This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Revil, T.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Revil, T.
Right arrow Articles by Chabot, B.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2007, p. 8431-8441, Vol. 27, No. 24
0270-7306/07/$08.00+0     doi:10.1128/MCB.00565-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Protein Kinase C-Dependent Control of Bcl-x Alternative Splicing{triangledown}

Timothée Revil, Johanne Toutant, Lulzim Shkreta, Daniel Garneau, Philippe Cloutier, and Benoit Chabot*

RNA/RNP Group, Département de Microbiologie et d'Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec, Canada J1H 5N4

Received 30 March 2007/ Returned for modification 7 May 2007/ Accepted 19 September 2007


arrow
ABSTRACT
 
The alternative splicing of Bcl-x generates the proapoptotic Bcl-xS protein and the antiapoptotic isoform Bcl-xL. Bcl-x splicing is coupled to signal transduction, since ceramide, hormones, and growth factors alter the ratio of the Bcl-x isoforms in different cell lines. Here we report that the protein kinase C (PKC) inhibitor and apoptotic inducer staurosporine switches the production of Bcl-x towards the xS mRNA isoform in 293 cells. The increase in Bcl-xS elicited by staurosporine likely involves signaling events that affect splicing decisions, because it requires active transcription and no new protein synthesis and is independent of caspase activation. Moreover, the increase in Bcl-xS is reproduced with more specific inhibitors of PKC. Alternative splicing of the receptor tyrosine kinase gene Axl is similarly affected by staurosporine in 293 cells. In contrast to the case for 293 cells, PKC inhibitors do not influence the alternative splicing of Bcl-x and Axl in cancer cell lines, suggesting that these cells have sustained alterations that uncouple splicing decisions from PKC-dependent signaling. Using minigenes, we show that an exonic region located upstream of the Bcl-xS 5' splice site is important to mediate the staurosporine shift in Bcl-x splicing. When transplanted to other alternative splicing units, portions of this region confer splicing modulation and responsiveness to staurosporine, suggesting the existence of factors that couple splicing decisions with PKC signaling.


arrow
INTRODUCTION
 
Alternative splicing of pre-mRNAs provides a powerful mechanism to augment the protein repertoire encoded by metazoan genomes. It is estimated that 74% of all multiexonic human genes are alternatively spliced (36). Moreover, alternative splicing is becoming increasingly relevant to a variety of human diseases, including cancer (60, 85). These observations justify current efforts devoted at uncovering the basic principles of alternative splicing control. Many studies have provided valuable insights into the roles of specific elements and factors in splicing modulation (7, 58, 84). Proteins that bind to specific sequence elements to affect splice site selection include SR proteins, hnRNP proteins, and other related RNA binding proteins such as TIA-1, ETR-3, Raver-1, and Sam68 (16, 29, 35, 54, 59, 76). Many of these proteins can be modified posttranslationally, and some of the modifications, like phosphorylation, can affect their localization and activity (59, 82).

Although we expect that the coupling between signal transduction events and alternative splicing decisions will represent a major network of regulation, very little is known about how splicing is coordinated by a variety of effectors to attune cells to specific environmental demands and stresses. Possibly the first system describing a link between signal transduction and splicing involved the cell surface molecule CD44, in which exon v5 inclusion was stimulated following activation of the protein kinase C (PKC) or extracellular signal-regulated kinase, as part of the Ras signaling pathway (41). It was later shown that this occurred through stimulation of Sam68 binding to exon v5 after its phosphorylation (59). Interestingly, the Ras-induced production of CD44 receptors made from the exon v6-containing mRNA in turn enhances Ras activation to enforce cell cycle progression (17).

A signaling pathway also triggered by Ras and PKC promotes the skipping of exons in the transmembrane protein phosphatase CD45 pre-mRNA (53, 73). Because hnRNP L is essential for the repression of several CD45-regulated exons (74), the aim of this signaling route may be to enforce the activity of hnRNP L or to repress the activity of proteins bound to nearby enhancers (49, 88). Recent progress has also been made in identifying sequences and factors that control alternative splicing decisions of the NMDA receptor upon depolarization or constitutive CaM kinase IV expression (3). The instruction to skip exon C1 is relayed by a variety of elements, some bound by hnRNP A1 (2, 45). On the other hand, the cellular localization of hnRNP A1 is controlled by the MEK3/6-p38 pathway (89). SR proteins have been implicated in multiple cases of alternative splicing control, and they are extensively phosphorylated. Although SR proteins can be phosphorylated by SRPK1, SRPK2, Clk/Sty, and topoisomerase I (27), the signaling pathways that converge on these kinases remain unclear. Recently, contributions to splicing control by signaling pathways involving AKT kinase, phosphatidylinositol 3-kinase, and Jun N-terminal protein kinase have also been documented (8, 9, 24, 64, 65, 67).

Apoptosis, or programmed cell death, represents an important mechanism that equips cells with the ability to respond dramatically to external and internal insults. Consequently, apoptosis must be tightly connected to a variety of signals that transduce information on the status of the cell and its environment (78). In human cells, apoptosis involves a large number of factors, including transcriptional regulators, transmembrane receptors, cytoplasmic mediators, adaptors, and caspases. Alternative splicing plays a major role in the control of apoptosis (78, 82, 93). In many cases, alternative splicing programs the synthesis of proteins with different and sometimes opposing functions in apoptosis. This contribution affects all categories of apoptotic factors (78). For example, the production of soluble forms of Fas and FasL can have an antiapoptotic function (4, 11). Many members of the Bcl-2 family of proteins are also subject to splicing regulation, with Bcl-x possibly representing the best-documented case. The Bcl-xL splice isoform is produced through the use of a specific 5' splice site in exon 2 (Fig. 1A). One manner by which Bcl-xL exerts its antiapoptotic activity is by binding to and inhibiting proapoptotic BH3 proteins such as Bad or Bax (18). In contrast, Bcl-xS displays proapoptotic activity and is derived from the use of a 5' splice site located 189 nucleotides (nt) upstream from the xL site. Bcl-xS forms active homodimers and heterodimers with proapoptotic Bcl-2 family members (51). Alternatively, Bcl-xS can heterodimerize with antiapoptotic Bcl-2 family members such as Bcl-xL, rendering them inactive (15, 51).


Figure 1
View larger version (10K):
[in this window]
[in a new window]

  		FIG. 1. Alternative splicing of the Bcl-x pre-mRNA. (A) The Bcl-x pre-mRNA is alternatively spliced to produce two major isoforms, Bcl-xL and Bcl-xS. The positions of the primers used in RT-PCR assays are shown. (B) Sequences and factors documented to affect the alternative splicing of Bcl-x. The CRCE1 and CRCE2 elements modulate the response of A549 cells to ceramide that activates the use of the 5' splice site of Bcl-xS (57). CRCE1 is bound by the U2 snRNP protein SAP155, and its knockdown increases the production of Bcl-xS (56). B2G is bound by hnRNP H and stimulates the production of Bcl-xS (23). B3 enhances the use of the Bcl-xL 5' splice site (23). The intron regulatory element (IRE) has been implicated in mediating the activity of growth factors and TPA on Bcl-x splicing in various cell lines (50). The SB1 element was previously shown to decrease the production of the Bcl-xS isoform (23), and its position is indicated. Sam68 and hnRNP A1 also contribute to Bcl-x splicing, but the cis-acting elements mediating these effects have not yet been mapped (63).

Despite the anticipated coupling between signal transduction events and alternative splicing decisions in apoptotic genes, there are only a few cases of this type of cross talk that have been reported. Activation of Fas at the membrane changes the alternative splicing of caspase 9 and Bcl-x (13, 14). It turns out that Fas activation and a variety of other stimuli (5, 19, 31, 37, 52, 62, 71) promote the production of ceramide, a regulator of stress responses and growth pathways. Ceramide activates protein phosphatase PP1, which can dephosphorylate SR proteins (13). Two cis-acting elements (CRCE1 and CRCE2) are necessary for the ceramide-induced accumulation of Bcl-xS in A549 cells (Fig. 1B) (57). CRCE1 is bound by the U2-associated spliceosomal complex protein SAP155 (56), which is a substrate for PP1/PP2A phosphatases (80). S-Adenosylmethionine and its metabolite 5' methylthioadenosine also increase PP1 expression and Bcl-xS production in HepG2 and 293 cells (94). A role for SR protein in Bcl-x splicing regulation may also be predicted based on the effect of an inhibitor of the SR protein kinase topoisomerase I (68). The ratio of the Bcl-x isoforms is also affected by growth factors, including interleukin-1{alpha} (69), interleukin-6, and granulocyte-macrophage colony-stimulating factor (50). Tetradecanoyl phorbol acetate (TPA) can also affect the alternative splicing of Bcl-x in an apparent PKC-dependent manner (50). A large intronic region immediately downstream from the Bcl-xL 5' splice site (Fig. 1B) has been linked to the effects of TPA and cytokines (50). Very recently, phosphorylation of Sam68 by Fyn was shown to stimulate Bcl-xS usage in HEK293 cells (63). The same study reported that hnRNP A1 can cooperate with Sam68 but that ASF/SF2 antagonizes the activity of Sam68 on Bcl-x splicing.

Also interesting is the observation that glucocorticoids activate transcription of Bcl-x from only one of five mouse promoters (92). Mouse promoter P4 favors the production of the Bcl-xL splice isoforms (66), whereas human promoter 1 displays this characteristic in human hepatoma cells (94). Thus, transcriptional events can also determine the balance of pro- and antiapoptotic Bcl-x isoforms.

Given the crucial role of Bcl-x in apoptosis and the ability of its pre-mRNA to respond to various classes of effectors, we have made efforts towards understanding regulatory aspects of Bcl-x splicing control. Our previous work uncovered an element bound by the hnRNP H protein that enforces the use of the upstream Bcl-xS 5' splice site (23) (Fig. 1B). In addition, an enhancer element was located immediately upstream of the Bcl-xL 5' splice site (23). Here, we report that staurosporine improves the production of the Bcl-xS isoform by interfering with a signaling pathway that is dependent on PKC. The impact of staurosporine on Bcl-x splicing is mediated through a region in exon 2 (SB1) that normally represses the production of Bcl-xS. While staurosporine lifts this repression in 293 cells, it is unable to do so in a variety of cancer cell lines. Our results therefore uncover a novel regulatory mechanism affecting the alternative splicing of Bcl-x. Alterations in this pathway may contribute to the greater resistance of cancer cells to apoptosis-inducing agents.


arrow
MATERIALS AND METHODS
 
Cell culture. The 293 cells used in this study were the EcR-293 cell line (Invitrogen). EcR-293, HeLa, U373, and U-87 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum and 1% glutamine. PC-3 cells were maintained in Ham's F12 medium containing 10% fetal bovine serum and 1% glutamine. SKOV-3 cells were maintained in DMEM/F12 medium containing 10% fetal bovine serum and 1% glutamine. MCF7 cells were maintained in Eagle's minimal essential medium/Earle's balanced salt solution medium containing 10% fetal bovine serum, 1% glutamine, 1 mM sodium pyruvate, 0.1 mM nonessential amino acids and 0.01 mg/ml bovine insulin. HCT 116 cells were maintained in McCoy's 5a medium containing 10% fetal bovine serum and 1% glutamine.

Drug treatment and reverse transcription-PCR (RT-PCR) analysis. A total of 3 x 105 EcR-293 cells, 2 x 105 HeLa or MCF-7 cells, 1.3 x 105 U-87 cells, or 1.5 x 105 SKOV-3, HCT 116, or U373 cells were plated in 35-mm2 wells. Forty-eight hours later, 25 or 50 nM of staurosporine (Roche or Calbiochem) or the indicated concentrations of Gö6976 (Calbiochem) or calphostin C (Calbiochem), in the presence of light, were added and left for the indicated times. One hundred micromolar of z-VAD-fmk (Calbiochem) or the indicated concentrations of 5, 6-dichloro-1-ß-D-ribofuranosylbenzimidazole (DRB) (Calbiochem) or cycloheximide (Calbiochem) were added 1 h before addition of staurosporine. Analysis of splicing profiles of Bcl-x was done as described previously (23). Axl splicing products were amplified with primers Axl-f (CCCCTGAGAACATTAGTGCT) and Axl-r (AGAGCCAAGATGAGGACACA) using the same procedure and conditions as for Bcl-x.

Plasmid constructs. The Bcl-x minigenes were constructed as described previously (23). Portions of SB1 were amplified by PCR using the following primers: for fragment A, A-forw (ATGCTGCAGTCGAGCTTCAG) and A-rev (CATCTGCAGAACCACCAGC); for fragment B, B-forw (ATGCTGCAGAACCAGAGAC) and B-rev (CATCTGCAGCTCAGTCCTG); and for fragment C, C-forw (ATGCTGCAGACTTTCTCTC) and C-rev (TATCTGCAGGGGCTGTCTG). Each PCR product was digested with PstI and gel purified. They were then ligated into Dup51 previously digested with NsiI. The plasmid constructs were verified by enzymatic digestion and sequencing. The pCMV-E1a plasmid has been described previously. The E1a minigene was constructed by digesting pCMVE1a (95) with PstI, blunting, and then digesting with XbaI. The E1a fragment was gel purified and inserted in pcDNA3.1+ digested with EcoRV and XbaI. Fragments B and C of SB1 were then inserted into the blunted EcoRI site.

Transfection of 293 cells. Cells (2 x 105) were plated in 35-mm2 wells. Forty-eight hours later, 0.05 µg of DNA and 4 µl of polyethyleneimine (1 µg/µl) were incubated for 15 min in 200 µl (final volume) of Opti-MEM before being added to the wells, which contained 500 µl of DMEM. Four hours later, 1.5 ml of DMEM was added to each well. At 24 hours posttransfection, the medium was changed and 50 nM of staurosporine was added where indicated. Cells were harvested 18 h later, and RNA was extracted using TRIzol (Invitrogen). Analysis of splicing profiles of the minigenes by RT-PCR was done as previously described (23). Visualization and analysis of amplified products for Bcl-x were done using the LabChip HT DNA assay on an automated microfluidic station (Caliper, Hopkinton, MA).


arrow
RESULTS
 
Staurosporine modifies Bcl-x pre-mRNA splicing in 293 cells. In order to identify signaling pathways that impinge on the control of splice site selection of Bcl-x, we tested whether staurosporine, a general kinase inhibitor and inducer of apoptosis (26, 88, 97), could alter the relative abundances of the Bcl-xS and Bcl-xL splice isoforms in different cell lines. Staurosporine was applied to the adenovirus-transformed cell line 293 and six cell lines derived from a variety of cancers (U373, HeLa, SKOV-3, U-87, MCF7, and HCT 116). After 18 h of incubation with 25 nM of staurosporine, the relative levels of endogenous Bcl-xL and Bcl-xS mRNAs were estimated by RT-PCR from total RNA (Fig. 1A). As expected, Bcl-xL was the predominant form found in all mock-treated cells (Fig. 2A). Staurosporine had no significant effect on the relative abundances of the Bcl-xL and Bcl-xS isoforms, except in 293 cells, where it drastically decreased the ratio of Bcl-xL to Bcl-xS.


Figure 2
View larger version (66K):
[in this window]
[in a new window]

  		FIG. 2. Staurosporine affects Bcl-x pre-mRNA alternative splicing in 293 cells. (A) RT-PCR assays were performed on total RNA extracted from different human cell lines treated or not with staurosporine (25 nM). (B to E) RT-PCR assays were also carried out to amplify portions of endogenous Bcl-x mRNAs when 293 cells were treated with increasing concentrations of staurosporine (B), when they were treated for different incubation times with 25 nM of staurosporine (C), or when the indicated concentrations of DRB (D) or cycloheximide (CHX) (E) were added 1 h prior to addition of 50 nM of staurosporine. A size ladder is shown on the left for all gels. The sizes of the different PCR products corresponding to the Bcl-x splice isoforms are indicated in panel A, and the Bcl-xL/Bcl-xS ratios are shown below the lane numbers.

The impact of staurosporine in 293 cells was dose dependent (Fig. 2B). Because our staurosporine stock was dissolved in dimethyl sulfoxide (DMSO) and DMSO can affect alternative splicing (10), we tested the impact of DMSO on the relative abundances of Bcl-x isoforms. At its highest concentration, which was twice the concentration present in the 150 nM staurosporine solution, DMSO affected the Bcl-x splice isoform ratio by less than 2-fold, whereas staurosporine usually shifted splicing by 10-fold (Fig. 2B, compare lane 8 with lane 7). The effect of staurosporine on Bcl-x splicing was visible after 12 h of incubation (Fig. 2C). Raising the concentration of staurosporine and/or increasing the incubation time did not change the Bcl-x isoform ratio in the cancer cell lines even though morphological changes characteristic of apoptosis (membrane blebbing, cell shrinkage, and formation of apoptotic bodies) were apparent in a majority of cells in all cell lines (data not shown). Thus, the signaling pathways that determine the relative abundances of Bcl-x mRNA isoforms in cancer cell lines are resistant to staurosporine.

Although the amplitude of the effect of staurosporine on the Bcl-x isoform ratio suggests that the drug might influence Bcl-x alternative splicing, it is possible that staurosporine differentially affects the stability of the Bcl-x mRNAs. To address this question, we tested the impact of staurosporine after inhibiting transcription elongation with increasing concentrations of DRB (Fig. 2D). Increasing concentrations of DRB antagonized the shift towards Bcl-xS. This result indicates that the staurosporine-induced decrease in the Bcl-xL/Bcl-xS ratio requires active transcription, suggesting that differential stability of the Bcl-x mRNA isoforms does not make a major contribution to the shift induced by staurosporine.

To test whether the shift in the alternative splicing of Bcl-x requires de novo protein synthesis, we tested the impact of staurosporine in the presence of the protein synthesis inhibitor cycloheximide. When applied alone, cycloheximide stimulated Bcl-xS splicing, and this effect was dose-dependent (Fig. 2E, lanes 3, 5, and 7), possibly due to its activation of mitogen-activated and stress-activated kinases (98). Adding staurosporine at 1 hour after the treatment with cycloheximide resulted in a marked increase in the Bcl-xS product at all concentrations of cycloheximide (Fig. 2E, lanes 4, 6, and 8). Because cycloheximide did not antagonize the staurosporine-induced shift to Bcl-xS, splicing modulation by staurosporine is likely achieved through the posttranslational modification of splicing factors rather than through the expression of newly synthesized regulatory proteins.

The effect of staurosporine on Bcl-x splicing is caspase independent. Staurosporine can induce apoptosis through caspase-dependent or caspase-independent pathways (6, 86, 97). Therefore, some of the changes in the alternative splicing of Bcl-x may be due to caspase-dependent alterations in the integrity of splicing regulatory components. Indeed, many RNA binding proteins and spliceosome components can be cleaved during apoptosis (12, 20, 22). To test whether the shift in Bcl-x splicing was dependent on the activation of caspases, 293 cells were pretreated with z-VAD-fmk, a general caspase inhibitor known to inhibit apoptosis caused by staurosporine in a variety of cell lines (26, 97). Activation and inhibition of caspases by z-VAD-fmk were verified using the poly(ADP-ribose) polymerase (PARP) cleavage assay (44). In comparison to vinorelbine, staurosporine did not elicit PARP cleavage, and z-VAD-fmk prevented PARP cleavage induced by vinorelbine (Fig. 3A). Moreover, z-VAD-fmk had no basal effect on Bcl-x splicing and did not antagonize the staurosporine-mediated switch towards Bcl-xS (Fig. 3B, lanes 3 and 4). Therefore, caspase activation does not contribute to the staurosporine-mediated change in Bcl-x splicing.


Figure 3
View larger version (51K):
[in this window]
[in a new window]

  		FIG. 3. Caspase-independent and PKC-dependent shifts in Bcl-x splicing. (A) Western blotting performed to detect PARP cleavage induced by the different drugs in the absence or the presence of z-VAD-fmk. The position of the cleaved PARP product obtained with vinorelbine is shown. (B) RT-PCR assays were performed on total RNA from 293 cells treated for 18 h with the caspase inhibitor z-VAD-fmk and/or staurosporine. The ratios of Bcl-xL and Bcl-xS products are indicated. (C) Bcl-x splicing profiles for different cell lines treated with the indicated concentrations of staurosporine (ST) and the specific PKC inhibitor Gö6976 (Gö). The graphs plot the Bcl-xL/Bcl-xS ratio. (D) Impact of the PKC inhibitor calphostin C on the endogenous Bcl-x splicing profile in 293 cells. Error bars indicate standard deviations.

PKC inhibition shifts Bcl-x splicing. Staurosporine can inhibit a broad spectrum of kinases such as PKC, PKG, PKA, CaM kinase, myosin light chain kinases, and others (75). However, it has greater potency against PKC (50% inhibitory concentration [IC50] = 700 pM; Ki = 19 nM). To investigate whether staurosporine might act on Bcl-x splicing by inactivating PKC, we tested the specific PKC inhibitor Gö6976 (IC50 = 7.9 nM; Ki = 2.8 nM) (39, 55). The incubation of 293 cells for 18 h with Gö6976 promoted an increase in the Bcl-xS product, as seen with staurosporine (Fig. 3C, lanes 1 to 6). Inhibiting PKA or PKG using H-89 (45 nM; Ki = 48 nM) or DT-3 (45 nM; Ki = 25 nM), respectively, only minimally increased the production of Bcl-xS in 293 cells (data not shown). Thus, the impact of staurosporine on the alternative splicing of Bcl-x in 293 cells is likely to be mediated mostly through the PKC pathway. Other observations are relevant to the role of PKC in Bcl-x splicing. First, DMSO can induce PKC-mediated apoptosis (25), possibly explaining the small effect of DMSO on Bcl-x splicing (Fig. 2B, lane 8). Second, calphostin C, a highly specific inhibitor of PKC (IC50 = 50 nM) (38), also increased the production of Bcl-xS in 293 cells (Fig. 3D). Third, tamoxifen, which has been reported to inhibit PKC (61), increased the relative level of Bcl-xS in 293 cells (not shown). While calphostin C can inhibit several members of the PKC family, Gö6976 is reported to inhibit PKC{alpha}, PKCß, and PKCµ (now known as PKD) but not PKC{gamma}, PKC{delta}, PKC{varepsilon}, and PKC{xi} (39, 96). A specific PKCß inhibitor did not affect Bcl-x splicing in 293 cells, nor did Gö6983, an inhibitor of PKC{alpha} but not of PKD (96) (data not shown). Knocking down PKC{alpha} by RNA interference did not affect Bcl-x splicing and did not antagonize the shifting activity of staurosporine (data not shown). While the above results might point to PKD as the PKC enzyme involved in Bcl-x splicing control, some studies indicate that PKD activity is not affected by staurosporine (96). To identify which PKC enzyme affects Bcl-x splicing in 293 cells, we have initiated a systematic RNA interference approach targeting individual PKC enzymes.

Modulation of Bcl-x and Axl splicing by staurosporine does not occur in cancer cell lines. Notably, staurosporine and Gö6976 did not improve the production of Bcl-xS in the cancer cell lines HCT 116, HeLa, and PC-3 (Fig. 3C, lanes 7 to 24). The PKC pathway is known to be abnormally regulated in many cancer cell lines (40), which may explain why the alternative splicing of Bcl-x in this selection of cancer cell lines is not affected.

To identify other alternative splicing events that might be controlled by PKC, we tested the impact of staurosporine on other pre-mRNA substrates expressed in 293 cells. First, we tested the production of isoforms produced from the adenovirus E1a pre-mRNA, a gene whose expression contributes to the transformed state of 293 cells. Like Bcl-x, E1a uses alternative 5' splice site usage to produce a variety of isoforms (13S, 12S, and 9S mRNAs). Staurosporine did not affect the alternative splicing of E1a (Fig. 4A). Thus, the impact of staurosporine appears not to involve a factor that controls alternative 5' splice site selection in a global manner.


Figure 4
View larger version (26K):
[in this window]
[in a new window]

  		FIG. 4. PKC-dependent alternative splicing of Axl. (A) An RT-PCR assay was carried out to amplify endogenous adenovirus E1a products in 293 cells treated or not with 50 nM of staurosporine. (B) RT-PCR assays were designed to amplify splicing products from Bcl-x and Axl in mock- or staurosporine-treated 293 cells. The sizes of the PCR products are indicated, as well as the structures of the Bcl-x and Axl alternative splicing units. (C) Different cell lines were treated with staurosporine or Gö6976. RT-PCR assays were performed to amplify Axl splicing products. The inclusion/exclusion ratios are shown below lane numbers.

Next, we tested the impact of staurosporine on the production of mRNA isoforms produced from a selection of apoptotic genes expressed in 293 cells. While most of the splicing units tested were not affected by staurosporine, the alternative splicing of the receptor tyrosine kinase Axl was significantly affected (Fig. 4B, lanes 3 and 4). The skipping of an alternative exon in Axl was also stimulated by the PKC inhibitor Gö6976 (Fig. 4C, lane 3). Although aberrant expression of Axl has been linked to cancer (28, 90), the function of the short isoform whose abundance is enhanced by staurosporine is currently unknown. Thus, the PKC pathway likely controls the alternative splicing of a subset of pre-mRNAs in 293 cells. As was the case with Bcl-x, staurosporine did not stimulate exon skipping of Axl in the HCT116, HeLa and PC-3 cancer cell lines (Fig. 4C).

Staurosporine mediates its activity through an element in Bcl-x exon 2. If the PKC-dependent effect of staurosporine on Bcl-x splicing is specific and not due to general splicing deregulation, this effect may be exerted through a protein that binds to a sequence element in the Bcl-x pre-mRNA. To identify regions in the Bcl-x pre-mRNA that may be necessary for the activity of staurosporine, we compared the splicing ratios of transcripts derived from Bcl-x minigenes (Fig. 5A). X2 contains exon 2 and 1.2 kb of downstream intron sequence with exon 3 and neighboring upstream intron sequences (23). X2.13 is identical to X2 except that it lacks the first half of exon 2. Following transfection of the Bcl-x minigenes in 293 cells, RT-PCR analysis indicated that transcripts from X2 were spliced more efficiently to the Bcl-xL 5' splice site than those expressed from X2.13 (Fig. 5B, compare lane 1 with lane 3 and the accompanying graph). Thus, the 361-nt region forming the first half of exon 2, dubbed SB1, behaves as an inhibitor of the Bcl-xS 5' splice site. When the analysis was performed with transfected cells treated with staurosporine, we observed a shift towards Bcl-xS for transcripts derived from X2, thereby reproducing the impact of staurosporine on endogenous Bcl-x transcripts (Fig. 5B, lane 2). In contrast, the same treatment had a much-reduced impact on the ratio of isoforms produced from X2.13 (lane 4). These results indicate that staurosporine can lift the basal repression of the Bcl-xS 5' splice site that is provided by SB1. We also tested mutated derivatives of X2 and X2.13 (X2-W and X2.13-W [Fig. 5A]) that produce more of the Bcl-xL isoform. In these cases, the repressor activity of SB1 was also apparent (Fig. 5B, compare lane 5 with lane 7 and the accompanying graph), and the production of Bcl-xS was stimulated by staurosporine in an SB1-dependent manner (Fig. 5B, lanes 6 and 8).


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		FIG. 5. The SB1 element represses the Bcl-xS 5' splice site, and its activity is neutralized by staurosporine. (A) Diagram representing the SB1 element on the Bcl-x gene and the structures of minigenes X2 and X2.13. Derivatives of X2 and X2.13 carrying mutations (two GGUs mutated to CCAs) that improve Bcl-xL production were also used (X2-W and X2.13-W). The positions of the primers used to amplify mRNA products from these minigenes are indicated. (B) The Bcl-x splicing products were monitored by RT-PCR amplification from total RNA isolated from mock- or staurosporine-treated 293 cells transfected with minigenes. The analysis of amplified products was done on an automated microfluidic station, and electropherograms are shown. The sizes of the amplified Bcl-x products are indicated, as well as the xL/xS ratios. The graphs on the right represent the quantitated xL/xS average ratios from another set of experiments performed with the X2.13, X2, X2.13-W, and X2-W minigenes. Standard deviations are provided. (C) Graph representing the xL/xS ratios obtained following transfections with the X2 and X2.13 minigenes in HeLa cells.

Although staurosporine did not promote an increase in the level of the Bcl-xS mRNA in cancer cells (Fig. 2A), we transfected the X2 and X2.13 minigenes in HeLa cells to determine whether the SB1 element had any activity in this cell line. Notably, the use of the Bcl-xS 5' splice site was stronger in the absence of the SB1 element (Fig. 5C), confirming a previous observation made with HeLa cells (23) and indicating that the SB1 element actively represses the xS donor splice site. This result suggests that the SB1 element functions in cancer cells but that staurosporine is unable to lift the repression.

To confirm the role of SB1 and the neutralization of its activity by staurosporine, we asked whether portions of SB1 were capable of directing splicing decisions in different contexts. As shown in Fig. 6A, we inserted three partially overlapping portions of SB1 into the first exon of Dup51, a model splicing unit derived from duplicated human ß-globin regions (21). Following transfection in 293 cells and RT-PCR analysis, we observed that all portions of SB1 enhanced the skipping of the central exon (Fig. 6B), with fragment C (159 nt) having the strongest effect (lane 7). When transfected cells were treated with staurosporine, the alternative splicing of Dup51 and of derivatives containing fragments A and B was not significantly affected (Fig. 6B, lanes 2, 4, and 6). In contrast, staurosporine neutralized the exon-skipping activity of fragment C (lane 8). We also tested the activities of portions B and C of SB1 when they were inserted at an upstream position in an adenovirus E1a minigene (95). In this case, only fragment B influenced alternative splicing by improving the inclusion of a central exon that produces the 10S isoform (Fig. 6C, lane 3). Staurosporine enhanced the inclusion of this exon in a fragment B-dependent manner (lane 4). Thus, fragment C displayed splicing modulatory activity in Dup51 and mediated the staurosporine splicing shift, while this behavior was a characteristic of fragment B in E1a. Although fragments B and C are overlapping, our results suggest that the SB1 element is complex and that the activities of distinct portions of SB1 are sensitive to the context in which they are tested. Nevertheless, it is clear that portions of SB1 can modulate splice site selection in an heterologous manner and that responsiveness to staurosporine can be transferred to other pre-mRNAs. Thus, our results suggest that SB1 is bound by factors whose activity is connected to the PKC pathway.


Figure 6
View larger version (49K):
[in this window]
[in a new window]

  		FIG. 6. Portions of SB1 can modulate splicing in heterologous pre-mRNAs. (A) Diagrams of the Bcl-x X2, the globin-derived Dup51, and the adenovirus E1a pre-mRNAs, indicating the portions of SB1 that were inserted into Dup51 and E1a. (B) RT-PCR assays were performed to amplify products derived from the minigenes transfected in 293 cells that were treated or not with staurosporine. Values for the exclusion/inclusion ratio are shown below lane numbers. (C) RT-PCR assays were carried out to amplify products derived from the E1a minigene transfected in 293 cells that were treated or not with staurosporine. The positions and structures of the various splicing products are indicated.


arrow
DISCUSSION
 
PKC-dependent control of Bcl-x splicing in 293 cells. As can be expected for a gene that produces isoforms with antagonistic functions in apoptosis, the alternative splicing of Bcl-x is highly regulated, and several sequence elements contribute to its splicing control. Among these are sequences that may couple splicing decisions with the transduction of signals initiated by growth factors and ceramide (50, 57). Although staurosporine can downregulate Bcl-xL levels in a few cell lines, a corresponding increase in Bcl-xS was not observed previously (26). Our study indicates that staurosporine stimulates the production of the proapoptotic Bcl-xS isoform in 293 cells. Because pretreatment with the transcriptional inhibitor DRB prevents the increase in Bcl-xS seen with staurosporine, this drug appears to act on the alternative splicing of Bcl-x rather than on the differential stabilities of mRNA isoforms. Moreover, the impact of staurosporine is not caused through protein cleavage, since incubation with a general inhibitor of caspases did not prevent the shift in Bcl-x splicing.

The fact that the translational inhibitor cycloheximide did not antagonize the staurosporine-induced splicing shift suggests that signaling events are responsible for the impact of staurosporine on Bcl-x splicing. Staurosporine is a known PKC inhibitor. Consistent with the possibility that staurosporine alters Bcl-x splicing in 293 cells through repression of PKC, we observed that the PKC{alpha}/PKCß/PKCµ inhibitor Gö6976 and the highly specific PKC inhibitor calphostatin C can mimic the staurosporine-mediated increase in Bcl-xS in 293 cells. This situation is similar to the PKC/Ras-induced shift in alternative splicing of CD44 (41), but it contrasts with the alternative splicing of CD45 where the PKC/Ras-dependent splicing switch is blocked by cycloheximide, indicating that one or several proteins must be made following activation (53).

The involvement of PKC in the control of Bcl-x splicing is not totally surprising. On the one hand, suppression of PKC is associated with the induction of apoptosis, which at least in some cases is accompanied by a reduction in the expression of Bcl-xL (26, 33, 48, 77). On the other hand, ceramide, which promotes Bcl-xS usage in A549 cells, is known to repress PKC{alpha} (46) and to induce the ceramide-activated protein phosphatase PP1 (14). However, the elements that have been associated with the response to ceramide are distinct from SB1 (57). Nevertheless, because the role of SB1 in the response to ceramide has not been examined, it is possible that part of the PKC-dependent impact of ceramide is exerted through SB1.

An exon element mediates the PKC-dependent repression of Bcl-xS. We have linked the effect of staurosporine on Bcl-x splicing to a 361-nt element (SB1) situated 187 nt upstream of the Bcl-xS 5' splice site. The SB1 element displays basal repressor activity, because its removal stimulates the use of the Bcl-xS 5' splice site in transfection assays performed with 293 and HeLa cells. Thus, 293 and HeLa cells likely contain a factor that mediates the repressor activity of the SB1 element. This interpretation is consistent with the observation that transfecting large amounts of Bcl-x plasmid in 293 cells increased the relative level of Bcl-xS and antagonized our ability to detect the SB1-dependent effect (data not shown). However, as suggested by testing SB1 fragments in a heterologous context, the mechanism of action of SB1 is probably more complex, because exon skipping in Dup51 was promoted by different portions of SB1 whereas a subregion of SB1 (fragment B) elicited exon inclusion in E1a.

In the absence of SB1, splicing to Bcl-xS was stronger and was not further stimulated by staurosporine. Thus, staurosporine appears to neutralize the repressor activity mediated by the SB1 element in 293 cells. In a heterologous context, the portions of SB1 that conferred a response to staurosporine stimulated the inclusion of downstream exons, a situation that is difficult to reconcile with a simple derepression model. Moreover, the portions of SB1 that conferred responsiveness to staurosporine varied with different pre-mRNAs. A more exhaustive mutational analysis of the SB1 element and the identification of the factors that bind to it should help us dissect this apparently complex mechanism of splicing control.

Given the role of PKC in the activity of SB1 and the lack of a requirement for new protein synthesis, our results suggest that a phosphorylated protein may be essential for the activity of SB1. The inhibition of PKC may shift the equilibrium towards a dephosphorylated form that may not be binding to SB1 or that may be incapable of sustaining interactions with other proteins involved in the repression of the 5' splice site Bcl-xS. We have been unable to reproduce in vitro the impact of SB1 on Bcl-x splicing using 293 extracts, a situation that may also point to a particularly labile phosphorylation event that is lost during extract preparation. The identity of this trans-acting factor therefore remains to be determined. Phosphorylation-dependent binding has been observed for many RNA binding proteins, including SR proteins (30, 34, 42, 70, 87). Interestingly, PKC can interact with PSF, hnRNP A3, p68 RNA helicase, and hnRNP L (72). The alternative splicing of CD45 during T-cell activation has also implicated both PKC and hnRNP L, with the latter protein interacting directly with sequences in the regulated exons (53, 74). Knocking down hnRNP L in HeLa cells did not affect Bcl-x splicing (data not shown). Sam68 has recently been shown to improve the production of the Bcl-xS isoform in HEK293 cells (63). Although the binding site for Sam68 in Bcl-x has not been mapped, Sam68 may counteract the activity of the repressor that binds to SB1.

We have observed that staurosporine and Gö6976 can also affect the alternative splicing of Axl, a gene encoding a protein kinase receptor whose expression is altered in cancer cells (32, 81). The larger isoform of Axl protects cells against apoptosis when bound to its receptor Gas6 (47, 79), but the function of the smaller isoform is unknown. Thus, the PKC signaling pathway is involved in modulating the splicing of several pre-mRNAs, but it is unclear whether all PKC-dependent splicing shifts converge on the same splicing regulatory factor(s). Comparing the sequences shared by fragments B and C of exon 2 in Bcl-x with the equivalent region in Axl revealed common stretches of CU-rich sequences. A mutational approach combined with swapping experiments should help determine if the staurosporine-induced splicing shift of Bcl-x and Axl is mediated by functionally similar elements.

Altered PKC pathway in cancer cells. Of the eight cell lines that were treated with staurosporine, a shift towards the proapoptotic Bcl-xS isoform was observed only in 293 cells. Likewise, the alternative splicing of Axl was modulated by staurosporine in 293 cells but not in the cancer cell lines. It is unlikely that this selectivity reflects an inability of the drug to reach sufficiently high intracellular concentrations in cancer cells, since staurosporine induced a phenotype characteristic of apoptosis in all cell lines. Moreover, the PKC inhibitor Gö6976 was also unable to promote a splicing switch in the cancer cell lines. Thus, the PKC pathway in the cancer cell lines tested either is inactive or is resistant to the action of inhibitors. We favor the latter explanation because activation of the PKC{alpha}/PKCß isozymes has been linked to malignancy (40). In addition, the SB1 element that represses the Bcl-xS 5' splice site is functional in HeLa cells. The molecular basis for the resistance of the PKC pathway to staurosporine and to Gö6976 remains unclear. Different PKC isoforms and isozymes may be expressed in cancer cells (1, 43, 91). These PKC variants may be less sensitive to inhibitors, or they may not phosphorylate the proteins that relay repression through the SB1 element in 293 cells. Alternatively, PKC activity may be more susceptible to inhibition in 293 cells. Consistent with this view, the expression of the adenovirus E1a gene can promote a relocalization of PKC to membranes (83).

Based on these observations, we are now testing the impact of a battery of chemotherapeutic agents on the alternative splicing of Bcl-x and other genes in a variety of cell lines. In addition to helping in uncovering networks of splicing regulation, this approach may reveal cancer-specific differences in abilities to couple signaling events with splicing decisions.


arrow
ACKNOWLEDGMENTS
 
We thank Catherine Desrosiers for the production of various polymerases. We thank Uli Froehlich and the Laboratory of Functional Genomics of the Université de Sherbrooke for their helpful contribution.

This study was supported initially by a grant from National Cancer Institute of Canada and later by a grant from the Canadian Institute of Health Research. B.C. is a Canada Research Chair in Functional Genomics.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: RNA/RNP Group, Département de Microbiologie et d'Infectiologie, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec, Canada J1H 5N4. Phone: (819) 564-5295. Fax: (819) 564-5392. E-mail: Benoit.Chabot{at}USherbrooke.ca Back

{triangledown} Published ahead of print on 8 October 2007. Back


arrow
REFERENCES
 
    1
  1. Aaltonen, V., J. Koivunen, M. Laato, and J. Peltonen. 2006. Heterogeneity of cellular proliferation within transitional cell carcinoma: correlation of protein kinase C alpha/betaI expression and activity. J. Histochem. Cytochem. 54:795-806.[Abstract/Free Full Text]
    2. 2
  2. An, P., and P. J. Grabowski. 2007. Exon silencing by UAGG motifs in response to neuronal excitation. PLos Biol. 5:e36.[CrossRef][Medline]
    3. 3
  3. Ares, M., Jr. 2007. Sing the genome electric: excited cells adjust their splicing. PLoS Biol. 5:e55.[CrossRef][Medline]
    4. 4
  4. Ayroldi, E., F. D'Adamio, O. Zollo, M. Agostini, R. Moraca, L. Cannarile, G. Migliorati, D. V. Delfino, and C. Riccardi. 1999. Cloning and expression of a short Fas ligand: a new alternatively spliced product of the mouse Fas ligand gene. Blood 94:3456-3467.[Abstract/Free Full Text]
    5. 5
  5. Ballou, L. R., C. P. Chao, M. A. Holness, S. C. Barker, and R. Raghow. 1992. Interleukin-1-mediated PGE2 production and sphingomyelin metabolism. Evidence for the regulation of cyclooxygenase gene expression by sphingosine and ceramide. J. Biol. Chem. 267:20044-20050.[Abstract/Free Full Text]
    6. 6
  6. Belmokhtar, C. A., J. Hillion, and E. Segal-Bendirdjian. 2001. Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene 20:3354-3362.[CrossRef][Medline]
    7. 7
  7. Black, D. L. 2003. Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem. 72:291-336.[CrossRef][Medline]
    8. 8
  8. Blaustein, M., F. Pelisch, O. A. Coso, M. J. Bissell, A. R. Kornblihtt, and A. Srebrow. 2004. Mammary epithelial-mesenchymal interaction regulates fibronectin alternative splicing via phosphatidylinositol 3-kinase. J. Biol. Chem. 279:21029-21037.[Abstract/Free Full Text]
    9. 9
  9. Blaustein, M., F. Pelisch, T. Tanos, M. J. Munoz, D. Wengier, L. Quadrana, J. R. Sanford, J. P. Muschietti, A. R. Kornblihtt, J. F. Caceres, O. A. Coso, and A. Srebrow. 2005. Concerted regulation of nuclear and cytoplasmic activities of SR proteins by AKT. Nat. Struct. Mol. Biol. 12:1037-1044.[CrossRef][Medline]
    10. 10
  10. Bolduc, L., B. Labrecque, M. Cordeau, M. Blanchette, and B. Chabot. 2001. Dimethyl sulfoxide affects the selection of splice sites. J. Biol. Chem. 276:17597-17602.[Abstract/Free Full Text]
    11. 11
  11. Cascino, I., G. Papoff, A. Eramo, and G. Ruberti. 1996. Soluble Fas/Apo-1 splicing variants and apoptosis. Front. Biosci. 1:d12-d18.[Medline]
    12. 12
  12. Casciola-Rosen, L. A., D. K. Miller, G. J. Anhalt, and A. Rosen. 1994. Specific cleavage of the 70-kDa protein component of the U1 small nuclear ribonucleoprotein is a characteristic biochemical feature of apoptotic cell death. J. Biol. Chem. 269:30757-30760.[Abstract/Free Full Text]
    13. 13
  13. Chalfant, C. E., B. Ogretmen, S. Galadari, B. J. Kroesen, B. J. Pettus, and Y. A. Hannun. 2001. FAS activation induces dephosphorylation of SR proteins; dependence on the de novo generation of ceramide and activation of protein phosphatase 1. J. Biol. Chem. 276:44848-44855.[Abstract/Free Full Text]
    14. 14
  14. Chalfant, C. E., K. Rathman, R. L. Pinkerman, R. E. Wood, L. M. Obeid, B. Ogretmen, and Y. A. Hannun. 2002. De novo ceramide regulates the alternative splicing of caspase 9 and Bcl-x in A549 lung adenocarcinoma cells. Dependence on protein phosphatase-1. J. Biol. Chem. 277:12587-12595.[Abstract/Free Full Text]
    15. 15
  15. Chang, B. S., A. Kelekar, M. H. Harris, J. E. Harlan, S. W. Fesik, and C. B. Thompson. 1999. The BH3 domain of Bcl-x(S) is required for inhibition of the antiapoptotic function of Bcl-x(L). Mol. Cell. Biol. 19:6673-6681.[Abstract/Free Full Text]
    16. 16
  16. Charlet, B. N., P. Logan, G. Singh, and T. A. Cooper. 2002. Dynamic antagonism between ETR-3 and PTB regulates cell type-specific alternative splicing. Mol. Cell 9:649-658.[CrossRef][Medline]
    17. 17
  17. Cheng, C., M. B. Yaffe, and P. A. Sharp. 2006. A positive feedback loop couples Ras activation and CD44 alternative splicing. Genes Dev. 20:1715-1720.[Abstract/Free Full Text]
    18. 18
  18. Cheng, E. H., M. C. Wei, S. Weiler, R. A. Flavell, T. W. Mak, T. Lindsten, and S. J. Korsmeyer. 2001. BCL-2, BCL-X(L) sequester BH3 domain-only molecules preventing BAX- and BAK-mediated mitochondrial apoptosis. Mol. Cell 8:705-711.[CrossRef][Medline]
    19. 19
  19. Cifone, M. G., R. De Maria, P. Roncaioli, M. R. Rippo, M. Azuma, L. L. Lanier, A. Santoni, and R. Testi. 1994. Apoptotic signaling through CD95 (Fas/Apo-1) activates an acidic sphingomyelinase. J. Exp. Med. 180:1547-1552.[Abstract/Free Full Text]
    20. 20
  20. Degen, W. G., Y. Aarssen, G. J. Pruijn, P. J. Utz, and W. J. van Venrooij. 2000. The fate of U1 snRNP during anti-Fas induced apoptosis: specific cleavage of the U1 snRNA molecule. Cell Death Differ. 7:70-79.[CrossRef][Medline]
    21. 21
  21. Dominski, Z., and R. Kole. 1991. Selection of splice sites in pre-mRNAs with short internal exons. Mol. Cell. Biol. 11:6075-6083.[Abstract/Free Full Text]
    22. 22
  22. Fischer, U., R. U. Janicke, and K. Schulze-Osthoff. 2003. Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death Differ. 10:76-100.[CrossRef][Medline]
    23. 23
  23. Garneau, D., T. Revil, J. F. Fisette, and B. Chabot. 2005. Heterogeneous nuclear ribonucleoprotein F/H proteins modulate the alternative splicing of the apoptotic mediator Bcl-x. J. Biol. Chem. 280:22641-22650.[Abstract/Free Full Text]
    24. 24
  24. Ghosh, N., N. Patel, K. Jiang, J. E. Watson, J. Cheng, C. E. Chalfant, and D. R. Cooper. 2007. Ceramide-activated protein phosphatase involvement in insulin resistance via Akt, serine/arginine-rich protein 40, and ribonucleic acid splicing in L6 skeletal muscle cells. Endocrinology 148:1359-1366.[Abstract/Free Full Text]
    25. 25
  25. Ginestier-Verne, C., M. T. Chateau, and J. P. Bureau. 1996. Implication of tyrosine kinases and protein kinase C in dimethyl sulfoxide-induced apoptosis. Anal. Cell Pathol. 11:115-126.[Medline]
    26. 26
  26. Giuliano, M., G. Bellavia, M. Lauricella, A. D'Anneo, B. Vassallo, R. Vento, and G. Tesoriere. 2004. Staurosporine-induced apoptosis in Chang liver cells is associated with down-regulation of Bcl-2 and Bcl-XL. Int. J. Mol. Med. 13:565-571.[Medline]
    27. 27
  27. Graveley, B. R. 2000. Sorting out the complexity of SR protein functions. RNA 6:1197-1211.[CrossRef][Medline]
    28. 28
  28. Green, J., M. Ikram, J. Vyas, N. Patel, C. M. Proby, L. Ghali, I. M. Leigh, E. A. O'Toole, and A. Storey. 2006. Overexpression of the Axl tyrosine kinase receptor in cutaneous SCC-derived cell lines and tumours. Br. J. Cancer 94:1446-1451.[CrossRef][Medline]
    29. 29
  29. Gromak, N., A. Rideau, J. Southby, A. D. Scadden, C. Gooding, S. Huttelmaier, R. H. Singer, and C. W. Smith. 2003. The PTB interacting protein raver1 regulates alpha-tropomyosin alternative splicing. EMBO J. 22:6356-6364.[CrossRef][Medline]
    30. 30
  30. Guil, S., J. C. Long, and J. F. Caceres. 2006. hnRNP A1 relocalization to the stress granules reflects a role in the stress response. Mol. Cell. Biol. 26:5744-5758.[Abstract/Free Full Text]
    31. 31
  31. Hannun, Y. A. 1994. The sphingomyelin cycle and the second messenger function of ceramide. J. Biol. Chem. 269:3125-3128.[Free Full Text]
    32. 32
  32. Holland, S. J., M. J. Powell, C. Franci, E. W. Chan, A. M. Friera, R. E. Atchison, J. McLaughlin, S. E. Swift, E. S. Pali, G. Yam, S. Wong, J. Lasaga, M. R. Shen, S. Yu, W. Xu, Y. Hitoshi, J. Bogenberger, J. E. Nor, D. G. Payan, and J. B. Lorens. 2005. Multiple roles for the receptor tyrosine kinase Axl in tumor formation. Cancer Res. 65:9294-9303.[Abstract/Free Full Text]
    33. 33
  33. Hsieh, Y. C., H. C. Jao, R. C. Yang, H. K. Hsu, and C. Hsu. 2003. Suppression of protein kinase Calpha triggers apoptosis through down-regulation of Bcl-xL in a rat hepatic epithelial cell line. Shock 19:582-587.[Medline]
    34. 34
  34. Huang, Y., T. A. Yario, and J. A. Steitz. 2004. A molecular link between SR protein dephosphorylation and mRNA export. Proc. Natl. Acad. Sci. USA 101:9666-9670.[Abstract/Free Full Text]
    35. 35
  35. Izquierdo, J. M., N. Majos, S. Bonnal, C. Martinez, R. Castelo, R. Guigo, D. Bilbao, and J. Valcarcel. 2005. Regulation of Fas alternative splicing by antagonistic effects of TIA-1 and PTB on exon definition. Mol. Cell 19:475-484.[CrossRef][Medline]
    36. 36
  36. Johnson, J. M., J. Castle, P. Garrett-Engele, Z. Kan, P. M. Loerch, C. D. Armour, R. Santos, E. E. Schadt, R. Stoughton, and D. D. Shoemaker. 2003. Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science 302:2141-2144.[Abstract/Free Full Text]
    37. 37
  37. Kim, M. Y., C. Linardic, L. Obeid, and Y. Hannun. 1991. Identification of sphingomyelin turnover as an effector mechanism for the action of tumor necrosis factor alpha and gamma-interferon. Specific role in cell differentiation. J. Biol. Chem. 266:484-489.[Abstract/Free Full Text]
    38. 38
  38. Kobayashi, E., H. Nakano, M. Morimoto, and T. Tamaoki. 1989. Calphostin C (UCN-1028C), a novel microbial compound, is a highly potent and specific inhibitor of protein kinase C. Biochem. Biophys. Res. Commun. 159:548-553.[CrossRef][Medline]
    39. 39
  39. Koivunen, J., V. Aaltonen, S. Koskela, P. Lehenkari, M. Laato, and J. Peltonen. 2004. Protein kinase C alpha/beta inhibitor Go6976 promotes formation of cell junctions and inhibits invasion of urinary bladder carcinoma cells. Cancer Res. 64:5693-5701.[Abstract/Free Full Text]
    40. 40
  40. Koivunen, J., V. Aaltonen, and J. Peltonen. 2006. Protein kinase C (PKC) family in cancer progression. Cancer Lett. 235:1-10.[CrossRef][Medline]
    41. 41
  41. Konig, H., H. Ponta, and P. Herrlich. 1998. Coupling of signal transduction to alternative pre-mRNA splicing by a composite splice regulator. EMBO J. 17:2904-2913.[CrossRef][Medline]
    42. 42
  42. Lai, M. C., R. I. Lin, and W. Y. Tarn. 2003. Differential effects of hyperphosphorylation on splicing factor SRp55. Biochem. J. 371:937-945.[CrossRef][Medline]
    43. 43
  43. Langzam, L., R. Koren, R. Gal, V. Kugel, A. Paz, A. Farkas, and S. R. Sampson. 2001. Patterns of protein kinase C isoenzyme expression in transitional cell carcinoma of bladder. Relation to degree of malignancy. Am. J. Clin. Pathol. 116:377-385.[Abstract/Free Full Text]
    44. 44
  44. Lazebnik, Y. A., S. H. Kaufmann, S. Desnoyers, G. G. Poirier, and W. C. Earnshaw. 1994. Cleavage of poly(ADP-ribose) polymerase by a proteinase with properties like ICE. Nature 371:346-347.[CrossRef][Medline]
    45. 45
  45. Lee, J.-A., Y. Xing, D. Nguyen, J. Xie, C. J. Lee, and D. L. Black. 2007. Depolarization and CaM kinase IV modulate NMDA receptor splicing through two essential RNA elements. PLoS Biol. 5:e40.[CrossRef][Medline]
    46. 46
  46. Lee, J. Y., Y. A. Hannun, and L. M. Obeid. 1996. Ceramide inactivates cellular protein kinase Calpha. J. Biol. Chem. 271:13169-13174.[Abstract/Free Full Text]
    47. 47
  47. Lee, W. P., Y. Liao, D. Robinson, H. J. Kung, E. T. Liu, and M. C. Hung. 1999. Axl-Gas6 interaction counteracts E1A-mediated cell growth suppression and proapoptotic activity. Mol. Cell. Biol. 19:8075-8082.[Abstract/Free Full Text]
    48. 48
  48. Leirdal, M., and M. Sioud. 1999. Ribozyme inhibition of the protein kinase C alpha triggers apoptosis in glioma cells. Br. J. Cancer 80:1558-1564.[CrossRef][Medline]
    49. 49
  49. Lemaire, R., A. Winne, M. Sarkissian, and R. Lafyatis. 1999. SF2 and SRp55 regulation of CD45 exon 4 skipping during T cell activation. Eur. J. Immunol. 29:823-837.[CrossRef][Medline]
    50. 50
  50. Li, C. Y., J. Y. Chu, J. K. Yu, X. Q. Huang, X. J. Liu, L. Shi, Y. C. Che, and J. Y. Xie. 2004. Regulation of alternative splicing of Bcl-x by IL-6, GM-CSF and TPA. Cell Res. 14:473-479.[CrossRef][Medline]
    51. 51
  51. Lindenboim, L., C. Borner, and R. Stein. 2001. Bcl-x(S) can form homodimers and heterodimers and its apoptotic activity requires localization of Bcl-x(S) to the mitochondria and its BH3 and loop domains. Cell Death Differ. 8:933-942.[CrossRef][Medline]
    52. 52
  52. Liscovitch, M. 1992. Crosstalk among multiple signal-activated phospholipases. Trends Biochem. Sci. 17:393-399.[CrossRef][Medline]
    53. 53
  53. Lynch, K. W., and A. Weiss. 2000. A model system for activation-induced alternative splicing of CD45 pre-mRNA in T cells implicates protein kinase C and Ras. Mol. Cell. Biol. 20:70-80.[Abstract/Free Full Text]
    54. 54
  54. Martinez-Contreras, R., J. F. Fisette, P. Cloutier, T. Revil, L. Shkreta, and B. Chabot. hnRNP proteins and splicing control. In B. J. Blencowe and B. R. Graveley (ed.), Alternative splicing in the postgenomic era, in press. Landes Bioscience, Austin, TX.
    55. 55
  55. Martiny-Baron, G., M. G. Kazanietz, H. Mischak, P. M. Blumberg, G. Kochs, H. Hug, D. Marme, and C. Schachtele. 1993. Selective inhibition of protein kinase C isozymes by the indolocarbazole Go 6976. J. Biol. Chem. 268:9194-9197.[Abstract/Free Full Text]
    56. 56
  56. Massiello, A., J. R. Roesser, and C. E. Chalfant. 2006. SAP155 binds to ceramide-responsive RNA cis-element 1 and regulates the alternative 5' splice site selection of Bcl-x pre-mRNA. FASEB J. 20:1680-1682.[Abstract/Free Full Text]
    57. 57
  57. Massiello, A., A. Salas, R. L. Pinkerman, P. Roddy, J. R. Roesser, and C. E. Chalfant. 2004. Identification of two RNA cis-elements that function to regulate the 5' splice site selection of Bcl-x pre-mRNA in response to ceramide. J. Biol. Chem. 279:15799-15804.[Abstract/Free Full Text]
    58. 58
  58. Matlin, A. J., F. Clark, and C. W. Smith. 2005. Understanding alternative splicing: towards a cellular code. Nat. Rev. Mol. Cell Biol. 6:386-398.[CrossRef][Medline]
    59. 59
  59. Matter, N., P. Herrlich, and H. Konig. 2002. Signal-dependent regulation of splicing via phosphorylation of Sam68. Nature 420:691-695.[CrossRef][Medline]
    60. 60
  60. Novoyatleva, T., Y. Tang, I. Rafalska, and S. Stamm. 2006. Pre-mRNA missplicing as a cause of human disease. Prog. Mol. Subcell. Biol. 44:27-46.[Medline]
    61. 61
  61. O'Brian, C. A., R. M. Liskamp, D. H. Solomon, and I. B. Weinstein. 1985. Inhibition of protein kinase C by tamoxifen. Cancer Res. 45:2462-2465.[Abstract/Free Full Text]
    62. 62
  62. Okazaki, T., R. M. Bell, and Y. A. Hannun. 1989. Sphingomyelin turnover induced by vitamin D3 in HL-60 cells. Role in cell differentiation. J. Biol. Chem. 264:19076-19080.[Abstract/Free Full Text]
    63. 63
  63. Paronetto, M. P., T. Achsel, A. Massiello, C. E. Chalfant, and C. Sette. 2007. The RNA-binding protein Sam68 modulates the alternative splicing of Bcl-x. J. Cell Biol. 176:929-939.[Abstract/Free Full Text]
    64. 64
  64. Patel, N. A., S. Kaneko, H. S. Apostolatos, S. S. Bae, J. E. Watson, K. Davidowitz, D. S. Chappell, M. J. Birnbaum, J. Q. Cheng, and D. R. Cooper. 2005. Molecular and genetic studies imply Akt-mediated signaling promotes protein kinase CbetaII alternative splicing via phosphorylation of serine/arginine-rich splicing factor SRp40. J. Biol. Chem. 280:14302-14309.[Abstract/Free Full Text]
    65. 65
  65. Patel, N. A., S. S. Song, and D. R. Cooper. 2006. PKCdelta alternatively spliced isoforms modulate cellular apoptosis in retinoic acid-induced differentiation of human NT2 cells and mouse embryonic stem cells. Gene Expr. 13:73-84.[Medline]
    66. 66
  66. Pecci, A., L. R. Viegas, J. L. Baranao, and M. Beato. 2001. Promoter choice influences alternative splicing and determines the balance of isoforms expressed from the mouse bcl-X gene. J. Biol. Chem. 276:21062-21069.[Abstract/Free Full Text]
    67. 67
  67. Pelisch, F., M. Blaustein, A. R. Kornblihtt, and A. Srebrow. 2005. Cross-talk between signaling pathways regulates alternative splicing: a novel role for JNK. J. Biol. Chem. 280:25461-25469.[Abstract/Free Full Text]
    68. 68
  68. Pilch, B., E. Allemand, M. Facompre, C. Bailly, J. F. Riou, J. Soret, and J. Tazi. 2001. Specific inhibition of serine- and arginine-rich splicing factors phosphorylation, spliceosome assembly, and splicing by the antitumor drug NB-506. Cancer Res. 61:6876-6884.[Abstract/Free Full Text]
    69. 69
  69. Pollock, A. S., J. Turck, and D. H. Lovett. 2003. The prodomain of interleukin 1alpha interacts with elements of the RNA processing apparatus and induces apoptosis in malignant cells. FASEB J. 17:203-213.[Abstract/Free Full Text]
    70. 70
  70. Prasad, J., K. Colwill, T. Pawson, and J. L. Manley. 1999. The protein kinase Clk/Sty directly modulates SR protein activity: both hyper- and hypophosphorylation inhibit splicing. Mol. Cell. Biol. 19:6991-7000.[Abstract/Free Full Text]
    71. 71
  71. Quintans, J., J. Kilkus, C. L. McShan, A. R. Gottschalk, and G. Dawson. 1994. Ceramide mediates the apoptotic response of WEHI 231 cells to anti-immunoglobulin, corticosteroids and irradiation. Biochem. Biophys. Res. Commun. 202:710-714.[CrossRef][Medline]
    72. 72
  72. Rosenberger, U., I. Lehmann, C. Weise, P. Franke, F. Hucho, and K. Buchner. 2002. Identification of PSF as a protein kinase Calpha-binding protein in the cell nucleus. J. Cell Biochem. 86:394-402.[CrossRef][Medline]
    73. 73
  73. Rothrock, C., B. Cannon, B. Hahm, and K. W. Lynch. 2003. A conserved signal-responsive sequence mediates activation-induced alternative splicing of CD45. Mol. Cell 12:1317-1324.[CrossRef][Medline]
    74. 74
  74. Rothrock, C. R., A. E. House, and K. W. Lynch. 2005. HnRNP L represses exon splicing via a regulated exonic splicing silencer. EMBO J. 24:2792-2802.[CrossRef][Medline]
    75. 75
  75. Ruegg, U. T., and G. M. Burgess. 1989. Staurosporine, K-252 and UCN-01: potent but nonspecific inhibitors of protein kinases. Trends Pharmacol. Sci. 10:218-220.[CrossRef][Medline]
    76. 76
  76. Sanford, J. R., D. Longman, and J. F. Caceres. 2003. Multiple roles of the SR protein family in splicing regulation. Prog. Mol. Subcell. Biol. 31:33-58.[Medline]
    77. 77
  77. Savickiene, J., A. Gineitis, and T. Stigbrand. 1999. Modulation of apoptosis of proliferating and differentiating HL-60 cells by protein kinase inhibitors: suppression of PKC or PKA differently affects cell differentiation and apoptosis. Cell Death Differ. 6:698-709.[CrossRef][Medline]
    78. 78
  78. Schwerk, C., and K. Schulze-Osthoff. 2005. Regulation of apoptosis by alternative pre-mRNA splicing. Mol. Cell 19:1-13.[Medline]
    79. 79
  79. Shankar, S. L., K. O'Guin, M. Kim, B. Varnum, G. Lemke, C. F. Brosnan, and B. Shafit-Zagardo. 2006. Gas6/Axl signaling activates the phosphatidylinositol 3-kinase/Akt1 survival pathway to protect oligodendrocytes from tumor necrosis factor alpha-induced apoptosis. J. Neurosci. 26:5638-5648.[Abstract/Free Full Text]
    80. 80
  80. Shi, Y., B. Reddy, and J. L. Manley. 2006. PP1/PP2A phosphatases are required for the second step of Pre-mRNA splicing and target specific snRNP proteins. Mol. Cell 23:819-829.[CrossRef][Medline]
    81. 81
  81. Shieh, Y. S., C. Y. Lai, Y. R. Kao, S. G. Shiah, Y. W. Chu, H. S. Lee, and C. W. Wu. 2005. Expression of axl in lung adenocarcinoma and correlation with tumor progression. Neoplasia 7:1058-1064.[CrossRef][Medline]
    82. 82
  82. Shin, C., and J. L. Manley. 2004. Cell signalling and the control of pre-mRNA splicing. Nat. Rev. Mol. Cell Biol. 5:727-738.[CrossRef][Medline]
    83. 83
  83. Shiroki, K., A. Yamakawa, M. Shibata, T. Takenawa, S. Sugano, and A. Nomoto. 1992. Adenovirus E1A proteins stimulate inositol phospholipid metabolism in PC12 cells. J. Virol. 66:6093-6098.[Abstract/Free Full Text]
    84. 84
  84. Smith, C. W., and J. Valcarcel. 2000. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem. Sci. 25:381-388.[CrossRef][Medline]
    85. 85
  85. Srebrow, A., and A. R. Kornblihtt. 2006. The connection between splicing and cancer. J. Cell Sci. 119:2635-2641.[Abstract/Free Full Text]
    86. 86
  86. Stepczynska, A., K. Lauber, I. H. Engels, O. Janssen, D. Kabelitz, S. Wesselborg, and K. Schulze-Osthoff. 2001. Staurosporine and conventional anticancer drugs induce overlapping, yet distinct pathways of apoptosis and caspase activation. Oncogene 20:1193-1202.[CrossRef][Medline]
    87. 87
  87. Tacke, R., Y. Chen, and J. L. Manley. 1997. Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer. Proc. Natl. Acad. Sci. USA 94:1148-1153.[Abstract/Free Full Text]
    88. 88
  88. ten Dam, G. B., C. F. Zilch, D. Wallace, B. Wieringa, P. C. Beverley, L. G. Poels, and G. R. Screaton. 2000. Regulation of alternative splicing of CD45 by antagonistic effects of SR protein splicing factors. J. Immunol. 164:5287-5295.[Abstract/Free Full Text]
    89. 89
  89. van der Houven van Oordt, W., M. T. Diaz-Meco, J. Lozano, A. R. Krainer, J. Moscat, and J. F. Caceres. 2000. The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J. Cell Biol. 149:307-316.[Abstract/Free Full Text]
    90. 90
  90. van Ginkel, P. R., R. L. Gee, R. L. Shearer, L. Subramanian, T. M. Walker, D. M. Albert, L. F. Meisner, B. C. Varnum, and A. S. Polans. 2004. Expression of the receptor tyrosine kinase Axl promotes ocular melanoma cell survival. Cancer Res. 64:128-134.[Abstract/Free Full Text]
    91. 91
  91. Varga, A., G. Czifra, B. Tallai, T. Nemeth, I. Kovacs, L. Kovacs, and T. Biro. 2004. Tumor grade-dependent alterations in the protein kinase C isoform pattern in urinary bladder carcinomas. Eur. Urol. 46:462-465.[Medline]
    92. 92
  92. Viegas, L. R., G. P. Vicent, J. L. Baranao, M. Beato, and A. Pecci. 2004. Steroid hormones induce bcl-X gene expression through direct activation of distal promoter P4. J. Biol. Chem. 279:9831-9839.[Abstract/Free Full Text]
    93. 93
  93. Wu, J. Y., H. Tang, and N. Havlioglu. 2003. Alternative pre-mRNA splicing and regulation of programmed cell death. Prog. Mol. Subcell. Biol. 31:153-185.[Medline]
    94. 94
  94. Yang, H., M. R. Sadda, M. Li, Y. Zeng, L. Chen, W. Bae, X. Ou, M. T. Runnegar, J. M. Mato, and S. C. Lu. 2004. S-adenosylmethionine and its metabolite induce apoptosis in HepG2 cells: role of protein phosphatase 1 and Bcl-x(S). Hepatology 40:221-231.[CrossRef][Medline]
    95. 95
  95. Yang, X., M. R. Bani, S. J. Lu, S. Rowan, Y. Ben-David, and B. Chabot. 1994. The A1 and A1B proteins of heterogeneous nuclear ribonucleoparticles modulate 5' splice site selection in vivo. Proc. Natl. Acad. Sci. USA 91:6924-6928.[Abstract/Free Full Text]
    96. 96
  96. Zhang, W., S. Zheng, P. Storz, and W. Min. 2005. Protein kinase D specifically mediates apoptosis signal-regulating kinase 1-JNK signaling induced by H2O2 but not tumor necrosis factor. J. Biol. Chem. 280:19036-19044.[Abstract/Free Full Text]
    97. 97
  97. Zhang, X. D., S. K. Gillespie, and P. Hersey. 2004. Staurosporine induces apoptosis of melanoma by both caspase-dependent and -independent apoptotic pathways. Mol. Cancer Ther. 3:187-197.[Abstract/Free Full Text]
    98. 98
  98. Zinck, R., M. A. Cahill, M. Kracht, C. Sachsenmaier, R. A. Hipskind, and A. Nordheim. 1995. Protein synthesis inhibitors reveal differential regulation of mitogen-activated protein kinase and stress-activated protein kinase pathways that converge on Elk-1. Mol. Cell. Biol. 15:4930-4938.[Abstract]

Molecular and Cellular Biology, December 2007, p. 8431-8441, Vol. 27, No. 24
0270-7306/07/$08.00+0     doi:10.1128/MCB.00565-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Revil, T., Pelletier, J., Toutant, J., Cloutier, A., Chabot, B. (2009). Heterogeneous Nuclear Ribonucleoprotein K Represses the Production of Pro-apoptotic Bcl-xS Splice Isoform. J. Biol. Chem. 284: 21458-21467 [Abstract] [Full Text]  
  • Venables, J. P., Koh, C.-S., Froehlich, U., Lapointe, E., Couture, S., Inkel, L., Bramard, A., Paquet, E. R., Watier, V., Durand, M., Lucier, J.-F., Gervais-Bird, J., Tremblay, K., Prinos, P., Klinck, R., Elela, S. A., Chabot, B. (2008). Multiple and Specific mRNA Processing Targets for the Major Human hnRNP Proteins. Mol. Cell. Biol. 28: 6033-6043 [Abstract] [Full Text]  
  • Zhou, A., Ou, A. C., Cho, A., Benz, E. J. Jr., Huang, S.-C. (2008). Novel Splicing Factor RBM25 Modulates Bcl-x Pre-mRNA 5' Splice Site Selection. Mol. Cell. Biol. 28: 5924-5936 [Abstract] [Full Text]  
  • Cloutier, P., Toutant, J., Shkreta, L., Goekjian, S., Revil, T., Chabot, B. (2008). Antagonistic Effects of the SRp30c Protein and Cryptic 5 ' Splice Sites on the Alternative Splicing of the Apoptotic Regulator Bcl-x. J. Biol. Chem. 283: 21315-21324 [Abstract] [Full Text]  
  • Hai, Y., Cao, W., Liu, G., Hong, S.-P., Elela, S. A., Klinck, R., Chu, J., Xie, J. (2008). A G-tract element in apoptotic agents-induced alternative splicing. Nucleic Acids Res 36: 3320-3331 [Abstract] [Full Text]  
  • Shkreta, L., Froehlich, U., Paquet, E. R., Toutant, J., Elela, S. A., Chabot, B. (2008). Anticancer drugs affect the alternative splicing of Bcl-x and other human apoptotic genes. Molecular Cancer Therapeutics 7: 1398-1409 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Revil, T.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Revil, T.
Right arrow Articles by Chabot, B.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»