sp1 in secretin gene transcription, we examined the activity of the secretin-luciferase reporter with cotransfected NeuroD1 and/or Sp1 plasmids in Schneider SL2 cells, which express neither NeuroD1 nor Sp1. Cotransfection of an Sp1 expression plasmid increased low basal reporter activity by
6.4-fold. NeuroD1 had no effect by itself on expression of the secretin reporter in SL2 cells (Fig. 1C). However, NeuroD1 and Sp1 together resulted in a greater-than-additive (
21.2-fold) activation of the reporter gene in SL2 cells, suggesting that they may functionally interact (Fig. 1C).
Formation of a ternary DNA-protein complex involves binding cooperativity between NeuroD1 and Sp1. We examined DNA-protein complexes formed by Sp1 and NeuroD1 on the secretin enhancer by electrophoretic mobility shift assays (EMSAs) to determine if the functional interaction between these proteins observed in transfection assays was related to the binding of these factors to the enhancer. It has previously been shown that NeuroD1 binds to E-boxes as a heterodimer with ubiquitously expressed bHLH proteins like E12 or E47 but not as a homodimer (23). Binding of in vitro-translated NeuroD1 and E12 to a probe containing the contiguous E-box and Sp1 binding site generated a DNA-protein complex representing a NeuroD1-E12 heterodimer (Fig. 2A, lane 1), whereas NeuroD1 alone did not form a complex (not shown). A distinct, faster-migrating complex was generated with Sp1 (Fig. 2A, lane 3). However, the presence of all three proteins generated an additional, more slowly migrating complex compared to the complexes produced by Sp1 or NeuroD1-E12 alone (Fig. 2A, lane 2), suggesting the formation of a ternary complex that contained all three proteins bound to the DNA.
![]() View larger version (24K): [in a new window] |
FIG. 2. NeuroD1 and Sp1 bind cooperatively to the secretin gene to form a ternary DNA-protein complex. (A) EMSA showing protein complexes formed by indicated combinations of in vitro-translated NeuroD1, E12, or Sp1 bound to a 32P-labeled probe containing the E-box and GC1 Sp1 site (lanes 1 to 3) or the same probes with mutations in either the E-box (lanes 4 to 6) or GC1 (lanes 7 to 9) or with the insertion of a 6-bp (Ins 6) or a 10-bp (Ins 10) sequence between the two sites (lanes 10 and 11). The arrowhead denotes a slow-migrating complex seen only in the presence of all three proteins (lane 2) but not seen with any of the mutant probes (lanes 4 to 11). (B) Failure to generate the ternary complex with E12 and Sp1 in the absence of NeuroD1 (lane 2). (C) Quantitation of Sp1 and NeuroD1/E12 binding to DNA. The fraction of probe present in complexes formed by NeuroD1 plus E12 alone (panel A, lane 1) or Sp1 alone (panel A, lane 3) or in the ternary complex formed by NeuroD1, E12, and Sp1 together (panel A, lane 2) was measured by phosphorimaging. Results are shown as the means ± standard errors of the means for at least three separate experiments. *, significantly different (P < 0.05) from the fraction predicted for independent binding events measured as described before (24). WT, wild type.
|
The synergistic transcriptional activation by NeuroD1 and Sp1 could arise from interactions that enhance their binding to DNA. To determine whether the observed ternary complex resulted from cooperative DNA binding by the two proteins to the enhancer, we performed an EMSA and quantitated by phosphorimaging the fraction of probe retained in each DNA-protein complex generated by Sp1 or NeuroD1/E12 alone as well the complexes generated by all three proteins together. Sp1 and NeuroD1/E12 independently bound 15.6% and 6.4% of the total probe, respectively (Fig. 2C). If Sp1 and NeuroD1-E12 bound to DNA independently of each other, the probability of the two proteins simultaneously binding to a single probe molecule should equal the product of their individual probabilities of binding. The two proteins together generated a ternary complex containing approximately 6.7% of the total probe versus the average predicted value of 1.8% if binding occurred independently and randomly. This indicates that generation of the higher-order DNA-protein complex was enhanced by cooperative binding interactions.
Ternary complex formation and transactivation depend on the close proximity of the NeuroD1 and Sp1 binding sites. We examined DNA-protein complexes generated with the secretin enhancer probe and nuclear extracts from HIT cells by EMSA to determine if a similar ternary complex is formed with proteins in crude nuclear extracts as described with purified proteins. A number of DNA-protein complexes were identified, including one that consisted of several complexes that were not well resolved on the gel (complex II) (Fig. 3A, lane 1). A consensus wild-type Sp1 oligonucleotide but not a mutant oligonucleotide completely competed a slowly migrating band (complex I), as well as complex III, and partially competed complex II (Fig. 3A, lane 2 versus lane 3). An Sp1 antibody completely supershifted the slowly migrating complex I and reduced the amount of the broad complex II, suggesting that Sp1 was present in complex I and probably in complex II (Fig. 3B, lane 3). Complex III was minimally altered by the Sp1 antibody, suggesting that it may contain another protein with an affinity for GC-rich sequences.
![]() View larger version (47K): [in a new window] |
FIG. 3. Presence of NeuroD1 and Sp1 in a higher-order DNA-protein complex formed from nuclear extracts. Shown are results of an EMSA of factors in HIT cell nuclear extract binding to the secretin promoter regions containing the E-box and adjacent Sp1 binding site. (A) Effect of competition with unlabeled oligonucleotides for an Sp1, mutant Sp1 site, or E-box on ternary complex formation. (B) Presence of Sp1 and NeuroD1 in the ternary complex. Antibodies to NeuroD1 (lane 2) or E12 (lane 5) reduced the slow-migrating complex. Sp1 antibody (lane 3) supershifted the ternary complex. (C) EMSA showing that probes with increased spacing between the E-box and Sp1 binding site cannot generate the ternary complex from nuclear proteins extracted from HIT cells (lanes 2 and 3). (D) Effect of spacing (6 or 10 bp) between the E-box and the adjacent Sp1 binding site on secretin gene transcription. Luciferase activity of the insertion mutants is expressed as a percentage of activity of the wild-type reporter gene transfected in HIT (white bars) or STC-1 (black bars) cells. Results are shown as the means ± standard errors of the means for at least four independent experiments. Significant differences from the wild type are shown by an asterisk (P < 0.001). WT, wild type.
|
To determine if transcriptional activation also was dependent on the proximity of the E-box to the Sp1 binding site, we compared the activity of reporter genes where the spacing between the E-box and the adjacent Sp1 binding site in the secretin promoter was increased by either 6 bp or 10 bp versus the wild-type secretin-reporter in two secretin-expressing cell lines, HIT cells and STC-1 cells. Insertion of either 6 bp or 10 bp significantly reduced the transcriptional activity of the enhancer in both cell lines, indicating that the position of the E-box adjacent to the Sp1 binding site was necessary for maximal transcription of the gene (Fig. 3D). Thus, increasing the spacing between the two sites both reduced transcription and prevented formation of the higher-order complex, suggesting that generation of the ternary complex may be required for maximal transcription.
Sp1 physically associates with NeuroD1. The spacing between the E-box and GC1 box required for ternary complex formation and maximal enhancer activity suggested that NeuroD1 and Sp1 might physically interact with each other. We immunoprecipitated NeuroD1 from unfractionated extracts of HIT cells with NeuroD1 antibodies and tested for the presence of Sp1 by immunoblotting the precipitated proteins (Fig. 4A). Sp1 antibodies detected a single band in the NeuroD1 immunoprecipitates (lane 3) but not proteins precipitated by control immunoglobulin G (IgG) (lane 2), indicating that Sp1 and NeuroD1 associate at their native levels. To rule out the possibility that DNA present in extracts led to an artifactual association between NeuroD1 and Sp1, we repeated the coimmunoprecipitation experiment with the HIT cell extracts following pretreatment with ethidium bromide (50 µg/ml) as described before (10). The interaction of NeuroD1 with Sp1 was not significantly changed by ethidium bromide, indicating that their interaction did not result from the presence of DNA (not shown). We expressed full-length Sp1 as a GST fusion protein and tested its ability to directly bind to NeuroD1 using in vitro binding assays. Labeled in vitro-translated NeuroD1 was retained on an affinity column containing full-length GST-Sp1, indicating that these two proteins directly interact with each other (Fig. 4B).
![]() View larger version (27K): [in a new window] |
FIG. 4. Physical association between Sp1 and NeuroD1. (A) Coimmunoprecipitation of Sp1 with NeuroD1 in HIT cells. Lane 1 shows 4% of the input used for immunoprecipitation. (B) Sp1 directly interacts with NeuroD1 but not its dimerization partner, E12, through zinc finger domains. 35S-labeled NeuroD1 (left) or 35S-labeled E12 (right) was incubated with GST or the indicated GST-Sp1 fusion proteins as indicated in panel C. NeuroD1 bound to fusion proteins was affinity isolated, subjected to SDS-PAGE, and detected by autoradiography. Input lanes were loaded with 10% of the labeled proteins used in the binding assay. (C) Structure of the Sp1 deletion mutants and summary of the results. (D and E) Identification of the Sp1 binding domain of NeuroD1. (D) Wild type or different 35S-labeled NeuroD1 mutants bound to GST-Sp1 (amino acids 622 to 788) were affinity isolated and separated by SDS-PAGE (left panel). Input (right panel) lanes were loaded with 10% of the labeled proteins used in the binding assay. (E) Structures of the NeuroD1 deletion mutants. WT, wild type; ND, NeuroD1.
|
To determine the domain of NeuroD1 necessary for interaction with Sp1, we tested the GST-Sp1 fusion containing the C-terminal 167 amino acids (GST-Sp1622-788) for its ability to bind to different truncation/deletion mutants of NeuroD1. The 158 amino acids at the N terminus of NeuroD1 were sufficient for binding to Sp1 (Fig. 4D and E). The inability of the mutant
49/155 to bind Sp1 indicates that the N terminus of NeuroD1, which contains the bHLH domain, is necessary for Sp1 binding, whereas the C-terminal activation domain of NeuroD1 does not appear to be involved. The NeuroD1 deletion mutants
49/96 and
113/128 retained the ability to bind to Sp1, suggesting that the deleted acidic and basic domains and helix 1 were not required. A final NeuroD1 truncation, N138, which retained 138 residues at the N terminus but lacks helix 2, was unable to bind to Sp1, suggesting that sequences in helix 2 of the bHLH domain of NeuroD1 are essential for its association with Sp1 (Fig. 4D and E).
Sp1 binding to the secretin enhancer is stabilized in Sp1-NeuroD1 ternary complex. To determine whether the binding cooperativity between NeuroD1 and Sp1 arises from stabilized DNA binding of either protein in the presence of the other, we compared the relative stability of the ternary complex compared to complexes generated by Sp1 or NeuroD1/E12 alone by EMSA. In order to better resolve the ternary complex from the complexes generated by either Sp1 alone or NeuroD1/E12, we used the truncated GST-Sp1622-788 fusion protein that contains both the DNA binding and NeuroD1-interacting domains of Sp1. The truncated Sp1 protein by itself generated a fast-migrating DNA-protein complex (complex iii, Fig. 5A, lane 2) that was easily resolved from the slower-migrating complex produced by NeuroD1/E12 (complex ii, Fig. 5A, lane 1). A more slowly migrating complex appeared with NeuroD1/E12 and GST-Sp1622-788 (complex i) (Fig. 5A, lane 3), suggesting that the truncated Sp1 protein could form the ternary complex as well. All three complexes (i, ii, and iii) were competed by an excess of unlabeled competitor containing the contiguous E-box and Sp1 binding site added to the probe prior to the binding reaction, indicating that all complexes resulted from sequence-specific DNA binding (lane 4).
![]() View larger version (25K): [in a new window] |
FIG. 5. Stabilization of Sp1-DNA binding in the ternary DNA-protein complex with NeuroD1. (A) EMSA performed with indicated recombinant proteins and a probe containing the contiguous E-box and Sp1 binding site. Slower-migrating complex i represents the ternary DNA-protein complex (lane 3) whereas complexes ii (lanes 1 and 3) and iii (lanes 2 and 3) were generated by NeuroD1-E12 and Sp1, respectively. All three complexes were competed by a 100-fold molar excess of the unlabeled probe added to the probe prior to the binding reaction. (B) An EMSA where a 500-fold molar excess of unlabeled oligonucleotide competitor was added after the probe and proteins reached equilibrium. Aliquots were removed at 4-minute intervals and quickly loaded onto an acrylamide gel for electrophoresis. (C) Time course of dissociation of DNA-protein complexes. The percentage of probe remaining in complexes with Sp1 alone (complex iii), with NeuroD1-E12 (complex ii), or with NeuroD1-E12-Sp1 (complex i) was quantitated by phosphorimaging and plotted relative to the zero time point. Results are shown as the means ± standard errors of the means for three separate experiments. *, significantly different (complex iii in comparison to complex i or complex ii; P < 0.01).
|
To determine whether NeuroD1 stabilizes Sp1 binding to the secretin promoter in vivo, we examined the effects of NeuroD1 on chromatin occupancy of the secretin enhancer by Sp1. As expected ChIP assays revealed no occupancy of the secretin enhancer by NeuroD1 in HeLa cells, which do not normally express NeuroD1 (Fig. 6A, top panel, lane 5). However, in HeLa cells transfected with a NeuroD1 expression plasmid we readily identified the presence of NeuroD1 at the secretin enhancer in vivo (top panel, lane 10) but not at the DHFR promoter, which lacks a NeuroD1 binding site (bottom panel, lane 10), indicating that transiently expressed NeuroD1 was associated with the endogenous secretin gene.
![]() View larger version (50K): [in a new window] |
FIG. 6. NeuroD1 facilitates interaction of Sp1 with the secretin enhancer. (A) Recruitment of transiently expressed NeuroD1 to the endogenous secretin promoter in HeLa cells. ChIP experiments were performed using soluble chromatin fragments prepared from HeLa cells transfected with an expression plasmid for E12 in the absence (–) or the presence (+) of a NeuroD1 expression plasmid. DNA purified from the chromatin input or the immunoprecipitate ( -NeuroD1 or control IgG) was amplified by PCR for 32 cycles with primers covering the secretin promoter (–284 to –57) (top panel) or a control promoter (–310 to +17 of human DHFR) (bottom panel). (B) Effect of NeuroD1 on recruitment of Sp1 to the secretin promoter in vivo. ChIP experiments were performed with anti-Sp1 antibody ( -Sp1) as described for panel A. The human GAPDH gene served as a negative control (right).
|
We further confirmed the importance of NeuroD1 for occupancy of the secretin promoter by Sp1 in vivo in NeuroD1-expressing STC-1 enteroendocrine cells by knocking down NeuroD1 expression by DNA-based RNA interference using a previously described NeuroD shRNA (6). We used transient ChIP assays (11) to examine occupancy of a transiently transfected secretin promoter by endogenous NeuroD1 or Sp1. Both Sp1 and NeuroD1 were recruited to the wild-type promoter but not to a mutant promoter containing mutations in the E-box and both Sp1 sites (MutE/GC) that prevent binding of either factor to DNA (Fig. 7A, lanes 5 and 6). Introduction of mutations into the Sp1 binding sites of secretin promoter slightly reduced NeuroD1 occupancy, suggesting that Sp1 DNA binding is not essential for NeuroD1 recruitment to the promoter (Fig. 7A, lane 6).
![]() View larger version (22K): [in a new window] |
FIG. 7. Depletion of NeuroD1 in STC-1 cells reduces recruitment of Sp1 to the secretin promoter. Shown are results of transient ChIP assays for transfected secretin and hTERT promoters. (A) Sp1 and NeuroD1 occupancy of the wild-type secretin promoter (top panel), a secretin promoter with mutations in the Sp1 binding sites (MutGC; middle panel), and a mutant (MutE/GC) secretin promoter lacking Sp1 and NeuroD1 binding sites (bottom panel) in STC-1 cells. (B) Effect of NeuroD1 depletion on transient ChIP of Sp1 and NeuroD1 in STC-1 cells cotransfected with a plasmid containing the secretin promoter (left) or hTERT promoter (right). Cells were cotransfected with either shRNA plasmids for NeuroD1 or GFP as a control. The final DNA extractions were PCR amplified for detection of the transfected promoters using pairs of primers described in Materials and Methods. (C) Effect of NeuroD1 depletion on transcription of a secretin reporter gene in STC-1 cells cotransfected with shRNA plasmids for NeuroD1 and GFP as indicated. Results are shown as the means ± standard errors of the means of at least three separate experiments. *, significantly different from control or GFP shRNAs (P < 0.01).
|
|
|
|---|
Cell-type-specific gene expression depends on the presence of a combination of transcription factors, some of which are also highly restricted in expression, as well as the organization transcription factor binding sites controlling a gene. The proximal enhancer of the secretin gene is conserved in different mammalian species, maintaining a nearly identical arrangement of four cis regulatory elements including the E-box and immediately adjacent Sp1 binding site. The close proximity of these two sites appears to be essential for the synergism between Sp1 and NeuroD1. Finb/RREB1, which binds to sequences upstream of the E-box, appears to be an unusual class of transcription-modifying protein. Although Finb/RREB1 is present in corepressor complexes with CtBP (31), it serves to potentiate NeuroD1-dependent transcription despite the absence of an intrinsic activation domain or any direct activation of transcription by itself. In contrast to coactivators, Finb must bind to DNA to modify the activity of NeuroD1.
The interaction of NeuroD1 with Sp1 through regions close to the DNA binding domain of each protein may in part explain why synergistic transcriptional activation depends on the adjacent positions of the E-box and Sp1 binding sites. This interaction results in cooperative DNA binding and stabilized Sp1 DNA binding in the resultant ternary DNA-protein complex with NeuroD1 and E12.
The promoters of several muscle-specific genes including the regulatory region of human cardiac alpha-actin promoter and troponin I promoter have Sp1 binding sites in close proximity to E-boxes that bind to myogenic bHLH proteins (1, 14). The HLH domain of the myogenic bHLH protein myogenin, like NeuroD1, physically associates with the C-terminal zinc finger domain of Sp1. However, it is not known whether myogenin and Sp1 increase transcription of the cardiac actin promoter in an additive or synergistic manner. In this promoter, the E-box and Sp1 site are separated by an additional 10 nucleotides, or approximately one complete helical turn, compared to the secretin enhancer. Introduction of 10 additional nucleotides between the secretin gene E-box and the adjacent Sp1 site abrogated their synergistic effects on transcription.
Besides the secretin gene, relatively few target genes that are directly activated by NeuroD1 have been identified. These include the genes encoding the hormones insulin and POMC. Expression of both of these genes depends on interactions between bHLH proteins with lineage-restricted homeodomain transcription factors bound to nearby cis elements to potentiate the transactivating function of NeuroD1.
Lineage-specific transcription of the POMC gene in the pituitary gland is enhanced by the functional synergy between bHLH factors binding to an E-box and the pituitary gland-specific homeodomain protein Pitx-1 (25). Pitx-1 indirectly modifies NeuroD1-dependent transcription by physically interacting with one of its ubiquitously expressed dimerization partners rather than by a direct association with NeuroD1. The bHLH domain of Pan1 (E47) serves as a protein-protein interaction domain with the homeodomain of Pitx-1. The NeuroD1 binding E-box in the POMC promoter is separated from the Pitx-1 binding site by 67 bp. This spacing may indicate that the interactions on the POMC promoter involve different surfaces of the bHLH proteins than in the case of the insulin and secretin promoter, where Pdx1 and Sp1 bind to sites immediately adjacent to the E-box.
Insulin-expressing pancreatic ß cells arise from the primitive gut endoderm and are developmentally related to enteroendocrine cells, and yet insulin gene expression does not occur in the intestine. The expression of insulin and secretin genes, two NeuroD1-dependent genes, in distinct cell types depends in part on the expression of different sets of transcriptional activators in islets versus enteroendocrine cells and on the organization of transcription factor binding sites on each promoter. The major elements responsible for ß-cell-specific transcription of the insulin gene are localized to a relatively small region of the promoter that contains an E-box and two TAAT-rich A elements that bind to the homeodomain protein PDX-1. In developing animals, PDX-1 is expressed throughout the proximal duodenum and the pancreas, but intestinal expression is largely absent in adult animals, whereas expression in islets continues.
The homeodomain of PDX-1 associates with several other proteins including E47, NeuroD1, and high-mobility-group protein Y1 to form a higher-order transcription-activating complex (24). Unlike the specific interaction between NeuroD1 and Sp1 on the secretin gene, PDX-1 interacts with the ubiquitous dimerization partners of NeuroD1 as well as with NeuroD1. In the case of the insulin gene, synergistic transcriptional activation occurs with E47 as well as NeuroD1. In addition, high-mobility-group protein Y1 synergizes with the other members of the insulin gene-transactivating complex. The absence of PDX-1 in adult enteroendocrine cells may explain in part why insulin is not expressed in the intestine. Thus, NeuroD1-dependent expression of the insulin and secretin genes in pancreatic ß cells and S-type enteroendocrine cells, respectively, depends on different sets of transcription factors that interact with NeuroD1 to potentiate its activity.
NeuroD1 plays an important role in regulating terminal differentiation of neurons and hormone-producing cell lineages. Relatively few target genes have been identified for this bHLH protein. Other DNA binding proteins potentiate transactivation of the genes encoding the hormones POMC, insulin, and secretin by NeuroD1. The enhancer of the secretin gene shares little with the organization of the insulin or POMC genes. Unlike the POMC and insulin genes, where NeuroD1 synergizes with homeodomain proteins specific for their tissue, NeuroD1 synergizes with the widely expressed proteins Sp1 and RREB1 to increase secretin gene transcription. The specific arrangement of factor binding sites in the secretin enhancer provides the critical context for the interaction with Sp1 and Finb that potentiates the activating function of NeuroD1.
We thank Hans Rotheneder (University of Vienna, Vienna, Austria) and Yang Shi and Azad Bonni (Harvard Medical School, Boston, MA) for generously providing plasmids as noted in Materials and Methods.
Published ahead of print on 17 September 2007. ![]()
|
|
|---|
-actin promoter. Mol. Cell. Biol. 19:2577-2584.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»