![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article 
Molecular and Cellular Biology, December 2007, p. 8049-8064, Vol. 27, No. 23
0270-7306/07/$08.00+0 doi:10.1128/MCB.00680-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
,
Fabian Preuss,,
Jin-Yuan Fan,
Edward S. Bjes, and
Jeffrey L. Price*
School of Biological Sciences, Division of Molecular Biology and Biochemistry, University of Missouri-Kansas City, Kansas City, Missouri 64110
Received 18 April 2007/ Returned for modification 25 May 2007/ Accepted 4 September 2007
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
DBT, an ortholog of mammalian casein kinase I
and casein kinase I
(CKI/), regulates PER cytoplasmic and nuclear accumulation by triggering PER's degradation and regulating the timing of its nuclear accumulation (3, 8, 9, 22, 23, 43, 46, 49). DBT's activity on PER is supplemented by the activity of CKII (2, 27, 28) and SGG (31) and is antagonized by a rhythmically expressed protein phosphatase (47). DBT may regulate other aspects of PER function (35) and other circadian proteins (e.g., dCLK) as well (21, 58). At present, a comprehensive understanding of DBT's effects on PER and other clock proteins is lacking.
Intriguingly, a dbt mutation conferring a short-period phenotype (dbtS) and dbt mutations conferring a long-period phenotype (dbtL, dbtG, and dbtH) all produce lowered kinase activity in vitro when introduced into orthologous CKIs (41, 49). This suggests that both short and long periods can be produced by lowered kinase activity. Analysis of phosphorylation by mammalian CKI has also suggested this idea. A mutation in CKI in hamsters (the tau mutation [30]) and a mutation in CKI causing a sleep disorder in humans (55) both produce short periods and have been shown to hypophosphorylate their substrates in vitro. By contrast, it has been shown that CKI inhibition produces long periods in mammalian cell culture rhythms (11). These results may point to complexity of kinase target sites, with phosphorylation at some sites lengthening the period and at other sites shortening it. Differential effects on various target sites in PER may explain the different effects of the Drosophila dbtS and dbtL mutations on the circadian period (41, 43). Alternatively, the dbtS and dbtL mutations may produce their period effects through some means other than by altering kinase activity. Since DBT forms a complex with PER and other clock proteins, such as dCLK (21, 58), some of its functions may be independent of its kinase activity and be attributable to associations that it forms with other proteins. It is not certain that the effects of the dbtS and the dbtL mutations are limited to effects on kinase activity.
It would therefore be interesting to know if short and long periods can be produced by mutations which only produce lower kinase activity. In this paper, we investigate the effect on the clock of a mutant form of DBT which is normal except that it lacks any detectable kinase activity. A mutation which specifically eliminates DBT kinase activity and not other aspects of its function has never been analyzed in the adult fly. To avoid lethality, our kinase-inactive transgenic protein was expressed only in circadian cells in flies that also expressed wild-type DBT (DBTWT) from the endogenous gene, and therefore the flies (and even the cells that expressed the kinase-inactive DBT) were viable. In addition to addressing the relationship between kinase activity and the circadian period, this mutant has allowed us to address more generally whether kinase activity is required for DBT's role in the circadian mechanism. If kinase activity is necessary for clock function of DBT and the kinase-inactive form of DBT could be expressed at high enough levels to effectively out-compete DBTWT for stable interactions with clock protein substrates, it should effectively block DBTWT activity in the clock mechanism and act as a dominant negative mutant. Alternatively, overexpression of this mutant DBT protein should produce the same effect as overexpression of DBTWT for any DBT function that does not require its kinase activity. The results presented here demonstrate that we have created a dominant negative dbt mutation and that its overexpression reduces endogenous DBT-dependent PER phosphorylation and degradation, with consequences for both molecular and behavioral circadian rhythms.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
GST pull-down assays. The DBTK/R-coding region was amplified by PCR from the pMT-DBTK/R-MYC plasmid described above, with the forward primer DBT 1f (GCGCGAATTCATGGAGCTGCGCGTGGGTAAC, containing an EcoRI site) and the reverse primer DBT 5'R (described above). A fragment resulting from digestion with ClaI and EcoRI was purified and then ligated into the ClaI- and EcoRI-digested pGEX-GST-DBTWT plasmid, which was previously described (41).
Bacteria expressing glutathione S-transferase (GST), GST-DBTWT, or GST-DBTK/R were grown and induced with isopropyl-ß-D-thiogalactoside (IPTG). GST pull-down assays and analysis were performed as previously described (41).
Expression of proteins in S2 cells. Generation of the per expression plasmid (pAC-PER-HA) and the wild-type pMT-DBT-MYC and pAC-LacZ-V5 plasmids was previously described (7, 41), and generation of the pMT-DBTK/R-MYC expression plasmid is described above. The plasmids expressing the MYC-tagged DBTs, V5-tagged LacZ, or hemagglutinin (HA)-tagged PER were transfected into Drosophila S2 cells with Cellfectin, as described by the supplier of Cellfectin (Invitrogen, Carlsbad, CA). A total of 1.9 µg of the pAC-PER-HA-expressing plasmid and 0.7 µg of the pAC-LacZ-V5-expressing plasmid were used for each transfection. Low levels of DBT-MYC were produced with 0.2 µg of plasmid, 5 ml of cells in the transfection, and 0.05 mM CuSO4 in the growth medium. Medium levels were produced with 0.2 µg of plasmid and 0.5 mM CuSO4, and high levels were produced with 1.9 µg of plasmid and 0.5 mM CuSO4. When the DBT protein carrying the K38R mutation (DBTK/R) was coexpressed with DBTWT in the same cells, the amounts of DBTWT plasmid and CuSO4 were the same in the three treatments just described, but the amount of DBTK/R plasmid was increased to 7.6 µg. An empty pMT vector containing no dbt gene was also used in the transfections in various amounts so that the total amount of plasmid transfected in all experiments equaled 4.5 µg (or 12.1 µg for DBTWT and DBTK/R cotransfections). At 42 h after the addition of CuSO4, the cells were collected and further processed for immunoprecipitation of DBT-MYC or DBTK/R-MYC or for immunoblot analyses (see below).
Drosophila S2 cells were also stably transfected with pMT-DBTWT-MYC or pMT-DBTK/R-MYC and pBS-PURO as described above. Selection was accomplished in Schneider's Drosophila medium plus L-glutamine (Invitrogen) supplemented with 10% fetal bovine serum and 10 µg/ml puromycin.
Kinase assays. Immunoprecipitation of DBT-MYC or DBTK/R-MYC from S2 cells was done as previously described (41), except that the transfected cells were homogenized in the lysis buffer with 5 µg of pepstatin/ml and 20 µg of aprotinin/ml, and the lysate was immunoprecipitated with a monoclonal anti-MYC antibody (MMS-150R from Covance Research Products, Berkeley, CA) at a concentration of 1:150. Immunoprecipitated DBTWT-MYC or DBTK/R-MYC was detected with a rabbit anti-DBT antibody generated to a GST-DBT C-terminal immunogen containing amino acids 293 to 440. The amounts of DBT used in the assays were detected by immunoblot analysis using the anti-DBT C terminus antibody at a concentration of 1:2,000. Kinase assays were done as previously described (41). For purification of the PER substrate, bacteria harboring PQE-PER (27) (generously provided by Ravi Allada) were induced with 1 mM IPTG, and PER was purified by Ni affinity chromatography as described by the supplier of the beads (Ni-nitrilotriacetic acid agarose from Invitrogen, Carlsbad, CA). Casein and PER phosphorylation were detected by phosphorimager analysis (Molecular Dynamics-GE Healthcare, Sunnyvale, CA) of gels containing 32P-labeled substrates, and the activities were normalized to the amount of DBT-MYC detected by chemifluorescence detection of the MYC epitope (ECL Plus Western blotting detection reagents; Amersham-GE Healthcare, Piscataway, NJ). Both signals were corrected for background by subtracting the signal from the same region of the "no-DNA" lane.
Quantification of protein expression in S2 cells. After 42 h of induction with CuSO4, the cells were harvested and immunoblotted as previously described (7). Individual bands were quantified by a quantitative line analysis of the scans, using a chemifluorescence imager and the ImagQuant 5.0 software program (Molecular Dynamics-GE Healthcare, Sunnyvale, CA). Briefly, the line analysis was performed by drawing a line through the entire length of the lane, followed by configuration of the width attributes to include the width of the lane. A graph representing the pixels within the defined area of the lane was created by the peak finder analysis. The peak area, corresponding to a protein signal, was defined by manually inserting two lines flanking the peak at the inflection points for both the ascending and descending lines. The value of the area in an equivalent length of a control lane expressing no protein was subtracted from this peak area to generate a background-corrected area value. These values representing the pixel areas beneath the peak for the PER signal were then normalized to the LacZ-V5 signal for the respective sample, which was quantified in a similar way. The final normalized PER/LacZ values for each lane were then normalized to the level of PER/LacZ without any DBT expression, which was defined as 100%. Three separate transfection experiments were done for Fig. 3B and three for Fig. 3D, and each experiment was analyzed two to four times by immunoblotting to generate average PER/LacZ percentages for each experiment. The percentages from the individual experiments were averaged to generate values from which the graphical representations of protein levels were generated (see Fig. 3B and D).
|
For our analyses, three different GAL4 driver lines were employed to express the UAS-DBT transgenes. One line expresses the GAL4 transcription factor in all cell types because it expresses gal4 under the control of the actin promoter {yw;P(w[+mC] = Act5C-GAL4)25F01/CyO, y+} (from the Bloomington Stock Center, Indiana University; stock number 4414). In one line, expression was limited to all circadian clock cells, because GAL4 expression was dependent on the activity of the timeless promoter {yw;P(w[+mC] = GAL4-tim.E)62} (from the Bloomington Stock Center; stock number 7126) (20). The third line (kindly provided by Justin Blau, New York University) also contained a UAS, so that GAL4 expressed in tim-expressing cells would then autoactivate its own expression (4).
Entrainment conditions, fly collection procedures, and locomotor activity assays. All flies were raised at 23.5°C with 12-h:12-h light-dark (LD) cycles provided by cool white fluorescent bulbs (ca.3,000 lx during the photophase) for at least 3 days. For analysis of PER and DBT, progeny were placed in vials containing 15 to 30 flies each, followed by entrainment for at least 72 h to a 12-h:12-h LD cycle at a constant temperature of 23.5°C (All flies for immunoblot analysis of whole bodies were males, while both females and males were selected for immunoblot or immunohistochemical analysis of heads.) Depending on the experimental conditions, the vials were placed in LD or constant-darkness (DD) conditions and collected at the indicated time point (zeitgeber time [ZT], indicating the presence of the light cue [LD], or circadian time [CT], indicating the absence of any entrainment cue [DD]). Flies collected during DD were collected during the first day of DD, starting at CT1. Flies either were quickly frozen using liquid nitrogen and stored at –80°C for immunoblot analysis of whole bodies or were directly processed for analysis of photoreceptors, heads, or larval brains. For locomotor activity analysis, individual flies were loaded into glass cuvettes, placed in monitoring devices linked to a computer recording the movement of each individual (Trikinetics, Inc., Waltham, Mass.), and monitored as previously described (3). Using analytic software (ClockLab, Inc., Evanston, IL), the average period length of each fly was determined by chi-square periodogram analysis, and the overall activity pattern across the recorded time period (actogram) was used to confirm rhythmic or arrhythmic behavior of each tested individual. Rhythmic flies produced a single major periodogram peak with a P value of <0.01 and produced discernibly rhythmic actograms.
In vivo immunoblot analysis. After completion of the collection series, frozen bodies were homogenized in 7.5 µl 2x sodium dodecyl sulfate (SDS) Laemmli gel loading buffer per fly with a Kontes pellet pestle homogenizer, incubated at 95°C for 5 min, and diluted by addition of 75 µl 1x SDS buffer. For quantification of PER and DBT-MYC in head extracts, heads were removed with a razor blade, homogenized with 3.2 µl of 1.1x SDS Laemmli gel loading buffer per head, and heat treated; 3 to 5 µl of extract was analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblotting. Depending on the experimental setup immunoblot analysis was performed using a 1:5,000 dilution of anti-MYC antibody (Invitrogen, Carlsbad, CA), a 1:2,000 dilution of rabbit anti-DBT antibody (see above), or a 1:25,000 dilution of a rabbit anti-PER antibody generated to the PQE-PER antigen described above. A 1:5,000 dilution of mouse monoclonal antitubulin antibody (Developmental Studies Hybridoma Bank, Iowa City, IA) was included with the anti-MYC and anti-DBT antibodies. Incubation with primary antibodies was followed by incubation with a 1:5,000 dilution of the appropriate horseradish peroxidase-labeled secondary antibodies and visualization of the signal with the ECL Plus Western blotting detection reagents (Amersham-GE Healthcare, Piscataway, NJ). Experiments were repeated two or three times, with multiple immunoblots for each.
Immunohistology. The heads of the flies were collected and processed as previously described (3). Scores between 0 and 2 (indicating the relative intensity of nuclear localization of PER) were assigned for each photoreceptor section examined. Larval brains were collected from tim-GAL4>UAS-DBT larvae after entrainment of the larvae and were processed as previously described for detection of PER and PDF (43). Our rabbit anti-PER was used at a dilution of 1/5,000, while anti-PDF (kindly deposited by Justin Blau in the Developmental Studies Hybridoma Bank, University of Iowa) was used at 1/1,000. Secondary antibodies were Alexa-Fluor 488 anti-rabbit immunoglobulin G and Alexa-Fluor 568 anti-mouse immunoglobulin G (Invitrogen, Carlsbad, CA). Z-stacks were acquired on a Zeiss confocal LSM 410 with a 40x water immersion lens and a 4x zoom.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
carrying the K38R mutation had been shown to antagonize the Wnt pathway in Xenopus, guided this effort. Mutation of this site was chosen for the creation of a DBT dominant negative mutant because (i) this amino acid is modified by a reagent which inactivates several kinases (19, 61), (ii) the amino acid contacts the phosphates of ATP in the crystal structure of casein kinase I (54), (iii) numerous amino acid changes (including K to R) at this site have previously been shown to produce dominant negative mutants in other kinases (18, 39), and (iv) we had previously analyzed the Xenopus CKIK/R mutant form of this protein employed by Peters et al. (39) in vitro and showed that it lacked detectable kinase activity on PER or casein substrates (7). Therefore, it is likely that K38 makes direct contact with ATP and is involved in the phosphotransferase reaction (18). K38 and the surrounding region are conserved in Drosophila DBT and vertebrate CKI/ (Fig. 1A), and a K/R mutation was introduced into the corresponding site of DBT by site-directed mutagenesis. Mutation of K to R was chosen because it is a very conservative change and would not be predicted to have global effects on protein structure but rather to impair the specific catalytic steps involving ATP.
|
To address whether the K38R mutation affected DBT's intrinsic kinase activity, DBTWT-MYC and DBTK/R-MYC immunoprecipitated via their MYC epitopes from S2 cells were assayed in vitro with casein and PER as substrates. (Purification of recombinant DBT from Escherichia coli would not have been informative, since we and others have previously shown that DBTWT expressed in bacteria is not enzymatically active [23, 41, 49].) The MYC-tagged DBT was expressed in S2 cells from transiently transfected plasmids (Fig. 2A) or in S2 cells which had been stably transformed with these plasmids and therefore produced higher transgene-specific kinase activity relative to the background kinase activity in cells which did not carry the dbt transgene (Compare Fig. 2A with Fig. 2B and C). Following immunoprecipitation, immunoblot analysis showed successful recovery of DBT proteins (top panels in Fig. 2A to C) except in cells that did not carry the transgene. Endogenous DBT, which produces a faster-migrating band with the antibody used for the immunoblot (e.g., see Fig. S1A in the supplemental material), is not detected in any of the immunoprecipitates and therefore did not contribute significantly to the kinase activity. As previously shown (41), DBTWT-MYC readily phosphorylates casein, the nominative substrate for casein kinases (Fig. 2A and B). While not as good a substrate, recombinant PER purified from bacteria by affinity chromatography was also phosphorylated by DBTWT-MYC, by comparison with the activity exhibited with immunoprecipitates from no-DNA controls (Fig. 2C). In contrast to DBTWT, immunoprecipitates containing mutant DBTK/R-MYC protein produced no increased phosphorylation of casein or PER relative to the negative controls, even when present at comparable or even larger amounts than DBTWT-MYC (as detected by immunoblot analysis of reaction aliquots [Fig. 2A to C]). The absence of detectable kinase activity for DBTK/R was confirmed by quantification of multiple independent assays comparing DBTWT and DBTK/R, with activities normalized to the amount of DBT-MYC in the assays (Fig. 2D) (note that subtraction of background signal from "no-DNA" lanes produced negative values for some DBTK/R assays). These results demonstrate that the K38R mutation in DBT eliminated the intrinsic casein kinase activity of DBT (Fig. 2) without affecting its capacity to interact with its substrate PER (Fig. 1).
|
In order to function as a dominant negative mutant in this assay, DBTK/R must antagonize the phosphorylation and degradation of PER by DBTWT. Since our GST pull-down assays showed that DBTK/R can associate stably with PER, it seemed likely that an excess of DBTK/R in S2 cells would antagonize DBTWT by titrating PER and preventing its interaction with DBTWT. Therefore, the possibility that DBTK/R might function as a dominant negative mutant was assessed in S2 cells by coexpressing DBTWT with an excess of DBTK/R. As in the experiments shown in the previous section, PER levels decrease when DBTWT levels increase from low to high (Fig. 3C, lanes 1 to 4). To address whether the K38R mutation could antagonize DBTWT-mediated degradation of PER, we contransfected S2 cells with both pMT-dbtWT and an excess of pMT-dbtK/R plasmids. Results from immunoblot analyses of S2 cell lysates show that the low, medium, and high levels of DBTWT coexpressed with higher levels of DBTK/R sustain high levels of hypophosphorylated (i.e., high-mobility) PER compared to DBTWT expressed alone (Fig. 3C). There is no substantial decline in PER levels normalized to LacZ under these conditions (Fig. 3D; results are for three experiments, each assayed two times). Taken together, the results from these experiments (Fig. 1 to 3) establish DBTK/R as a dominant negative mutant in S2 cells. Not only does it lack kinase activity and the capacity to target PER for degradation, but it also prevents DBTWT from phosphorylating and degrading PER, most likely by competing with DBTWT for access to the PER substrate.
Overexpression of DBTWT, DBTS, or DBTL phenocopies the corresponding alleles of the endogenous gene. To overexpress various DBT proteins in vivo, our mutant dbt genes were inserted into the genomes of flies under control of a yeast UAS, which activates expression of the linked dbt gene (the responder) when a separate transgene expressing the yeast GAL4 transcription factor (the driver) is also present (5). Transformant flies were crossed to GAL4 driver lines to generate flies with both a driver and a uas-dbt responder. A priori, expression of mutant and DBTWT with this approach might have caused apoptosis, necrosis, or developmental abnormalities due to high levels of expression, improper localization, or nonspecific targeting of substrates. However, expression of DBTWT in neurons and circadian cells did not produce lethality or any obvious external defects, and expression of DBTWT with an actin-GAL4 driver produced normal-looking flies, albeit at lower than expected Mendelian ratios (J. L. Price, M. J. Muskus, and A. Venkatesan, unpublished data).
Locomotor activity, which is similar to human sleep/wake cycles and is controlled by the circadian clock, was assayed as a behavioral test for effects on the circadian clock. Table 1 summarizes the locomotor activity results with flies carrying two different GAL4 drivers expressing DBTWT in all known circadian cells, along with the results from control flies carrying only the GAL4 driver or the UAS-DBT responder. A representative activity record (actogram) and period analysis (periodogram) are shown in Fig. 4 for each fly genotype discussed here. tim-GAL4>UAS-DBT flies from five different wild-type lines with different UAS-DBT transgene insertion sites exhibit almost-wild-type periods ranging from 24.2 to 24.9 h (Table 1). There is a tendency for the periods to be longer than those of nonexpressing controls (e.g., UAS-DBTWT/+ flies or tim-GAL4/+ flies; see also reference 55), but the period is at most under an hour longer. The tim-UAS-GAL4 is a driver construct in which expression of GAL4 is controlled both by the timeless and the UAS promoter (4). This allows timeless-independent expression once GAL4 has been activated, since the GAL4 will feed back on its own promoter, keeping the UAS promoter active even if the circadianly regulated timeless promoter shuts off or oscillates in its expression (although we did not detect any variation in transgenic tim-GAL4>DBT-MYC levels throughout the day [see Fig. S1A and S1B in the supplemental material]). However, even with this self-maintaining enhancer, the tim-UAS-GAL4>UAS-DBTWT flies tested (with transgene 45F2B) did not show any major effect of DBT on their locomotor behavior (Table 1). Many of the tim-GAL4>UAS-DBT flies showed reduced rhythmicity compared with the nonexpressing controls, but the reduction is variable over a wide range, and therefore it may result from fairly indirect effects of DBT overexpression.
|
|
Both dbtS and dbtL have been shown to act as semidominant mutations in flies (43), but their mechanisms of action are unclear. One possibility was that the dbtS mutation produced an excess of otherwise DBTWT protein, while the dbtL mutation produced a deficit. However, this possibility was not supported by standard complementation tests, which instead suggested that these mutations altered some aspect of DBT protein function (43). In the dbtS/dbtWT and dbtL/dbtWT genotypes, it was proposed that the mutant protein was competing with the wild-type protein for access to substrate, thereby producing a period phenotype intermediate between those of wild-type and dbt mutant flies.
We tested the dominance of the dbtS-myc and dbtL-myc transgenic constructs in flies by driving expression with tim-GAL4. If the transgenic DBT mutant protein were expressed at a high enough level, the transgenic DBT mutant protein should have been able to titrate DBTWT expressed from the endogenous gene and tilt the balance towards the mutant phenotype. In fact, the ectopically expressed mutant DBT proteins did precisely phenocopy the endogenous alleles of dbtS and dbtL. The dbtS and dbtL data in Table 1 and Fig. 4 support the hypothesis that DBTS and DBTL can completely replace endogenous DBTWT in complexes with PER and other clock proteins, if they are expressed at a high enough level. Locomotor assays of flies with the tim-GAL4>UAS-DBT or tim-UAS-GAL4>UAS-DBT genotype demonstrate that both dbtS and dbtL transgenes generate a dominant period alteration of the same magnitude as the one generated by the original homozygous mutants: 
18 h for dbtS/dbtS and 27 h for dbtL/dbtL, respectively (Fig. 4 and Table 1) (43). Furthermore, there is little intra- or interline variation in circadian period (note the small standard deviations and similar average periods in different lines). This intriguing finding again suggests that the period changes are caused by effects of the mutations on specific processes or functions of the protein rather than by alterations in the levels of kinase available. With high levels of hypomorphic transgenic kinase present, both DBTL and DBTS titrate the endogenous enzyme in clock protein complexes and change the period length of the fly by a set amount of hours equal to the period changes observed in homozygous genetic mutants, rather than exceed the changes of the original mutants. The production of higher levels of transgenic DBT than endogenous DBT and the fully penetrant dbtS and dbtL mutant phenotypes validate this binary expression approach for the analysis of the dbtK/R mutant phenotype.
Expression of a catalytically inactive DBT protein produces dominant negative effects in adult flies: arrhythmicity and very long periods. Since Drosophila DBTK/R does not phosphorylate PER in S2 cells and antagonizes the action of DBTWT in triggering PER degradation (Fig. 3), the possibility that DBTK/R might exert a general dominant negative effect on the clock in adult flies was examined with the same binary expression approach just described for DBTWT, DBTS, and DBTL. Ubiquitous expression of DBTK/R-MYC using an actin-GAL4 driver conferred high lethality when using a strong responder line (e.g., 1M1C, 12F1A, or 17M1B [data not shown]; there are a few escapers in flies with the weak responder 13F1A). Since strong loss-of-function dbt alleles produce embryonic lethality (60), this finding indicates that the DBTK/R can be a strong general dominant negative mutant in vivo and can therefore produce a null phenotype in an otherwise wild-type genotype.
To determine whether DBTK/R expression in clock cells would produce lethality or circadian phenotypes, we generated flies with both the UAS-DBTK/R transgene responder and the tim-GAL4 transgene driver, which would ultimately overexpress DBTK/R specifically in clock cells. Successful recovery of many flies with both transgenes (Table 1) indicates this combination is nonlethal. Furthermore, the viability of the clock cells, which include the eyes, is apparently normal, based on the normal external morphology of the eye (data not shown) and immunohistological analysis confirming the presence of tim-GAL4-expressing brain neurons and photoreceptors (see Fig. 6 and 7). The effects of tim-GAL4-mediated DBTK/R expression on circadian periodicity are shown in Table 1, with representative actograms and periodograms shown in Fig. 4. The data indicate that DBTK/R-MYC is capable of interfering with endogenous DBT and preventing proper clock function. Depending on the responder transgenic insertion site (four different lines with independent insertions), flies exhibit higher levels of arrhythmicity with the tim-GAL4 driver than do any of the other types of DBT responders (fewer than 20% rhythmic in two of the four lines tested) and/or variably long periods (28 to 35 h). In controls bearing only UAS-DBTK/R/+, the periods of the progeny were within the wild-type range (average, 24 h) and locomotor activity was highly rhythmic, indicating that tim-GAL4-dependent expression of UAS-DBTK/R is required for the effects on rhythms. All of the UAS-DBT lines (wild type, dbtS, dbtL, and dbtK/R) tabulated here were tested without outcross to a driver line, and all rhythmic flies had periods within the wild-type range (23 to 25 h), so the mutant periods require the presence of the driver and the responder in all lines (data not shown). As further evidence for this conclusion, no progeny which acquired the TM3 chromosome rather than the UAS-DBT chromosome (from UAS-DBT/TM3 parents) had a circadian period outside the normal circadian range, although in our hands the TM3 balancer is often associated with a high degree of arrhythmicity in most genetic backgrounds (not shown).
|
|
DBTK/R-expressing flies have high levels of hypophosphorylated and nuclear PER throughout the day. The behavioral results strongly argue that DBT kinase activity is required for circadian rhythmicity, and they establish DBT K/R as a dominant negative mutant in vivo. Recently, the effects of a similar transgenic DBT on inhibition of the hedgehog pathway in Drosophila have also been interpreted as evidence of a dominant negative effect in this pathway (17). Since DBTK/R successfully protects PER from phosphorylation and degradation in S2 cells, the in vivo behavioral data are consistent with the possibility that arrhythmicity and long periods are caused by stabilization of PER, thereby freezing the cells in a continuous transcriptionally repressed state or prolonging this transcriptional repression. This possibility was investigated by addressing PER's phosphorylation state, stability, and cellular localization in DBTK/R flies.
To analyze the effects of DBT or DBTK/R on PER expression in clock cells, flies with a tim-GAL4>UAS-DBTWT or tim-GAL4>UAS-DBTK/R genotype were collected at four time points in a 12-h:12-h LD cycle or in DD. PER levels both in extracts from entire male bodies (Fig. 5A and B) and in extracts from heads (Fig. 5C and D) were analyzed. For the analysis of whole-body extracts, we collected only males because wild-type females express constitutively high levels of PER throughout the day in the ovarian tissues, and this PER masks the detection of PER oscillations in other tissues (15). As expected, PER levels oscillate over the course of the day in flies with no responder transgene (TM3) or in flies expressing DBTWT-MYC from the tim-GAL4 driver. Both of these genotypes express high levels of PER at ZT19, when PER is mostly nuclear (9, 59) (see Fig. 6); the wild-type TM3 control flies also express high levels at ZT1, while the flies expressing DBTWT-MYC express somewhat lower levels of PER at ZT1. Furthermore, at ZT1 and ZT7 PER levels exhibit a slower electrophoretic mobility on SDS-PAGE, indicative of a highly phosphorylated state (Fig. 5A, C, and D) (9). At ZT7 most of the highly phosphorylated PER has been degraded, and there is little or no newly synthesized and unphosphorylated PER. One hour after the light is out at ZT13, newly formed, unphosphorylated PER begins to accumulate, producing a fast-migrating PER on SDS-PAGE. Levels of largely unphosphorylated PER reach a high point at ZT19 (Fig. 5A, C, and D), when PER enters the nucleus and begins to inhibit the CLK/CYC transcription factor (3, 9, 21, 58, 59). In DD (CT) the wild-type oscillation in PER level and electrophoretic mobility persists in whole-body extracts for the first day, with changes in level and mobility equivalent to those seen in LD (Fig. 5B, TM3).
|
The effect of DBTK/R expression on the circadian oscillation of PER nuclear accumulation in the eye and in brain neurons was also examined. The fly eye consists of a regular array of ommatidia, each containing eight photoreceptor neurons. The nuclei of photoreceptors 1 to 7 lie on the outside of the retina, while the nuclei for photoreceptor 8 lies on the inside of the retina (Fig. 6A). When fly head sections from wild-type control flies carrying the balancer chromosome (TM3) instead of a DBT responder or from flies overexpressing DBTWT-MYC were collected in LD and stained for PER, strong nuclear localization of PER protein in photoreceptor cells could be detected on the outside and inside of the retina during the early day and the late night (ZT1 and ZT19) (Fig. 6). Undetectable or weak nuclear staining was seen during the late day and early night (ZT7 and ZT13) (Fig. 6) in these wild-type flies. The circadian timing of PER nuclear localization in these wild-type controls is consistent with multiple published reports for the wild-type circadian oscillation (59). Blind scoring results of multiple sections, ranging from 0 (no nuclear staining) to 2 (strong nuclear staining), are presented in Fig. 6B and confirm this circadian oscillation in nuclear accumulation, which is unaffected by overexpression of DBTWT-MYC, consistent with the lack of a strong effect of overexpression of DBTWT on circadian behavior and total PER levels (Fig. 4 and 5; Table 1).
By contrast, immunocytochemical analysis of fly eyes from tim-GAL4>UAS-DBTK/R flies showed generally high nuclear staining for PER at all time points (Fig. 6). In particular, nuclear PER was consistently detected at ZT7 and ZT13, while PER was undetectable in many wild-type photoreceptors at these time points. Nevertheless, there was a persistent (albeit damped) oscillation of nuclear PER accumulation, with peak levels at ZT1 (Fig. 6B).
Expression of PER in the brain neurons which express the neuropeptide PDF (and control locomotor activity rhythms in adult flies [12, 25, 29, 32, 36-38, 45]) was examined in whole mounts of larval brains overexpressing DBTWT or DBTK/R specifically in these neurons (Fig. 7). Control larvae which overexpress DBTWT in all clock cells with the tim-GAL4 driver showed wild-type rhythmic nuclear accumulation of PER in the PDF-positive (PDF+) neurons, with high nuclear levels at ZT 1 (Fig. 7A) and undetectable or cytoplasmic levels at ZT13 (Fig. 7B). By contrast, PER levels were high in PDF+ neurons at both ZT1 (Fig. 7A) and ZT13 (Fig. 7B) when DBTK/R was overexpressed in these larval brains with the tim-GAL4 driver. PER localization was somewhat variable in PDF+ brain neurons from tim-GAL4>UAS-DBTK/R larvae but was most commonly observed in the nucleus or both the nucleus and the cytoplasm, as judged by PER fluorescence which could overlap that of PDF but also was found more centrally (Fig. 7A and B). The robust oscillation of nuclear accumulation observed for tim-GAL4>UAS-DBTWT brains was lacking in tim-GAL4>UAS-DBTK/R brains. The fast electrophoretic mobility of PER with expression of the dominant negative DBT (Fig. 5) suggests a very low DBT-dependent phosphorylation state for PER at all times, and the in situ analyses show high levels of nuclear PER at all times (Fig. 6 and 7). These results suggest that high levels of PER phosphorylation are not absolutely required for nuclear localization of PER, and they would be consistent with antagonism of PER nuclear localization by DBT in the wild-type circadian cycle (8). This possibility is discussed in more detail below.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
10% of wild-type levels, showed that DBT is essential for oscillations of per and tim gene expression (43). This mutant produces a constitutively high level of PER, which constitutively represses per and tim mRNAs to low levels just sufficient to maintain repressing levels of PER and TIM proteins. This constitutively high level of PER can persist with greatly reduced levels of TIM (43). By contrast, in the timo mutant, in which TIM is absent but DBT is present, PER is cytoplasmic (8, 53) and is expressed at very low levels (44). It was therefore proposed that DBTWT functions to destabilize PER in the cytoplasm during the day and early evening, while TIM accumulation during the night antagonizes DBT and allows PER to accumulate (22, 43). Because DBT delays the accumulation of PER in the cytoplasm, per and tim mRNA levels rise to their peak levels, before their transcription is repressed by nuclear PER (43). In this model, the delay in PER accumulation effected by DBT is essential for molecular rhythms of per and tim mRNA, which otherwise would be constitutively repressed by immediate accumulation of PER.
Kinases have multiple targets and complex effects on circadian clock components.
In addition to the effects of DBT on PER cytoplasmic stability, it has become clear from additional work that DBT and its vertebrate orthologs (CKI and CKI) cause additional effects on PER and other clock components. A number of studies have suggested that CKI regulates nuclear localization and nuclear stability of PER (1, 3, 8, 33, 35, 50-52). As well, DBT or CKI has been proposed to activate the repressor function of PER (35). Other clock components have also been proposed as targets of DBT, including Drosophila dCLK (21, 58), which is also a target of PER's repression. Drosophila DBT destabilizes dCLK and may also repress its transcriptional activator function, suggesting that DBT may mediate PER's repressor function (21, 58). A similar function has been proposed for kinases in the bread mold Neurospora crassa, with FRQ mediating the targeting of the kinases to the white-collar transcription factor (16, 48), and other vertebrate transcription factors besides PER are also targets of CKI (10).
In both flies and mammals, DBT is part of a multiprotein complex (23, 26) that is likely to include other kinases, and it is not clear how much phosphorylation in this complex requires DBT. Reductions in DBT kinase activity do not necessarily lead to equivalent reductions in the phosphorylation of PER and other clock components in vivo. For instance, although normal oscillations of dCLK phosphorylation state are dependent on DBT, CLK is nevertheless phosphorylated to some extent in a dbtAR mutant suggested by other work to have greatly reduced kinase activity. Hence, other kinases besides DBT may directly phosphorylate dCLK (21, 58). Because all of the short-period and long-period mutant alleles of dbt in both flies and vertebrates have lowered kinase activity on PER and casein in vitro (30, 41, 49, 55) but the short-period alleles apparently produce faster circadian cycles of phosphorylation in vivo, a faster clock is not the consequence of a simple increase in DBT's general kinase activity.
Antagonism of DBTWT by DBTK/R produces long circadian periods but not short circadian periods.
These results suggest two possible means by which DBT can regulate period length. The first possibility is that some of the period-altering mutants of dbt alter some other aspect of its function in addition to kinase activity and that these alterations differ in short- and long-period mutants. A second possibility is that the dbtS and dbtL mutations affect the rate of phosphorylation at different sites in PER in different ways or to different extents. Recently, two studies have provided evidence that the phenotype of the tau mutation, originally identified in CKI of hamsters, may be explained by the latter possibility. One of these studies proposed that the tau mutant form of the kinase phosphorylates some of the sites more rapidly than wild-type kinase, while phosphorylating other sites less rapidly (13). The other study proposed less rapid phosphorylation at all sites but with different consequences of the phosphorylation events for PER stability (51). Reduced phosphorylation of one cluster of sites was proposed to reduce nuclear retention of PER and thereby destabilize PER, because it is still phosphorylated in the cytoplasm at other sites which target PER for degradation (51). Both of these studies postulated that the tau mutation affected the site preference of the kinase, with different consequences mediated at different sites. Analysis of mice carrying a mutation in a PER target site for CKI has also shown that different phosphorylation sites in PER produce different effects on clock biochemistry (56).
In order to address how a general reduction (rather than a site-specific reduction) in kinase activity would affect the circadian period, we constructed a very conservative mutation (K38R) that is predicted from prior work only to eliminate catalytic activity without affecting the general protein folding or interactions with other proteins. In fact, this protein, when immunoprecipitated from Drosophila S2 cells, completely lacks kinase activity. Our analysis of the DBTK/R protein in vitro and in cell culture has shown that while this mutation eliminates the kinase activity of DBT, it leaves its interactions with PER in tact. For this reason, DBTK/R can antagonize the action of DBT in S2 cells and in vivo, with the level of antagonism proportional to the amount of DBTK/R expression.
Since flies expressing DBTK/R can exhibit long circadian periods, reduced kinase activity is shown to produce long-period rhythms. Even the most weakly expressing DBTK/R line, which is mostly rhythmic and has the shortest periods, still exhibits periods longer than wild type. This finding demonstrates that period becomes progressively longer as DBTWT is progressively antagonized by higher levels of DBTK/R. While long-period mutants have not been identified in mammalian CKI/, it is possible that redundancy between CKI and CKI may mask the phenotypic effect of generally lowered kinase activity for either isoform. Importantly, no level of antagonism by DBTK/R produced short periods in our study, so short periods are not the consequence of a general antagonism of DBTWT kinase activity in flies. The general reduction in the kinase activity of the DBTS protein detected in vitro cannot fully explain the reason for its short-period phenotype.
Since the transgenic lines overexpressing DBTS and DBTL lines analyzed here have essentially the same periods as those resulting from the original mutations in the endogenous genes (43), both the dbtS and dbtL mutations produce an altered set point for the period length, which is not altered by overexpression of the proteins. Because the polypeptide chain folds back on itself to form a ß-sheet in the ATP-binding lobe of CKI, the amino acid affected by the dbtL mutation lies close to K38 in the ATP-binding domain of the X-ray crystal structure of CKI (54), and thus the dbtL mutation (like the dbtK/R mutation) may reduce general catalytic activity. In contrast to dbtK/R, the dbtL mutation does not eliminate this activity, since the dbtL period length is shorter than the maximum period lengths produced by DBTK/R in a wild-type genetic background, and DBTL does exhibit detectable kinase activity (41). The dbtS mutation affects an amino acid that lies on a surface-exposed loop of the ATP-binding lobe (54), and so it might affect an interaction with another protein, in addition to catalytic activity. Intriguingly, a human CKI mutation leading to short periods and an advanced sleep phase syndrome lies very close to the amino acid affected by the dbtS mutation (55) (Fig. 1A). Like the dbtS mutation, this mutation also leads to generally lower kinase activity in vitro. An intriguing possibility is that both of these mutations shorten period by the same mechanism, although in flies this mutation exhibits a modest lengthening of the circadian period (55).
DBT kinase activity is necessary for circadian rhythms of behavior and PER cycling.
In addition to their relevance to the role of kinase activity in setting circadian period length, our results with DBTK/R-expressing flies have broader relevance to the role of DBT's kinase activity in the circadian clock. To begin with, the results establish that DBT does have kinase activity in the fly. While this conclusion has been clear for the vertebrate CKIs, it has not been clear for the fly DBT protein. Wild-type Drosophila DBT is not enzymatically active when expressed in E. coli (41). While DBT immunoprecipitated from S2 cells has kinase activity associated with it (41), it was formally possible that some other associating protein provided the kinase activity. However, the fact that the DBTK/R mutant protein immunoprecipitated from S2 cells completely lacks kinase activity in vitro while DBTWT exhibits kinase activity establishes that DBTWT has an intrinsic kinase activity, rather than a kinase activity resulting from an associated protein; the kinase activity does not derive from an associated kinase, or it would not be eliminated by the K38R mutation. The vertebrate CKI/s are known to autophosphorylate their C-terminal domains, and this phosphorylation autoinhibits their kinase activity (54). Absence of kinase activity in DBTK/R is predicted to eliminate this inhibition, and yet there is no detectable kinase activity in vitro, thereby reinforcing the notion that the primary effect of the mutation is on the catalytic mechanism of DBT.
Our further analysis of the DBTK/R phenotype in S2 cells and flies establishes the requirement for this kinase activity in all the circadian phenomena that were assessed here. DBTK/R acts as a dominant negative mutant when expressed in flies, resulting in arrhythmic and long-period phenotypes. At the molecular level in flies expressing DBTK/R, PER levels are high at all times of day, and the oscillation in level is damped in LD and DD conditions, especially in the PDF+ cells, which are essential for rhythmic locomotor activity. Because the oscillation in electrophoretic mobility shifts of PER is eliminated in DBTK/R flies and PER always has a high mobility, phosphorylation of PER that produces electrophoretic mobility shifts is shown to be dependent on DBT's kinase activity.
The phenotype of the DBTK/R mutant is the first which can be said to arise specifically from strongly reduced DBT catalytic activity and not some other aspect of its function or regulation. The original strong loss-of-function dbt mutation that was analyzed for effects on PER and TIM cycling resulted from the insertion of a P element in an intron of the gene
-32P]ATP. Reaction aliquots were analyzed by SDS-PAGE, followed by detection of DBT with immunoblot analysis using an antibody against the C terminus of DBT (top panels) and detection of phosphorylated casein (A and B, bottom panels) or PER (C, bottom panel) by autoradiography. The band that migrates just ahead of DBT-MYC in some reactions is nonspecific (NS) rather than endogenous DBT because it was detected in lanes which contained only the substrate and no material immunoprecipitated from S2 cells (not shown). Increases or decreases in the volume of solution containing the kinase are indicated above the lanes (no label denotes a 1x volume). PER(F), full-length PER; PER(NF), PER protein that is not full length. Phosphorylation of casein or PER is readily detected for all DBTWT reactions (DBTWT lanes) and is not detected when using the DBTK/R or immunoprecipitates of cells that did not receive the DBT transgene ("no DNA"). (D) For lines permanently transformed with pMT-DBT-MYC, the amount of signal in the casein or PER mobility range was quantified by phosphorimager analysis and normalized to the amount of DBT detected by immunoblotting; both the 32P and DBT signals were corrected by subtracting the background from an equivalent region of the "no-DNA" lane, resulting in negative values for some of the DBTK/R normalizations. These values were then plotted relative to the amount of normalized DBTWT activity, which was set to 1. The results of three experiments for casein and six experiments for PER showed no evidence of any residual kinase activity for DBTK/R (representative autoradiographs are shown in panels B and C).
