This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balagopalan, L.
Right arrow Articles by Samelson, L. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balagopalan, L.
Right arrow Articles by Samelson, L. E.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, December 2007, p. 8622-8636, Vol. 27, No. 24
0270-7306/07/$08.00+0     doi:10.1128/MCB.00467-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

c-Cbl-Mediated Regulation of LAT-Nucleated Signaling Complexes{triangledown} ,{dagger}

Lakshmi Balagopalan, Valarie A. Barr, Connie L. Sommers, Mira Barda-Saad,{ddagger} Amrita Goyal, Matthew S. Isakowitz, and Lawrence E. Samelson*

Laboratory of Cellular and Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland

Received 19 March 2007/ Returned for modification 8 May 2007/ Accepted 27 September 2007


arrow
ABSTRACT
 
The engagement of the T-cell receptor (TCR) causes the rapid recruitment of multiple signaling molecules into clusters with the TCR. Upon receptor activation, the adapters LAT and SLP-76, visualized as chimeric proteins tagged with yellow fluorescent protein, transiently associate with and then rapidly dissociate from the TCR. Previously, we demonstrated that after recruitment into signaling clusters, SLP-76 is endocytosed in vesicles via a lipid raft-dependent pathway that requires the interaction of the endocytic machinery with ubiquitylated proteins. In this study, we focus on LAT and demonstrate that signaling clusters containing this adapter are internalized into distinct intracellular compartments and dissipate rapidly upon TCR activation. The internalization of LAT was inhibited in cells expressing versions of the ubiquitin ligase c-Cbl mutated in the RING domain and in T cells from mice lacking c-Cbl. Moreover, c-Cbl RING mutant forms suppressed LAT ubiquitylation and caused an increase in cellular LAT levels, as well as basal and TCR-induced levels of phosphorylated LAT. Collectively, these data indicate that following the rapid formation of signaling complexes upon TCR stimulation, c-Cbl activity is involved in the internalization and possible downregulation of a subset of activated signaling molecules.


arrow
INTRODUCTION
 
The engagement of the multisubunit T-cell receptor (TCR) is rapidly followed by the activation of protein tyrosine kinases (PTKs) that phosphorylate a number of downstream substrates, of which a prominent example is LAT, a transmembrane adapter protein. Phosphorylated tyrosines on LAT serve as docking sites for multiple proteins containing Src homology 2 domains, including adapters such as Gads and Grb2 (51, 53), which in turn are associated with other signaling proteins. For example, SLP-76 is recruited to LAT through association with Gads (48). The LAT-Gads-SLP-76 complex creates a platform for the recruitment of numerous other signaling molecules, including phospholipase C-{gamma}1 (PLC-{gamma}1), the Rho family GTPase exchange factor Vav, and the ubiquitin ligase Cbl (48). Thus, TCR engagement induces the formation of LAT-based signaling complexes that initiate intracellular signals required for T-cell activation.

Modern imaging techniques have given us insights into the dynamics of signaling proteins within a single cell. Studies from our lab using immobilized stimulatory antibodies binding the TCR showed that the TCR-rich microclusters form within seconds of activation and rapidly recruit several other signaling proteins (5, 8, 10). Similar microclusters have been observed in T cells activated by antigen-presenting lipid bilayers and antigen-presenting cells (11, 49). Importantly, microclusters are the principal sites of TCR-induced tyrosine phosphorylation and form coincident with the initial calcium response in a T cell, indicating that signaling is initiated at these clusters (10, 11).

To ensure an appropriate immune response to antigenic challenge, without generating an autoimmune response, it is crucial that T-cell activation be tightly regulated. TCR engagement activates several mechanisms that have been described to attenuate TCR-mediated signaling (46), including ligand-induced internalization and degradation of activated signaling molecules (25). For example, c-Cbl-mediated ubiquitin conjugation to the TCR{zeta} chain has been correlated with TCR internalization into endosomal compartments and the subsequent degradation of the receptor in activated T cells (17). In addition, Cbl proteins downregulate PTKs such as Lck, Fyn, and ZAP-70 (3, 34, 42), as well as non-PTK molecules such as the p85 subunit of phosphatidylinositol 3-kinase and the guanine nucleotide exchange factor Vav (16, 30). Furthermore, in anergic T cells, Cbl-b-mediated ubiquitylation is thought to contribute to early destabilization of the immune synapse and therefore lead to decreased signaling (21, 26). Thus, Cbl-mediated protein ubiquitylation in T cells has emerged as an important mechanism to attenuate the T-cell response.

While most studies on internalization as a means of signal downregulation in T cells have focused on the fate of the TCR, results from studies tracking individual components of TCR-induced microclusters in real time suggest that the fates of the TCR and signaling proteins diverge during T-cell activation. In systems using either stimulatory antibodies or lipid bilayers to model T-cell activation, whereas microclusters contain both the TCR and signaling molecules initially, signaling molecules dissociate from the receptor soon thereafter (10, 11, 15, 49). Consistent with these observations, immunoelectron microscopy analysis of mast cells has shown that upon activation, mast cell membranes are organized into primary signaling domains, which are formed around the Fc{varepsilon} receptor I and associate with clathrin-coated pits, and secondary signaling domains, which are organized around LAT and do not include the receptor or coated pits (47). Thus, at least in some cell types, receptor and LAT-nucleated signaling domains are discrete, and the internalization of proteins in the two domains appears to be regulated by distinct mechanisms. Although numerous studies have examined receptor internalization, not much is known about the internalization and fate of signaling molecules, such as LAT and SLP-76. A recent study from our group demonstrated that the cytosolic adapter molecule SLP-76 is endocytosed in vesicles that also contain a percentage of cellular LAT. SLP-76 endocytosis occurs through a lipid raft-dependent pathway that requires the association of the endocytic machinery with ubiquitylated proteins (6). Of interest, a recent study reported that LAT is a target of ubiquitylation (9), raising the possibility that LAT may be the ubiquitylated component that drives the internalization of the LAT-SLP-76 complex. A previous study from this group demonstrated that LAT is observed in endosomal compartments (7). However, the correlation between LAT ubiquitylation and LAT internalization remains unclear.

In the present study, we demonstrate that upon TCR activation, LAT-containing signaling clusters are internalized into various distinct intracellular compartments prior to dissipating rapidly. To investigate the molecular mechanism that regulates both the internalization and dissipation of signaling clusters, we examined the role of the ubiquitin ligase c-Cbl in signaling complex internalization. We expressed versions of c-Cbl that were defective in the RING finger domain, which mediates ubiquitin ligase activity, and assessed their effect on the trafficking of TCR-induced protein complexes. The expression of ligase-defective Cbl mutants resulted in severely decreased internalization of LAT and SLP-76 clusters, decreased ubiquitylation of LAT, and an increase in basal LAT levels, as well as elevated basal and TCR-induced phosphorylated LAT (pLAT) levels. The inhibition of LAT internalization was also observed in T cells from mice lacking c-Cbl. Our data are consistent with a model in which TCR-mediated activation first leads to the rapid formation of signaling complexes, after which c-Cbl activity is involved in the internalization and possible downregulation of a subset of activated signaling molecules.


arrow
MATERIALS AND METHODS
 
Reagents. The following antibodies were used to coat coverslips: mouse anti-CD3{varepsilon}, anti-CD28, and anti-CD4 and human anti-CD3{varepsilon} (UCHT or HIT3a) were all purchased from BD Pharmingen. OKT3 against the human CD3{varepsilon} chain was used to trigger T-cell activation. The following antibodies were used for immunofluorescence: anti-c-Cbl (BD Transduction Labs), rabbit anti-LAT (described in reference 51), antibodies to LAT phosphorylated at tyrosine 191 and to ZAP-70 phosphorylated at tyrosine 315 and 319 (Biosource International), antiphosphotyrosine (anti-pY) 4G10 (Upstate), anti-SLP-76 (Antibody Solutions), and anti-TCR{zeta} 6B10 (Santa Cruz Biotechnologies). The following antibodies were used for Western blotting and immunoprecipitation: antihemagglutinin (anti-HA)-horseradish peroxidase (Roche), mouse anti-LAT (Upstate), anti-c-Cbl (BD Transduction Labs), anti-glyceraldehyde-3-phosphate dexhydroxygenase (anti-GAPDH; Biodesign International), and antibody to LAT phosphorylated at tyrosine 191 (Biosource International). Isotype-specific secondary antibodies and Alexa 594-labeled transferrin and cholera toxin subunit B (CTX-B) were obtained from Molecular Probes.

Expression vectors and plasmids. The expression vectors pEYFP-N1 and pECFP-N1 were obtained from Clontech. The plasmid pCDNA3.1+ Hygro was obtained from Invitrogen. The SLP-yellow fluorescent protein (YFP) and LAT-YFP constructs have been described previously (10). The c-Cbl cDNAs from the pSX HA Cbl and pSX HA 70Z-Cbl constructs described previously (43) were cloned into the pEYFPN1 expression vector to generate the wild-type (WT) Cbl-YFP and the 70Z/3 Cbl-YFP constructs, respectively. For cyan fluorescent protein (CFP)-tagged constructs, the c-Cbl coding sequences were cloned into the pCDNA3.1+ Hygro vector. Point mutations and deletions were introduced into Cbl constructs by using a QuikChange II XL site-directed mutagenesis kit (Stratagene). All constructs were verified using DNA sequencing. The following constructs were expressed in COS-7 cells: the HA-tagged ubiquitin plasmid was provided by Dirk Bohmann, and the myc-tagged LAT construct (51) and the pSX FLAG-Cbl construct (43) have been described previously.

Cell culture and transfection of Jurkat T cells. Jurkat E6.1 cells, LAT-deficient JCam2.5 cells, and reconstituted variants of JCam2.5 cells have been described previously (53); ZAP-70-deficient P116 cells and P116 reconstituted variants have also been described previously (44). All Jurkat cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics. For protein expression, Jurkat cells were transfected with the 5- to 10-µg plasmid DNA by using the electroporation system, solution T, and program H-10 from Amaxa Biosystems. Transiently transfected cells were used 24 to 48 h posttransfection. For the generation of stable cell clones, transiently transfected cells were subjected to drug selection, followed by cell sorting. Single-cell clones were then obtained by plating sorted cells at limiting dilutions.

Transfection of murine T cells. Mice used in this study were on the C57BL/6 background. c-Cbl–/– mice have been described previously (32). CD4+ T cells from the lymph nodes of wild-type (WT) C57BL/6, c-Cbl–/–, or c-Cbl–/+ mice were purified by magnetic bead separation as previously described (37). Cells were transfected with LAT-YFP in the case of c-Cbl–/– and c-Cbl–/+ T cells and with WT Cbl-YFP or 70Z/3 Cbl-YFP in the case of the C57BL/6 T cells by using the Amaxa electroporator, the Amaxa kit for primary murine T cells, and program X-01. Cells were stimulated on coverslips 24 h posttransfection and processed as described in "Confocal microscopy" below.

Confocal microscopy. Spreading assays were performed as described previously (10). Briefly, chambered coverslips (LabTek) were coated overnight at 4°C with the stimulatory antibody human anti-CD3{varepsilon} (HIT3a or UCHT at 10 µg/ml) or mouse anti-CD3{varepsilon}, anti-CD4, and anti-CD28 (10 µg/ml each). Cells were plated onto coated coverslips containing imaging buffer (RPMI 1640 without phenol red, 10% fetal calf serum, 20 mM HEPES). Cells were fixed at different time points with 2.4% paraformaldehyde. Immunostaining was performed as described previously (5). Fluorescent images of fixed samples were acquired on a 510 laser-scanning confocal microscope system by using a 63x plan apochromat objective (Carl Zeiss). The movement of fluorescent proteins in live cells was observed with a Zeiss Axiovert 200 microscope equipped with a PerkinElmer Ultraview spinning-disk confocal system (PerkinElmer). Images were captured with an Orca-ERII charge-coupled device camera (Hamamatsu). A hot air blower and an objective warmer were used to maintain live samples at 37°C.

Image processing. IPLab 3.6 (Scanalytics Inc.) was used for most image processing. Movies were prepared from z-stacks by making a maximum-intensity projection for a given time point and then making a sequence of all the projections. Kymographs were made from regions of interest drawn around moving clusters of interest, and the movement of clusters was analyzed using IPLab 3.6. Graphs were prepared with Microsoft Excel. Adobe PhotoShop and Adobe Illustrator (Adobe Systems Inc.) were used to prepare composite figures.

siRNA-mediated depletion of LAT levels. The small interfering RNA (siRNA) corresponding to human LAT and the control nontargeting siRNA pool were purchased from Dharmacon Inc. The SMARTpool duplexes for human LAT were designed to target the following cDNA sequences: SMARTpool duplex 1, GCACAUCCUCAGAUAGUUUUU; duplex 2, CAAACGGCCUCAACGGUUUU; duplex 3, GGACGACUAUCACAACCCAUU; and duplex 4, CCAACAGUGUGGCGAGCUAUU. Briefly, Jurkat cells were transfected with control siRNA or siRNA for LAT (100 µm/5 x 106 cells) by using an Amaxa electroporator, Amaxa solution T, and program H-10. Forty-eight hours after electroporation, cells were lysed in ice-cold lysis buffer containing 1% Brij, 1% octyl-ß-D-glucoside, 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 5 mM EDTA, 1 mM Na3VO4, and a complete protease inhibitor tablet (Roche). Lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene difluoride (PVDF) membrane, and immunoblotted for LAT and GAPDH. Alternatively, cells were plated onto stimulatory coverslips and processed as described under "Confocal microscopy" above.

COS-7 cell transfection, immunoprecipitation, and immunoblotting. COS-7 cells were transfected using Lipofectamine Plus reagent as recommended by the manufacturer (Sigma). Briefly, 60-mm dishes with 70% confluent cell cultures were used for transfection. Cells were cotransfected with plasmids indicated in the figures, and 24 h posttransfection, cells were lysed in ice-cold NP-40 lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 50 mM NaF, 1% NP-40) and cellular lysates were subjected to immunoprecipitation using mouse anti-LAT monoclonal antibody (Upstate). Protein A/G Plus-agarose beads (Santa Cruz Biotechnology) were used for immunoprecipitation. Protein samples were resolved by SDS-PAGE, transferred onto PVDF membrane, and subjected to immunoblotting with primary antibodies followed by enhanced chemiluminescence with a system from Upstate. The denaturation of immunoprecipitated complexes and the reprecipitation of LAT were performed as described previously (27). Briefly, the first immunoprecipitation was performed as described above. The precipitated complex was resuspended and boiled for 5 min in 40 µl of denaturation buffer (20 mM Tris-HCl [pH 7.4], 50 mM NaCl, 5 mM dithiothreitol, 1% SDS, and 1 mM sodium orthovanadate). The denatured sample was diluted to 800 µl with lysis buffer, and the second immunoprecipitation was performed, again as described above.

Cell stimulation and immunoblotting of Jurkat cells. Jurkat E6.1 cells stably expressing LAT-YFP were transiently transfected with CFP, WT Cbl-CFP, or 70Z/3 Cbl-CFP. Twenty-four hours after transfection, cells containing both CFP and YFP were sorted. Sorted cells were washed once with RPMI 1640 without supplements and resuspended to a concentration of 5 x 107 cells/ml. The cells were then treated with anti-CD3 (OKT3 ascites fluid; 1/200) for various time periods and lysed using a twofold excess of hot 2x sample buffer (20 mM Tris-HCl [pH 8.0], 2 mM EDTA, 2 mM Na3VO4, 20 mM dithiothreitol, 2% SDS, and 20% glycerol). The samples were then heated to 95°C for 5 min and sonicated to reduce the viscosity of the solution. To analyze the phosphorylation status of LAT, 2.4 x 105 cell equivalents were separated by SDS-PAGE. Separated proteins were then transferred onto PVDF membrane and immunoblotted for pLAT, total LAT, GAPDH, and HA.

Flow cytometric assays. Cells stably expressing LAT-YFP were transfected with various WT and 70Z/3 Cbl-CFP constructs. Twenty-four hours after transfection, cells were analyzed using a Becton Dickinson FACSVantage SE flow cytometer (Becton Dickinson Inc.). The data were analyzed with FloJo software. Mean LAT-YFP levels (± standard errors of the mean [SEM]) were measured in the CFP+ YFP+ quadrant and were normalized to levels of the CFP vector control.


arrow
RESULTS
 
LAT traffics through distinct intracellular compartments upon T-cell activation. Previous studies from our lab have demonstrated that LAT is recruited to signaling clusters upon TCR stimulation and exits the clusters rapidly (10). To further study the trafficking of LAT, we characterized LAT dynamics using a monomeric YFP-tagged LAT construct (LAT-YFP). We transfected Jurkat E6.1 cells and primary murine CD4+ T cells with LAT-YFP and observed LAT dynamics in both these cell types upon the stimulation of the TCR by using antibody immobilized on coverslips (10). In Jurkat cells, LAT-YFP clusters formed within seconds of initial contact with the coverslip. Cluster formation continued during cell spreading, with rapid dissipation from the initial contact site within 2 to 3 min (Fig. 1A; also see Video S1 in the supplemental material). To confirm that the same events occurred in nontransformed cells, we transfected CD4+ cells isolated from lymph nodes of C57BL/6 mice with LAT-YFP. Cells were dropped onto stimulatory coverslips and fixed at various times after stimulation. Similar to LAT-YFP in Jurkat cells, LAT-YFP was recruited to signaling clusters in cells that had just made contact. The YFP signal then dissipated from the clusters, and once the cell had spread, the majority of LAT-YFP at the clusters had dispersed (Fig. 1B). Although the kinetics was slower in primary cells, LAT-YFP exited signaling clusters rapidly through what appeared to be small vesicles upon TCR-mediated activation in both cell types.


Figure 1
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 1. LAT traffics through intracellular compartments upon stimulation of the TCR. (A) Jurkat E6.1 cells stably expressing LAT-YFP were plated onto antibody-coated coverslips as described in Materials and Methods and visualized with a spinning-disk confocal system (see Video S1 in the supplemental material). An image set made from Z stacks (five sections, 0.5 µm apart) collected after plating onto stimulatory coverslips is shown by displaying selected time points as maximum-intensity projections. (B) Primary murine CD4+ cells were transfected with LAT-YFP and plated onto stimulatory coverslips. Cells were fixed at various time points into the spreading process, as indicated, and confocal images at the coverslip were collected. (C and D) Jurkat E6.1 cells stably expressing LAT-YFP were incubated with transferrin (Tfr) (C) or CTX-B (D) at 4°C to allow binding but prevent the internalization of these markers. Cells were then plated onto stimulatory coverslips maintained at 37°C, causing the rapid internalization of these markers from the membrane, and visualized with a spinning-disk confocal system (see Videos S2 and S3 in the supplemental material). Z stacks (five stacks, 0.5 µm apart) were collected and are displayed as maximum-intensity projections at selected time points. Data are representative of a minimum of two independent experiments.

To analyze where total cellular LAT was distributed following TCR stimulation, we further characterized the localization of LAT within an activated cell. To track internalized LAT, we examined the colocalization of LAT-YFP with cholera toxin and transferrin, two known endocytic markers. Transferrin is a marker for clathrin-mediated endocytosis, while CTX-B is used as a marker for nonclathrin-mediated endocytosis (2, 31). To examine LAT distribution following TCR-mediated activation, cells stably expressing LAT-YFP were incubated with transferrin or CTX-B at 4°C to enable binding but prevent the internalization of these markers. These cells were then plated onto stimulatory coverslips at 37°C, which caused the rapid internalization of these markers from the membrane. As shown in Fig. 1C and D, LAT-YFP-containing vesicles partially colocalized with transferrin-labeled endosomes and CTX-B in vesicular structures before dissipating (see Videos S2 and S3 in the supplemental material). Additionally, a recently published study from our group reported that internalizing SLP-76 vesicles, which are negative for transferrin and CTX-B labeling, contain LAT (6). Thus, upon TCR-mediated activation, LAT-YFP is rapidly internalized and can be seen in at least three kinds of vesicles marked by different proteins: one type of vesicle is positive for transferrin, the second kind is labeled by CTX, and the third contains SLP-76 but neither of the other markers.

Persistence and movement of LAT clusters can be modulated by c-Cbl RING activity. We next sought the molecular mechanism that could mediate both the internalization of LAT and the loss of visible LAT-YFP clusters upon TCR activation. Since the ubiquitin ligase c-Cbl is involved in endocytic trafficking of the TCR and the downregulation of several proteins involved in T-cell signaling (13), we decided to examine whether c-Cbl played a role in LAT cluster internalization and dissipation. Fixed-cell analysis revealed that c-Cbl is recruited to the signaling clusters that contain LAT and SLP-76 upon the activation of the TCR (data not shown) (10). To examine the effect of c-Cbl expression on LAT dynamics in living cells, we transiently transfected E6.1 LAT-YFP cells with either WT Cbl-CFP or 70Z/3 Cbl-CFP, an oncogenic, dominant negative version of c-Cbl with a 17-amino-acid internal deletion in the RING finger domain that abolishes ubiquitin ligase activity (4). Figure 2 shows the movement of LAT-YFP in a cell that has been transfected with CFP vector only (Fig. 2A), a cell coexpressing WT Cbl-CFP (Fig. 2B), or a cell coexpressing 70Z/3 Cbl-CFP (Fig. 2C; see Videos S4 to S6 in the supplemental material). As expected, CFP appeared to be cytosolic and did not get recruited into clusters (Fig. 2A, bottom panels). In comparison, WT Cbl-CFP clustered rapidly at the signaling complexes, and Cbl clusters dissipated soon thereafter (Fig. 2B, bottom panels). In the presence of CFP vector or WT Cbl-CFP, LAT-YFP was rapidly recruited into clusters, after which clusters containing LAT dissipated within 2 min (Fig. 2A and B, top panels). Of note, the central LAT structure that persisted in the cell expressing WT Cbl-CFP (Fig. 2B, top panel) was LAT-YFP localized in the Golgi compartment, as evaluated by colocalization with Golgi markers (data not shown). In contrast, 70Z/3 Cbl-CFP clusters remained visible longer and did not dissipate (Fig. 2C, bottom panels). Remarkably, in cells expressing 70Z/3 Cbl, LAT-YFP clusters persisted, colocalized with 70Z/3 Cbl-CFP clusters for extended periods of time, and failed to translocate (Fig. 2C, top panels).


Figure 2
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 2. c-Cbl RING finger activity is required for the movement and dissipation of LAT-YFP clusters. (A, B, and C) E6.1 LAT-YFP cells were transiently transfected with CFP (A), WT Cbl-CFP (B), or 70Z/3 Cbl-CFP (C). Cells were plated onto stimulatory coverslips and visualized with a spinning-disk confocal system (see Videos S4, S5, and S6 in the supplemental material). Representative image sets from selected time points are shown. (A) In CFP-transfected cells, LAT-YFP clusters move for a short distance and dissipate rapidly. (B) In cells coexpressing WT Cbl-CFP, clusters containing both LAT-YFP (top panel; pseudocolored in green) and WT Cbl-CFP (bottom panel; pseudocolored in red) dissipate rapidly. Of note, the central LAT-YFP structure that persists in the cell expressing WT Cbl-CFP (top panel) is LAT-YFP localized in the Golgi compartment. (C) In cells coexpressing 70Z/3 Cbl-CFP, LAT-YFP (top panel) and 70Z/3 Cbl-CFP (bottom panel) clusters persist and do not move. (D) Average traces demonstrating the movement of LAT-YFP clusters. The y axis shows how far the clusters moved, while the x axis shows how long they were visible. (E) Traces from 10 cells expressing each construct were compared, and the average persistence of the clusters is shown in the graph. The coexpression of 70Z/3 Cbl-CFP caused a significant increase in the length of time that LAT-YFP clusters remained visible (P < 0.001), while the coexpression of WT Cbl-CFP caused a modest decrease in the persistence of clusters (P = 0.02). (F) Average traces demonstrating the movement of SLP-YFP clusters. The y axis shows how far the clusters moved, while the x axis shows how long they were visible. (G) Traces from 10 cells expressing each construct were compared, and the average persistence of the clusters is shown in the graph. The overexpression of WT Cbl-CFP caused a significant decrease in the amount of time SLP-YFP clusters were visible (P = 0.01), while the overexpression of 70Z/3 Cbl-CFP caused a significant increase in the length of time that SLP-YFP clusters remained visible (P < 0.001). Bars show the SEM.

To quantify the effects of WT and 70Z/3 Cbl expression on LAT dynamics, we arranged our images as kymographs and traced the movement of individual LAT-YFP clusters. We traced nine individual clusters in each cell and analyzed 10 cells from each group. The averaged traces confirmed that clusters persist in cells expressing 70Z/3 Cbl-CFP (Fig. 2D). The average lifetimes of the visible clusters calculated from the traces also show these effects (Fig. 2E). Notably, the quantification of the imaging data revealed that LAT-YFP clusters dissipated faster in cells expressing WT Cbl-CFP than in those expressing only the CFP control (Fig. 2D and E). Similar inhibition of LAT-YFP movement was observed in cells expressing a version of c-Cbl with a point mutation in the RING finger domain (C381A) (data not shown). Importantly, the E6.1 LAT-YFP cell line we used in all the experiments reported here expresses a 1:1 ratio of LAT-YFP to endogenous LAT (data not shown), thereby minimizing any effects of LAT overexpression. Furthermore, we verified that the expression of 70Z/3 Cbl-CFP inhibited LAT trafficking in JCam2.5 cells, which lack endogenous LAT but express LAT-YFP (see Videos S7 to S9 in the supplemental material).

TCR-induced activation leads to the phosphorylation of LAT, which creates docking sites for the recruitment of several proteins, including SLP-76. Additionally, since a pool of LAT is found in vesicles containing SLP-76, we assessed the effect of Cbl expression on SLP-YFP clusters. We transiently transfected E6.1 Jurkat cells stably expressing SLP-YFP with CFP-tagged constructs. Similar to its effect on LAT-YFP clusters, 70Z/3 Cbl-CFP caused persistence and retarded movement of SLP-YFP clusters, while in the presence of additional WT Cbl, the SLP-YFP clusters faded more rapidly (Fig. 2F and G; also see Videos S10 to S12 in the supplemental material). Since LAT and SLP-YFP are rapidly internalized upon T-cell activation, these data support the conclusion that c-Cbl ubiquitin ligase activity, mediated by the RING domain, is required for the sorting of LAT and SLP-76 into mobile, endocytic structures.

To verify that the effect of Cbl on LAT clusters occurred in nontransformed cells, we transfected primary murine CD4+ lymph node cells from C57BL/6 mice with either WT Cbl-YFP or 70Z/3 Cbl-YFP and dropped the cells onto stimulatory coverslips. We fixed the cells at various times after activation and immunostained them for LAT. Soon after activation, signaling clusters that contained LAT and WT Cbl-YFP or 70Z/3 Cbl-YFP were observed (Fig. 3A). Similar to the phenotype in Jurkat cells, we saw significant differences in the persistence of LAT and Cbl clusters at later time points. In cells that were transfected with WT Cbl-YFP, both Cbl and LAT clusters had largely dissipated by 15 min (Fig. 3B, top panel). In contrast, cells containing 70Z/3 Cbl-YFP displayed persistent LAT and 70Z/3 Cbl clusters (Fig. 3B, bottom panel, and quantified data shown in Fig. 3C), thus extending the observations made with YFP-tagged LAT in Jurkat cells to endogenous LAT in primary cells.


Figure 3
View larger version (35K):
[in this window]
[in a new window]

 
FIG. 3. 70Z/3 Cbl inhibits endogenous LAT trafficking in primary cells. Murine primary CD4+ cells were transfected with WT Cbl-YFP or 70Z/3 Cbl-YFP as indicated. (A and B) Cells were plated onto stimulatory coverslips and fixed at 5 min (A) and 15 min (B) into the spreading process. Following fixation, cells were immunostained for LAT, and confocal images at the plane of the coverslip were collected. (C) The number of cells exhibiting LAT clusters among cells transfected with WT Cbl-YFP (blue bars) or 70Z/3 Cbl-YFP (yellow bars) was assessed at each time point. Data are representative of two independent experiments. Error bars show the SEM.

LAT cluster movement in T cells lacking c-Cbl. c-Cbl associates with its targets via protein-protein interactions and juxtaposes the RING finger-associated E2 enzyme to the target protein, thus enabling ubiquitylation. 70Z/3 Cbl is thought to function as a dominant negative form of c-Cbl due to the loss of the RING finger-mediated binding of the E2 enzyme. It thus binds target proteins, but ubiquitylation fails to occur (50). Additionally, it may homodimerize with endogenous c-Cbl, thereby inhibiting the negative regulatory activity of c-Cbl (44). However, 70Z/3 Cbl expression may inhibit other Cbl family members or even other proteins. To use an alternate method to analyze c-Cbl function, we examined LAT cluster movement in T cells from c-Cbl–/– mice. CD4+ lymph node cells isolated from c-Cbl–/– mice or their heterozygous siblings were transfected with LAT-YFP. The cells were then dropped onto stimulatory coverslips, fixed at various time points, and stained for pY and pLAT to visualize the signaling clusters. Soon after activation, signaling clusters that contained LAT-YFP, pY, and pLAT were observed in both cell types (Fig. 4A). At later time points, when the cells had spread, we saw differences in the persistence of LAT clusters. Significantly more cells from c-Cbl–/– mice displayed persistent LAT-YFP clusters than cells from heterozygous mice (Fig. 4B and quantified data shown in panel C). These data confirm that the inhibition of LAT trafficking caused by the expression of the 70Z/3 Cbl mutant protein reflects a requirement for c-Cbl function.


Figure 4
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 4. Internalization of LAT clusters in T cells lacking c-Cbl. Lymph node CD4+ cells from c-Cbl–/– or c-Cbl–/+ mice were transfected with LAT-YFP. (A and B) Cells were plated onto stimulatory coverslips and fixed at 5 min (A) and 15 min (B) into the spreading process. Following fixation, cells were immunostained for pY or pLAT and confocal images at the plane of the coverslip were collected. (C) The number of cells exhibiting LAT-YFP clusters among T cells from c-Cbl–/+ mice (blue bars) or c-Cbl–/– mice (yellow bars) was assessed at each time point. Data are presented as percentages of cells containing LAT-YFP clusters at each time point and are representative of two independent experiments. Error bars show the SEM.

Cbl recruitment to signaling clusters requires the proline-rich domain, while 70Z/3 Cbl persistence in clusters requires the TKB domain. Cbl is a large, multidomain protein and is composed of an N-terminal tyrosine kinase binding domain (TKB), a zinc binding RING finger domain, several proline-rich sequences, multiple tyrosine residues that get phosphorylated upon TCR stimulation, and a C-terminal ubiquitin-associated domain (33, 41). We mapped the domains of Cbl required for its recruitment to TCR-induced signaling clusters and, in the case of 70Z/3 expression, for the retention of molecules in clusters. To this end, we generated a panel of Cbl constructs (Fig. 5A) with point mutations or carboxy-terminal truncations in combination with the 70Z/3 deletion. Jurkat E6.1 cells were transfected with CFP-tagged Cbl mutant constructs, and transfected cells were dropped onto stimulatory coverslips, fixed after 2 (Fig. 5B) and 5 (Fig. 5C) min, and visualized. As observed in the live-cell imaging in Fig. 2, WT Cbl and 70Z/3 Cbl were recruited into activation clusters at the 2-min time point (the quantification of clustering data for all constructs is presented in the table in Fig. 5A). In comparison, the G306E-70Z/3 Cbl, 3YF-70Z/3 Cbl, and 690-70Z/3 Cbl constructs were also recruited into signaling clusters at 2 min, although the C-terminally truncated 690-70Z/3 Cbl showed a slight defect in cluster recruitment. These data indicate that the Cbl TKB domain, the three C-terminal tyrosines, and the sequences C terminal to residue 690 are not essential for Cbl recruitment to activation clusters. In contrast, 481-70Z/3 Cbl-CFP was not localized to signaling clusters (Fig. 5B, far-right panel), indicating that the proline-rich region between residues 481 and 690 is critical for Cbl recruitment to signaling complexes.


Figure 5
View larger version (58K):
[in this window]
[in a new window]

 
FIG. 5. 70Z/3 Cbl recruitment to clusters requires the proline-rich domain of Cbl, while the persistence of 70Z/3 Cbl and LAT clusters requires the TKB domain. (A) Schematic of Cbl constructs. 4H, four-helix bundle; EF, EF hand; SH2, Src homolgy 2 domain; RF, RING finger domain; PRR, proline-rich repeat; UBA, ubiquitin-associated domain; *, point mutation in TKB domain; YYY, tyrosine residues. The table on the right summarizes the quantification of the data shown in panels B and C. Data are expressed as percentages of cells that displayed Cbl-CFP clusters (at 2 or 5 min) and LAT-YFP clusters (at 5 min). (B) Jurkat E6.1 cells were transfected with the indicated Cbl and 70Z/3 Cbl-CFP constructs, plated onto stimulatory coverslips, and fixed at 2 min into the spreading process. (C) Jurkat E6.1 cells stably expressing LAT-YFP were transfected with the indicated Cbl-CFP constructs, plated onto stimulatory coverslips, and fixed at 5 min into the spreading process. Z stacks (five stacks, 0.5 µm apart) were collected and are displayed as maximum-intensity projections. Data are representative of a minimum of three independent experiments.

Next, we evaluated the requirement for the various domains in the persistence of 70Z/3 Cbl-CFP and LAT-YFP clusters at the 5-min time point (Fig. 5C). At 5 min, the WT Cbl-CFP signal had mostly dissipated from the clusters, while the 70Z/3 Cbl-CFP clusters were still present and robust. Consistent with the live-cell data shown in Fig. 2, LAT-YFP clusters in cells expressing WT Cbl-CFP had dissipated but those in cells with 70Z/3 Cbl-CFP were persistent. Similar to 70Z/3 Cbl-CFP, the 3YF-70Z/3 Cbl-CFP clusters persisted and retained LAT-YFP at 5 min. In contrast, the 481-70Z/3 construct that did not get recruited to clusters at 2 min was not present in signaling complexes at 5 min and did not retain LAT-YFP clusters. In comparison, the 690-70Z/3 Cbl truncated protein that displayed a slight defect in clustering at the 2-min time point had a similar defect in the persistence and retention of LAT clusters. Surprisingly, the G306E-70Z/3 Cbl-CFP construct that clustered with LAT at 2 min did not persist or retain LAT-YFP clusters at 5 min (Fig. 5C, third panel from the left). Together, these data demonstrate that the proline-rich region between amino acids 481 and 690 is required for Cbl recruitment to signaling complexes, while the TKB domain is required for the persistence of 70Z/3 Cbl and LAT clusters.

Requirement of LAT and binding to ZAP-70 for c-Cbl recruitment to activation clusters. Having determined the domain requirements of c-Cbl for the localization of c-Cbl to TCR-induced clusters, we next investigated which proteins at the clusters are important in c-Cbl recruitment. To evaluate the importance of LAT and LAT-interacting proteins, we examined c-Cbl localization in JCam2.5 cells that lack LAT or JCam2.5 cells reconstituted with LAT mutant forms that lack either the three Grb2 binding sites (LAT3YF) or the PLC-{gamma} binding site (LATY132F). These cells were dropped onto stimulatory coverslips, fixed soon after activation, and immunostained for pY to mark the activation clusters, pLAT to mark LAT clusters, and c-Cbl to assess c-Cbl recruitment (Fig. 6A). JCam2.5 cells reconstituted with wild-type LAT served as a positive control (Fig. 6A, top panel). Of note, there appears to be no pLAT at the activation clusters in the JCam2.5 and JCam2.5 LAT3YF cells, indicating that, as we reported previously, LAT clusters do not form in these cells (Fig. 6A, panels 2 and 4) (24). To our surprise, c-Cbl was localized at the signaling clusters in all the cell lines examined. Since LAT was not essential for the recruitment of c-Cbl to signaling clusters, we next analyzed which other proteins may be important in c-Cbl localization.


Figure 6
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 6. Requirement of LAT and ZAP-70 binding for c-Cbl recruitment to activation clusters. Cells were dropped onto stimulatory coverslips, fixed after 2 min, and immunostained for pY, pLAT, and c-Cbl. In all cases, four panels are shown: those corresponding to pY (left; red), pLAT (second from left; blue), and c-Cbl (second from right; green) and an overlay panel emphasizing the colocalization of these proteins (right). (A) c-Cbl localization in LAT-deficient JCam2.5 cells or JCam2.5 variants reconstituted with LATY132F or LAT3YF. JCam2.5 cells reconstituted with WT LAT served as a positive control (top panel). Note the absence of pLAT staining in JCam2.5 and JCam2.5(LAT3YF) cells. c-Cbl was recruited to signaling clusters in all cell lines. (B) c-Cbl localization in ZAP-deficient P116 cells or P116 cells reconstituted with ZAP-70 Y292F. P116 cells reconstituted with WT ZAP-70 served as a positive control (top panel). c-Cbl is recruited to signaling clusters in the absence of ZAP-70 binding in the Y292F reconstituted cells. (C and D) c-Cbl localization in P116 WT ZAP-70 or P116 ZAP-70 Y292F cells transfected with siRNA for LAT (bottom panels) or control siRNA (top panels). c-Cbl is localized normally in P116 WT ZAP-70 cells depleted of LAT expression (C, bottom panel), but not in P116 ZAP-70 Y292F reconstituted cells depleted of LAT expression (D, bottom panel). (E) The numbers of cells exhibiting c-Cbl clusters among P116 WT ZAP-70 cells and P116 Y292F ZAP-70 cells transfected with control siRNA (blue bars) or LAT siRNA (yellow bars) were assessed. Data are presented as numbers of cells containing c-Cbl clusters and are representative of two independent experiments. Error bars show the SEM.

It has been reported previously that the c-Cbl TKB domain binds to phosphorylated tyrosine 292 in ZAP-70 upon TCR activation (29). To evaluate the importance of ZAP-70 in Cbl recruitment, we examined c-Cbl localization in ZAP-70-deficient P116 cells (Fig. 6B). P116 cells reconstituted with WT ZAP-70 served as a positive control (Fig. 6B, top panel). Upon examination, P116 cells did not display c-Cbl clusters (Fig. 6B, middle panel). However, in the absence of ZAP-70, several other proximal proteins, such as LAT and SLP-76, were not recruited to signaling clusters (data not shown). Therefore, to specifically evaluate whether binding to ZAP-70 was important for c-Cbl localization, c-Cbl clustering was examined in P116 cells reconstituted with ZAP-70 containing the mutation Y292F (ZAP-70 Y292F), which inhibits binding to c-Cbl (29). c-Cbl was recruited to pY- and pLAT-containing clusters in these cells, indicating that interaction with ZAP-70 is also not essential for c-Cbl recruitment to signaling clusters (Fig. 6B, bottom panel).

Next, we considered whether LAT and ZAP-70, together, accounted for c-Cbl recruitment to clusters. To evaluate this possibility, we simultaneously eliminated LAT and ZAP-70 binding by using an siRNA pool to reduce LAT expression in P116 cells reconstituted with ZAP-70 Y292F. In cells transfected with siRNA pools targeting LAT, LAT expression was reduced by 80% (data not shown). A control siRNA pool was used to control for off-target effects. The siRNA-mediated inhibition of LAT expression in P116 cells reconstituted with WT ZAP-70 did not lead to an inhibition of c-Cbl clustering (Fig. 6C). In contrast, LAT depletion in P116 cells reconstituted with ZAP-70 Y292F led to a significant decrease in the number of cells with distinct c-Cbl clusters (Fig. 6D; quantification in panel E). Of note, the absence of pLAT staining in these cells confirmed the effective knockdown of LAT expression. These data indicate that although the binding of LAT and ZAP-70, taken separately, is dispensable for c-Cbl clustering, the loss of both these signaling components abolishes c-Cbl recruitment to activation clusters.

LAT is ubiquitylated, and 70Z/3 Cbl expression suppresses LAT ubiquitylation. Since c-Cbl functions as a ubiquitin ligase, we next investigated whether molecules affected by the expression of c-Cbl RING mutant proteins in our imaging assay were potential substrates of c-Cbl ubiquitin ligase activity. For this purpose, we tested for the ubiquitylation of the signaling molecules LAT and SLP-76 in COS-7 cells. COS-7 cells were transfected with HA-tagged ubiquitin and SLP-76 or LAT, followed by the immunoprecipitation of SLP-76 or LAT and anti-HA Western blotting. Consistent with the findings of a recently published study that presented evidence for LAT ubiquitylation (9), the immunoprecipitation of LAT resulted in the coprecipitation of ubiquitylated bands (Fig. 7). In contrast, no HA-tagged ubiquitin was detected in SLP-76 immunoprecipitates (data not shown). Notably, in the LAT immunoprecipitates, the predominant ubiquitylated band was detected at around 48 kDa (Fig. 7A, top panel). Since immunoprecipitated LAT runs at 40 kDa, this band likely represents monoubiquitylated LAT. The bands above the 48-kDa band may represent multimonoubiquitylated or polyubiquitylated LAT species. To confirm that the ubiquitylated bands detected by LAT immunoprecipitation were in fact modified LAT and not LAT-associated proteins, we immunoprecipitated LAT and denatured the immunoprecipitated proteins, allowed them to be renatured, and then reimmunoprecipitated LAT. As seen in Fig. 7B, the ubiquitylated bands were detected in both the first and second LAT immunoprecipitations, indicating that the bands detected by the HA antibody included ubiquitylated LAT species.


Figure 7
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 7. Ubiquitylation of LAT in COS-7 cells. (A) COS-7 cells were transfected with HA epitope-tagged ubiquitin (HA-Ub) alone (lane 1) or LAT alone (lane 2) or HA-Ub and LAT (lane 3). Twenty-four hours after transfection, LAT was immunoprecipitated (IP) from whole-cell lysates and the blots were immunoblotted (IB) for ubiquitin (with anti-HA) or LAT, as indicated to the right of the blots. Molecular mass standards (in kilodaltons) appear to the left of the panels. +, present; –, absent. (B) COS-7 cells were transfected with HA-Ub alone (lanes 1 and 3) or HA-Ub and LAT (lanes 2 and 4). LAT was immunoprecipitated from whole-cell lysates, and an aliquot of the immunoprecipitate was run in lanes 1 and 2. The remainder of the immunoprecipitate was boiled in a denaturing buffer to separate associated proteins and diluted in cell lysis buffer, and LAT was reimmunoprecipitated (re-IP). The precipitate from the denatured/renatured sample was run in lanes 3 and 4. The blots were immunoblotted for ubiquitin (with anti-HA) or LAT as indicated. (C) COS-7 cells were transfected with HA-Ub alone (lane 1), HA-Ub and LAT (lane 2), or HA-Ub and LAT in combination with WT Cbl (lane 3) or 70Z/3 Cbl (70Z; lane 4). Twenty-four hours after transfection, LAT was immunoprecipitated from cell lysates and blots were immunoblotted for ubiquitin (with anti-HA) or LAT as indicated. In addition, whole-cell lysates (WCL) were blotted for Cbl (bottom panel). Data are representative of a minimum of three independent experiments.

Since we observed ubiquitylated LAT in our biochemical assay and endocytic trafficking of LAT in our imaging assay, and as ubiquitylation has been implicated in the internalization of proteins (19), we were interested in the correlation, if any, between the two. In view of the fact that Cbl RING finger activity was required for LAT internalization, we assessed the effect of Cbl and 70Z/3 Cbl expression on LAT ubiquitylation. The expression of WT Cbl caused a modest increase in LAT ubiquitylation, predominantly in the monoubiquitylated band (Fig. 7C, top panel, compare lanes 2 and 3). Strikingly, the expression of 70Z/3 Cbl resulted in a significant decrease in all ubiquitylated LAT species (Fig. 7C, top panel, compare lanes 2 and 4). The opposing effects on LAT ubiquitylation caused by WT and 70Z/3 Cbl expression were not a consequence of differences in the levels of expression of the two constructs (Fig. 7C, bottom panel). Together, the data from our imaging and biochemical assays are consistent with a model in which Cbl-mediated ubiquitylation is required for the internalization of SLP-76 and LAT clusters. Upon 70Z/3 Cbl expression, the ubiquitylation of LAT and perhaps other signaling molecules is diminished, and as a result, microcluster endocytosis and dissipation are inhibited.

70Z/3 Cbl regulates basal cellular LAT levels as well as basal and TCR-induced LAT phosphorylation. The microscopic and biochemical data described above demonstrate that c-Cbl activity modulates both LAT internalization and LAT ubiquitylation. To assess whether Cbl might have an effect on LAT expression, we developed a system to evaluate basal LAT levels in cells expressing various Cbl constructs. In this system, a stable cell line expressing LAT-YFP was transfected with Cbl-CFP, 70Z/3 Cbl-CFP, or a construct expressing CFP alone as a control. Following transfection, LAT-YFP levels in transfected (CFP+) cells were assessed by flow cytometry. LAT-YFP levels were not substantially altered in cells transfected with Cbl-CFP compared with those in CFP control-transfected cells. To our surprise, in cells transfected with 70Z/3 Cbl-CFP, LAT-YFP levels were significantly increased (Fig. 8A and B). Quantification of these data revealed that LAT-YFP levels were increased by more than three times in cells expressing 70Z/3 Cbl-CFP compared to levels in cells expressing a CFP vector control (Fig. 8B). Importantly, 70Z/3 Cbl-CFP expression did not cause an increase in YFP levels in control cells stably expressing YFP, indicating that the increase observed in LAT-YFP levels is not due to the global upregulation of expressed plasmids mediated by 70Z/3 Cbl (data not shown).


Figure 8
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 8. 70Z/3 Cbl upregulates basal LAT levels and basal and TCR-induced levels of pLAT. Jurkat E6.1 cells stably expressing LAT-YFP were transiently transfected with CFP vector control plasmid or WT Cbl-CFP, 70Z/3 Cbl-CFP, or mutant 70Z/3 Cbl-CFP plasmids as indicated. Twenty-four hours after transfection, cells were analyzed by flow cytometry (A and B) or sorted for CFP+ YFP+ cells and analyzed by Western blotting (C and D). (A) Histogram of LAT-YFP expression in cells expressing both LAT-YFP and the CFP construct. The expression of 70Z/3 Cbl-CFP causes an increase in LAT-YFP expression. (B) Quantification of mean LAT-YFP levels in CFP+ YFP+ cells that had been transiently transfected with the indicated CFP plasmid. Data are presented as mean LAT-YFP levels (± SEM) and are normalized to the CFP vector control. Data are representative of four independent experiments. (C) Cells sorted for LAT-YFP and Cbl-CFP expression were left unstimulated or stimulated with OKT3 for various time points and lysed. Lysates were separated by electrophoresis and analyzed by Western blotting for LAT phosphorylated at tyrosine 191 (pLAT191), total LAT (LAT), GAPDH to normalize for protein expression, and HA to look at c-Cbl expression. Note that the LAT bands in panels 1 and 2 correspond to LAT-YFP. (D) pLAT levels (C, top panel) were normalized to GAPDH levels (C, third panel from top). The maximal response of 70Z/3 Cbl-CFP-expressing cells at 120 s was set to 100, and all values are presented relative to the maximal value. Data are representative of three independent experiments.

To determine which domains of 70Z/3 Cbl are required to upregulate LAT levels, we transfected the stable LAT-YFP cell line with a panel of 70Z/3 Cbl mutant constructs tagged with CFP and assessed LAT-YFP expression. Strikingly, mutations of the same Cbl domains that prevented the internalization of LAT (Fig. 5) had comparable effects on cellular LAT expression (Fig. 8B). Cbl mutant forms that prevented LAT internalization (70Z/3 Cbl and 3YF-70Z/3 Cbl) caused a significant increase in cellular LAT levels, while constructs that did not inhibit LAT internalization (WT Cbl and G306E-70Z/3 and 481-70Z/3 Cbl) did not have an effect on LAT expression. The 690-70Z/3 Cbl construct that had a partial effect on LAT internalization also had an intermediate effect on LAT expression levels (compare Fig. 5 and 8B). The failure of mutant 70Z/3 Cbl-CFP constructs to upregulate LAT expression levels was not due to differences in levels of expression of the Cbl mutant proteins, as levels of expression of all the mutant proteins were similar to or higher than the expression of 70Z/3 Cbl-CFP (data not shown). These data suggest a correlation between the mechanisms of LAT endocytosis and the regulation of basal LAT expression levels, with Cbl RING finger activity being required for both.

We were also interested in monitoring the effects of c-Cbl expression on LAT levels following activation. However, we could not detect any changes in total LAT protein levels upon OKT3-induced TCR triggering, either by Western blotting or by flow cytometry (Fig. 8C and data not shown). One possible explanation is that only a small fraction of LAT is recruited to the activation clusters and subjected to c-Cbl-dependent ubiquitylation and degradation. Therefore, to better understand the fate of activated pools of LAT, we examined levels and kinetics of LAT phosphorylation using a phospho-specific antibody to tyrosine 191 of LAT. Upon TCR stimulation, tyrosine 191 of LAT gets phosphorylated rapidly, reaching maximal stimulation at 60 s (23). To evaluate the effects of c-Cbl expression on pLAT, E6.1 LAT-YFP cells were transfected with CFP, WT Cbl-CFP, or 70Z/3 Cbl-CFP. Following transfection, cells were stimulated and the degree of LAT phosphorylation was determined at various time points. In cells transfected with CFP and WT Cbl-CFP, pLAT levels peaked at 60 s and decreased slightly by 120 s (Fig. 8C and D), though pLAT levels in WT Cbl-CFP-transfected cells were comparatively lower at both time points. In contrast, 70Z/3 Cbl-CFP expression augmented both basal and TCR-induced pLAT levels. Furthermore, pLAT levels remained elevated at 120 s. These results suggest that c-Cbl function is involved in regulating pools of pLAT and that, upon TCR triggering, c-Cbl activity regulates the loss of phosphorylated LAT protein. Importantly, these data suggest that the inhibition of LAT ubiquitylation and LAT cluster endocytosis by 70Z/3 Cbl have consequences for LAT signaling.


arrow
DISCUSSION
 
While several biochemical and imaging studies have examined the dynamics of the transmembrane protein LAT in an activated T cell, these studies have been limited to an analysis of LAT at the plasma membrane (12, 20, 38, 52). In the present study, we demonstrated that LAT is rapidly internalized from the T-cell surface upon the activation of the TCR and is found in several distinct intracellular compartments. Given the essential scaffolding role of the adapter protein LAT in T-cell activation, the regulated internalization of activated LAT signaling complexes may be one efficient strategy by which to control the duration and localization of signaling from microclusters and, thus, regulate the kinetics, intensity, and specificity of T-cell signaling.

Importantly, we have uncovered a role for the ubiquitin ligase c-Cbl in the internalization of LAT-nucleated clusters. The expression of versions of c-Cbl that are defective in the RING domain severely inhibited LAT and SLP-76 movement and caused the persistence of signaling clusters. These data suggest that c-Cbl ubiquitin ligase activity is intimately involved in the sorting of LAT and SLP-76 into mobile endocytic structures. Though the function of c-Cbl in the endocytosis of immune and growth factor receptors has been well documented, the novelty of our demonstration is that this mechanism can regulate activated signaling complexes independently of the TCR, which does not accompany LAT and SLP-76. Additionally, LAT internalization appears to be inhibited in CD4+ cells from c-Cbl–/– mice, confirming that the effects of 70Z/3 Cbl expression reflect c-Cbl function. We note that the extent of inhibition of LAT internalization by 70Z/3 Cbl expression in CD4+ lymph node cells is greater than that caused by the lack of c-Cbl function in CD4+ cells from c-Cbl–/– mice. It is possible that in addition to inhibiting c-Cbl function, 70Z/3 Cbl expression inhibits the function of other Cbl family members or even other proteins. Alternatively, the biology of the peripheral CD4+ cells from the c-Cbl–/– mice may differ from that in wild-type CD4+ T cells used in the 70Z/3 Cbl experiments, due to altered signaling in the c-Cbl–/– thymocytes undergoing selection, thus effecting the number of mature T cells that exhibit persistent LAT clusters (32).

To give us insight into the mechanisms by which c-Cbl regulates signaling cluster dynamics, we examined the requirements for domains in c-Cbl, as well as the proteins at the cluster required for c-Cbl recruitment to TCR-induced clusters. The importance of c-Cbl proline-rich and TKB domains in c-Cbl recruitment and stabilization at signaling clusters is compatible with a role for LAT and ZAP-70. LAT interaction with the c-Cbl proline-rich domain can be mediated by Grb-2, PLC-{gamma}, or NCK (36), and ZAP-70 interacts with the TKB domain of c-Cbl (29). Interestingly, though neither the binding of LAT nor that of ZAP-70 was required individually for c-Cbl recruitment, the simultaneous depletion of both molecules abolished c-Cbl recruitment to clusters. These data indicate a redundancy in the system and show that the presence of either ZAP-70 or LAT is sufficient to stabilize c-Cbl recruitment to the same TCR-induced clusters, without the participation of the other. Alternatively, it is possible that ZAP-70 and LAT are at distinct signaling clusters and that the elimination of either signaling component allows c-Cbl to be recruited into signaling clusters containing the other protein. Consistent with this scenario, in mast cell membranes, receptor-containing signaling domains and LAT-containing domains are discrete (47).

The requirement for the c-Cbl RING domain in the internalization of signaling clusters prompted us to look for the ubiquitylation of molecules that were inhibited by RING finger mutant forms of c-Cbl. Consistent with a recent report (9), we observed the modification of LAT by ubiquitylation. Furthermore, we have demonstrated that LAT ubiquitylation can be modulated by c-Cbl, with WT Cbl expression causing an increase and 70Z/3 Cbl expression causing a decrease in ubiquitylated LAT species. In recent years, it has become clear that, in addition to its well-known role in proteasome-dependent protein degradation, ubiquitin is involved in protein trafficking and membrane protein internalization (1, 22). Thus, c-Cbl-mediated LAT ubiquitylation may serve as a regulated signal for the internalization of LAT and perhaps LAT-nucleated signaling complexes.

However, c-Cbl may regulate LAT endocytosis by other mechanisms. One possibility is that effects seen with the Cbl mutants on endocytosis result from the defective ubiquitylation of proteins other than LAT. These proteins may potentially be other signaling molecules in the LAT-nucleated signaling complex. Alternatively, endocytic adapter proteins may be the targets of ubiquitylation. In fact, it has been proposed that the ubiquitylation of a component of the endocytic apparatus is required for the endocytosis of {alpha} factor receptor in yeast (14) and growth hormone receptor in mammalian cells (18). Finally, it is possible that the RING domain of Cbl is required to recruit proteins essential for the endocytosis of microclusters in a ubiquitin-independent manner.

The loss of LAT clusters with time and the regulation of cellular LAT levels by c-Cbl suggests that the dissipation of LAT represents degradation. Interestingly, stimulation of the TCR is not required for the observed increase in LAT levels. A significant amount of data support the idea that some basal level of signaling occurs continuously in most signal-transducing systems and is the result of an equilibrium between positive and negative regulators of a signaling pathway (35). Our data suggest that the expression of 70Z/3 Cbl perturbs the function of the negative regulatory protein c-Cbl, thus uncovering a role for the c-Cbl RING domain in the regulation of homeostatic basal LAT levels in resting cells.

Although LAT-YFP clusters dissipate rapidly upon TCR stimulation, we did not detect a decrease in LAT protein levels following T-cell activation in the defined time course over which we observed the loss of LAT clusters. One possible explanation is that only a small fraction of cellular LAT is recruited into signaling complexes, internalized, and degraded. Therefore, we decided to monitor the effects of c-Cbl expression on the activated pool of pLAT. Interestingly, we saw an increase in basal and activation-induced levels of pLAT upon 70Z/3 Cbl expression. Similarly, thymocytes from both c-Cbl–/– mice and mice with a loss-of-function mutation in the c-Cbl RING domain exhibited increased and sustained phosphorylation of LAT and SLP-76, probably due to deregulated ZAP-70 activity (39, 40). In our studies, we cannot rule out the possibility that the effects on LAT internalization and levels by c-Cbl are mediated through an effect on ZAP-70. However, the observations that LAT is ubiquitylated and that c-Cbl modulates LAT ubiquitylation are suggestive of direct regulation of LAT by c-Cbl.

Current spatial models of TCR-induced microcluster signaling and downregulation propose that the central supramolecular activation cluster (cSMAC) is a site for TCR downregulation and signal attenuation (28, 45). In our model system, TCR microclusters remain immobilized by the stimulatory antibody on the coverslip, and hence, we do not observe cSMAC formation. However, in addition to the degradation of the TCR at the cSMAC, the regulation of signaling probably also occurs at the level of the microclusters. We envision a scenario in which almost simultaneously with the assembly of signaling proteins in the microclusters, disassembly mechanisms are triggered to limit the duration of signaling. In this study, we have uncovered the ubiquitylation and endocytosis of signaling complexes as one possible mechanism of downregulation of signaling proteins at the microcluster level.


arrow
ACKNOWLEDGMENTS
 
We thank D. Bohmann for the HA-ubiquitin construct, J. Chiang and R. Hodes for c-Cbl knockout mice, B. Taylor for cell sorting, B. Ashwell and C. Reagan for technical help, and J. Houtman, A. Bagorda, S. Lipkowitz, and A. Weissman for critical comments on the manuscript.

This research was supported by the Intramural Research Program of the Center for Cancer Research, NCI, NIH. A.G. and M.S.I. received salary support from the Office of Research on Women's Health, Foundation for Advanced Education in the Sciences, NIH.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Laboratory of Cellular and Molecular Biology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bldg. 37, Rm. 2066, Bethesda, MD 20892. Phone: (301) 496-9683. Fax: (301) 496-8479. E-mail: samelson{at}helix.nih.gov Back

{triangledown} Published ahead of print on 15 October 2007. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back

{ddagger} Present address: Mina and Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat-Gan 52900, Israel. Back


arrow
REFERENCES
 
    1
  1. Aguilar, R. C., and B. Wendland. 2003. Ubiquitin: not just for proteasomes anymore. Curr. Opin. Cell Biol. 15:184-190.[CrossRef][Medline]
  2. 2
  3. Alarcon, B., and M. Fresno. 1998. Transferrin receptor (CD71), p. 2389-2392. In P. J. Delves and I. M. Roitt (ed.), Encyclopedia of immunology, 2nd ed. Academic Press, London, United Kingdom.
  4. 3
  5. Andoniou, C. E., N. L. Lill, C. B. Thien, M. L. Lupher, Jr., S. Ota, D. D. Bowtell, R. M. Scaife, W. Y. Langdon, and H. Band. 2000. The Cbl proto-oncogene product negatively regulates the Src-family tyrosine kinase Fyn by enhancing its degradation. Mol. Cell. Biol. 20:851-867.[Abstract/Free Full Text]
  6. 4
  7. Andoniou, C. E., C. B. Thien, and W. Y. Langdon. 1994. Tumour induction by activated abl involves tyrosine phosphorylation of the product of the cbl oncogene. EMBO J. 13:4515-4523.[Medline]
  8. 5
  9. Barda-Saad, M., A. Braiman, R. Titerence, S. C. Bunnell, V. A. Barr, and L. E. Samelson. 2005. Dynamic molecular interactions linking the T cell antigen receptor to the actin cytoskeleton. Nat. Immunol. 6:80-89.[CrossRef][Medline]
  10. 6
  11. Barr, V. A., L. Balagopalan, M. Barda-Saad, R. Polishchuk, H. Boukari, S. C. Bunnell, K. M. Bernot, Y. Toda, R. Nossal, and L. E. Samelson. 2006. T-cell antigen receptor-induced signaling complexes: internalization via a cholesterol-dependent endocytic pathway. Traffic 7:1143-1162.[CrossRef][Medline]
  12. 7
  13. Bonello, G., N. Blanchard, M. C. Montoya, E. Aguado, C. Langlet, H. T. He, S. Nunez-Cruz, M. Malissen, F. Sanchez-Madrid, D. Olive, C. Hivroz, and Y. Collette. 2004. Dynamic recruitment of the adaptor protein LAT: LAT exists in two distinct intracellular pools and controls its own recruitment. J. Cell Sci. 117:1009-1016.[Abstract/Free Full Text]
  14. 8
  15. Braiman, A., M. Barda-Saad, C. L. Sommers, and L. E. Samelson. 2006. Recruitment and activation of PLC{gamma}1 in T cells: a new insight into old domains. EMBO J. 25:774-784.[CrossRef][Medline]
  16. 9
  17. Brignatz, C., A. Restouin, G. Bonello, D. Olive, and Y. Collette. 2005. Evidences for ubiquitination and intracellular trafficking of LAT, the linker of activated T cells. Biochim. Biophys. Acta 1746:108-115.[Medline]
  18. 10
  19. Bunnell, S. C., D. I. Hong, J. R. Kardon, T. Yamazaki, C. J. McGlade, V. A. Barr, and L. E. Samelson. 2002. T cell receptor ligation induces the formation of dynamically regulated signaling assemblies. J. Cell Biol. 158:1263-1275.[Abstract/Free Full Text]
  20. 11
  21. Campi, G., R. Varma, and M. L. Dustin. 2005. Actin and agonist MHC-peptide complex-dependent T cell receptor microclusters as scaffolds for signaling. J. Exp. Med. 202:1031-1036.[Abstract/Free Full Text]
  22. 12
  23. Douglass, A. D., and R. D. Vale. 2005. Single-molecule microscopy reveals plasma membrane microdomains created by protein-protein networks that exclude or trap signaling molecules in T cells. Cell 121:937-950.[CrossRef][Medline]
  24. 13
  25. Duan, L., A. L. Reddi, A. Ghosh, M. Dimri, and H. Band. 2004. The Cbl family and other ubiquitin ligases: destructive forces in control of antigen receptor signaling. Immunity 21:7-17.[CrossRef][Medline]
  26. 14
  27. Dunn, R., and L. Hicke. 2001. Multiple roles for Rsp5p-dependent ubiquitination at the internalization step of endocytosis. J. Biol. Chem. 276:25974-25981.[Abstract/Free Full Text]
  28. 15
  29. Ehrlich, L. I., P. J. Ebert, M. F. Krummel, A. Weiss, and M. M. Davis. 2002. Dynamics of p56lck translocation to the T cell immunological synapse following agonist and antagonist stimulation. Immunity 17:809-822.[CrossRef][Medline]
  30. 16
  31. Fang, D., and Y. C. Liu. 2001. Proteolysis-independent regulation of PI3K by Cbl-b-mediated ubiquitination in T cells. Nat. Immunol. 2:870-875.[CrossRef][Medline]
  32. 17
  33. Geisler, C. 2004. TCR trafficking in resting and stimulated T cells. Crit. Rev. Immunol. 24:67-86.[Medline]
  34. 18
  35. Govers, R., T. ten Broeke, P. van Kerkhof, A. L. Schwartz, and G. J. Strous. 1999. Identification of a novel ubiquitin conjugation motif, required for ligand-induced internalization of the growth hormone receptor. EMBO J. 18:28-36.[Medline]
  36. 19
  37. Haglund, K., P. P. Di Fiore, and I. Dikic. 2003. Distinct monoubiquitin signals in receptor endocytosis. Trends Biochem. Sci. 28:598-603.[CrossRef][Medline]
  38. 20
  39. Hartgroves, L. C., J. Lin, H. Langen, T. Zech, A. Weiss, and T. Harder. 2003. Synergistic assembly of linker for activation of T cells signaling protein complexes in T cell plasma membrane domains. J. Biol. Chem. 278:20389-20394.[Abstract/Free Full Text]
  40. 21
  41. Heissmeyer, V., F. Macian, S. H. Im, R. Varma, S. Feske, K. Venuprasad, H. Gu, Y. C. Liu, M. L. Dustin, and A. Rao. 2004. Calcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins. Nat. Immunol. 5:255-265.[CrossRef][Medline]
  42. 22
  43. Hicke, L., and R. Dunn. 2003. Regulation of membrane protein transport by ubiquitin and ubiquitin-binding proteins. Annu. Rev. Cell Dev. Biol. 19:141-172.[CrossRef][Medline]
  44. 23
  45. Houtman, J. C., R. A. Houghtling, M. Barda-Saad, Y. Toda, and L. E. Samelson. 2005. Early phosphorylation kinetics of proteins involved in proximal TCR-mediated signaling pathways. J. Immunol. 175:2449-2458.[Abstract/Free Full Text]
  46. 24
  47. Houtman, J. C., H. Yamaguchi, M. Barda-Saad, A. Braiman, B. Bowden, E. Appella, P. Schuck, and L. E. Samelson. 2006. Oligomerization of signaling complexes by the multipoint binding of GRB2 to both LAT and SOS1. Nat. Struct. Mol. Biol. 13:798-805.[CrossRef][Medline]
  48. 25
  49. Jang, I. K., and H. Gu. 2003. Negative regulation of TCR signaling and T-cell activation by selective protein degradation. Curr. Opin. Immunol. 15:315-320.[CrossRef][Medline]
  50. 26
  51. Jeon, M. S., A. Atfield, K. Venuprasad, C. Krawczyk, R. Sarao, C. Elly, C. Yang, S. Arya, K. Bachmaier, L. Su, D. Bouchard, R. Jones, M. Gronski, P. Ohashi, T. Wada, D. Bloom, C. G. Fathman, Y. C. Liu, and J. M. Penninger. 2004. Essential role of the E3 ubiquitin ligase Cbl-b in T cell anergy induction. Immunity 21:167-177.[CrossRef][Medline]
  52. 27
  53. Keane, M. M., S. A. Ettenberg, M. M. Nau, P. Banerjee, M. Cuello, J. Penninger, and S. Lipkowitz. 1999. cbl-3: a new mammalian cbl family protein. Oncogene 18:3365-3375.[CrossRef][Medline]
  54. 28
  55. Lee, K. H., A. R. Dinner, C. Tu, G. Campi, S. Raychaudhuri, R. Varma, T. N. Sims, W. R. Burack, H. Wu, J. Wang, O. Kanagawa, M. Markiewicz, P. M. Allen, M. L. Dustin, A. K. Chakraborty, and A. S. Shaw. 2003. The immunological synapse balances T cell receptor signaling and degradation. Science 302:1218-1222.[Abstract/Free Full Text]
  56. 29
  57. Lupher, M. L., Jr., Z. Songyang, S. E. Shoelson, L. C. Cantley, and H. Band. 1997. The Cbl phosphotyrosine-binding domain selects a D(N/D)XpY motif and binds to the Tyr292 negative regulatory phosphorylation site of ZAP-70. J. Biol. Chem. 272:33140-33144.[Abstract/Free Full Text]
  58. 30
  59. Miura-Shimura, Y., L. Duan, N. L. Rao, A. L. Reddi, H. Shimura, R. Rottapel, B. J. Druker, A. Tsygankov, V. Band, and H. Band. 2003. Cbl-mediated ubiquitinylation and negative regulation of Vav. J. Biol. Chem. 278:38495-38504.[Abstract/Free Full Text]
  60. 31
  61. Montesano, R., J. Roth, A. Robert, and L. Orci. 1982. Non-coated membrane invaginations are involved in binding and internalization of cholera and tetanus toxins. Nature 296:651-653.[CrossRef][Medline]
  62. 32
  63. Naramura, M., H. K. Kole, R.-J. Hu, and H. Gu. 1998. Altered thymic positive selection and intracellular signals in Cbl-deficient mice. Proc. Natl. Acad. Sci. USA 95:15547-15552.[Abstract/Free Full Text]
  64. 33
  65. Rao, N., I. Dodge, and H. Band. 2002. The Cbl family of ubiquitin ligases: critical negative regulators of tyrosine kinase signaling in the immune system. J. Leukoc. Biol. 71:753-763.[Abstract/Free Full Text]
  66. 34
  67. Rao, N., S. Miyake, A. L. Reddi, P. Douillard, A. K. Ghosh, I. L. Dodge, P. Zhou, N. D. Fernandes, and H. Band. 2002. Negative regulation of Lck by Cbl ubiquitin ligase. Proc. Natl. Acad. Sci. USA 99:3794-3799.[Abstract/Free Full Text]
  68. 35
  69. Roose, J. P., M. Diehn, M. G. Tomlinson, J. Lin, A. A. Alizadeh, D. Botstein, P. O. Brown, and A. Weiss. 2003. T cell receptor-independent basal signaling via Erk and Abl kinases suppresses RAG gene expression. PLoS Biol. 1:E53.[Medline]
  70. 36
  71. Samelson, L. E. 2002. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. Annu. Rev. Immunol. 20:371-394.[CrossRef][Medline]
  72. 37
  73. Sommers, C. L., J. Lee, K. L. Steiner, J. M. Gurson, C. L. Depersis, D. El-Khoury, C. L. Fuller, E. W. Shores, P. E. Love, and L. E. Samelson. 2005. Mutation of the phospholipase C-{gamma}1-binding site of LAT affects both positive and negative thymocyte selection. J. Exp. Med. 201:1125-1134.[Abstract/Free Full Text]
  74. 38
  75. Tanimura, N., M. Nagafuku, Y. Minaki, Y. Umeda, F. Hayashi, J. Sakakura, A. Kato, D. R. Liddicoat, M. Ogata, T. Hamaoka, and A. Kosugi. 2003. Dynamic changes in the mobility of LAT in aggregated lipid rafts upon T cell activation. J. Cell Biol. 160:125-135.[Abstract/Free Full Text]
  76. 39
  77. Thien, C. B., F. D. Blystad, Y. Zhan, A. M. Lew, V. Voigt, C. E. Andoniou, and W. Y. Langdon. 2005. Loss of c-Cbl RING finger function results in high-intensity TCR signaling and thymic deletion. EMBO J. 24:3807-3819.[CrossRef][Medline]
  78. 40
  79. Thien, C. B., D. D. Bowtell, and W. Y. Langdon. 1999. Perturbed regulation of ZAP-70 and sustained tyrosine phosphorylation of LAT and SLP-76 in c-Cbl-deficient thymocytes. J. Immunol. 162:7133-7139.[Abstract/Free Full Text]
  80. 41
  81. Thien, C. B., and W. Y. Langdon. 2005. c-Cbl and Cbl-b ubiquitin ligases: substrate diversity and the negative regulation of signalling responses. Biochem. J. 391:153-166.[CrossRef][Medline]
  82. 42
  83. Thien, C. B., and W. Y. Langdon. 2005. Negative regulation of PTK signalling by Cbl proteins. Growth Factors 23:161-167.[CrossRef][Medline]
  84. 43
  85. van Leeuwen, J. E., P. K. Paik, and L. E. Samelson. 1999. Activation of nuclear factor of activated T cells-(NFAT) and activating protein 1 (AP-1) by oncogenic 70Z Cbl requires an intact phosphotyrosine binding domain but not Crk(L) or p85 phosphatidylinositol 3-kinase association. J. Biol. Chem. 274:5153-5162.[Abstract/Free Full Text]
  86. 44
  87. van Leeuwen, J. E., P. K. Paik, and L. E. Samelson. 1999. The oncogenic 70Z Cbl mutation blocks the phosphotyrosine binding domain-dependent negative regulation of ZAP-70 by c-Cbl in Jurkat T cells. Mol. Cell. Biol. 19:6652-6664.[Abstract/Free Full Text]
  88. 45
  89. Varma, R., G. Campi, T. Yokosuka, T. Saito, and M. L. Dustin. 2006. T cell receptor-proximal signals are sustained in peripheral microclusters and terminated in the central supramolecular activation cluster. Immunity 25:117-127.[CrossRef][Medline]
  90. 46
  91. Veillette, A., S. Latour, and D. Davidson. 2002. Negative regulation of immunoreceptor signaling. Annu. Rev. Immunol. 20:669-707.[CrossRef][Medline]
  92. 47
  93. Wilson, B. S., J. R. Pfeiffer, Z. Surviladze, E. A. Gaudet, and J. M. Oliver. 2001. High resolution mapping of mast cell membranes reveals primary and secondary domains of Fc(epsilon)RI and LAT. J. Cell Biol. 154:645-658.[Abstract/Free Full Text]
  94. 48
  95. Wu, J. N., and G. A. Koretzky. 2004. The SLP-76 family of adapter proteins. Semin. Immunol. 16:379-393.[CrossRef][Medline]
  96. 49
  97. Yokosuka, T., K. Sakata-Sogawa, W. Kobayashi, M. Hiroshima, A. Hashimoto-Tane, M. Tokunaga, M. L. Dustin, and T. Saito. 2005. Newly generated T cell receptor microclusters initiate and sustain T cell activation by recruitment of Zap70 and SLP-76. Nat. Immunol. 6:1253-1262.[CrossRef][Medline]
  98. 50
  99. Yokouchi, M., T. Kondo, A. Houghton, M. Bartkiewicz, W. C. Horne, H. Zhang, A. Yoshimura, and R. Baron. 1999. Ligand-induced ubiquitination of the epidermal growth factor receptor involves the interaction of the c-Cbl RING finger and UbcH7. J. Biol. Chem. 274:31707-31712.[Abstract/Free Full Text]
  100. 51
  101. Zhang, W., J. Sloan-Lancaster, J. Kitchen, R. P. Trible, and L. E. Samelson. 1998. LAT: the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92:83-92.[CrossRef][Medline]
  102. 52
  103. Zhang, W., R. P. Trible, and L. E. Samelson. 1998. LAT palmitoylation: its essential role in membrane microdomain targeting and tyrosine phosphorylation during T cell activation. Immunity 9:239-246.[CrossRef][Medline]
  104. 53
  105. Zhang, W., R. P. Trible, M. Zhu, S. K. Liu, C. J. McGlade, and L. E. Samelson. 2000. Association of Grb2, Gads, and phospholipase C-{gamma}1 with phosphorylated LAT tyrosine residues. Effect of LAT tyrosine mutations on T cell antigen receptor-mediated signaling. J. Biol. Chem. 275:23355-23361.[Abstract/Free Full Text]


Molecular and Cellular Biology, December 2007, p. 8622-8636, Vol. 27, No. 24
0270-7306/07/$08.00+0     doi:10.1128/MCB.00467-07
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Lee, J. S., Lee, J. E., Oh, Y. M., Park, J. B., Choi, H., Choi, C. Y., Kim, I.-H., Lee, S. H., Choi, K. (2009). Recruitment of Sprouty1 to Immune Synapse Regulates T Cell Receptor Signaling. J. Immunol. 183: 7178-7186 [Abstract] [Full Text]  
  • Carrizosa, E., Gomez, T. S., Labno, C. M., Klos Dehring, D. A., Liu, X., Freedman, B. D., Billadeau, D. D., Burkhardt, J. K. (2009). Hematopoietic Lineage Cell-Specific Protein 1 Is Recruited to the Immunological Synapse by IL-2-Inducible T Cell Kinase and Regulates Phospholipase C{gamma}1 Microcluster Dynamics during T Cell Spreading. J. Immunol. 183: 7352-7361 [Abstract] [Full Text]  
  • Baker, R. G., Hsu, C. J., Lee, D., Jordan, M. S., Maltzman, J. S., Hammer, D. A., Baumgart, T., Koretzky, G. A. (2009). The Adapter Protein SLP-76 Mediates "Outside-In" Integrin Signaling and Function in T Cells. Mol. Cell. Biol. 29: 5578-5589 [Abstract] [Full Text]  
  • Chiang, Y. J., Jordan, M. S., Horai, R., Schwartzberg, P. L., Koretzky, G. A., Hodes, R. J. (2009). Cbl Enforces an SLP76-dependent Signaling Pathway for T Cell Differentiation. J. Biol. Chem. 284: 4429-4438 [Abstract] [Full Text]  
  • Prasad, A., Zikherman, J., Das, J., Roose, J. P., Weiss, A., Chakraborty, A. K. (2009). Origin of the sharp boundary that discriminates positive and negative selection of thymocytes. Proc. Natl. Acad. Sci. USA 106: 528-533 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Balagopalan, L.
Right arrow Articles by Samelson, L. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Balagopalan, L.
Right arrow Articles by Samelson, L. E.