Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2007, p. 912-925, Vol. 27, No. 3
0270-7306/07/$08.00+0 doi:10.1128/MCB.01223-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Kyle D. Mansfield,2,
,
Cara C. Bertozzi,2
Viktoriya Rudenko,2
Denise A. Chan,3
Amato J. Giaccia,3 and
M. Celeste Simon1,2*
Howard Hughes Medical Institute, University of Pennsylvania, Philadelphia, Pennsylvania 19104,1 Abramson Family Cancer Research Institute, University of Pennsylvania, Philadelphia, Pennsylvania 19104,2 Center for Clinical Science Research, Department of Radiation Oncology, Stanford University, Stanford, California 943053
Received 6 July 2006/ Returned for modification 4 August 2006/ Accepted 2 November 2006
|
|
|---|
) proteins is essential for their recognition by pVHL containing ubiquitin ligase complexes and subsequent degradation in oxygen (O2)-replete cells. Therefore, HIF prolyl hydroxylase (PHD) enzymatic activity is critical for the regulation of cellular responses to O2 deprivation (hypoxia). Using a fusion protein containing the human HIF-1
O2-dependent degradation domain (ODD), we monitored PHD activity both in vivo and in cell-free systems. This novel assay allows the simultaneous detection of both hydroxylated and nonhydroxylated PHD substrates in cells and during in vitro reactions. Importantly, the ODD fusion protein is regulated with kinetics identical to endogenous HIF-1
during cellular hypoxia and reoxygenation. Using in vitro assays, we demonstrated that the levels of iron (Fe), ascorbate, and various tricarboxylic acid (TCA) cycle intermediates affect PHD activity. The intracellular levels of these factors also modulate PHD function and HIF-1
accumulation in vivo. Furthermore, cells treated with mitochondrial inhibitors, such as rotenone and myxothiazol, provided direct evidence that PHDs remain active in hypoxic cells lacking functional mitochondria. Our results suggest that multiple mitochondrial products, including TCA cycle intermediates and reactive oxygen species, can coordinate PHD activity, HIF stabilization, and cellular responses to O2 depletion. |
|
|---|
and ß subunits (29, 55, 56). One ß-subunit, the aryl hydrocarbon receptor nuclear translocator (ARNT), is primarily responsible for cellular HIF transcriptional activity (31, 39, 40, 56). In contrast, three
subunits play distinct roles in this "stress" response (6). HIF-1
is ubiquitously expressed and therefore responsible for a major component of HIF activity in O2-starved cells (3, 50). HIF-2
and HIF-3
expression is tissue restricted, implying more specific functions (29, 38, 55). HIF function is largely modulated by HIF-
subunit stability based on O2 availability. Under normoxia (>5% O2), HIF-
subunits are expressed at extremely low levels due to rapid degradation via the ubiquitin-proteasome pathway (53). HIF-
protein turnover is ensured by hydroxylation of critical proline residues within the oxygen-dependent degradation domains (ODDs) (23), allowing their association with von Hippel-Lindau protein (pVHL)-containing E3 ubiquitin ligase complexes (7, 16, 21, 27, 28, 44, 58). However, under hypoxic conditions (
5% O2), HIF prolyl hydroxylation is largely diminished, causing dissociation from pVHL and HIF-
stabilization (27, 28, 58).
HIF-specific prolyl hydroxylases, or prolyl hydroxylation domain-containing proteins (referred to as PHDs here) catalyze HIF-
prolyl hydroxylation (16). PHDs and their involvement in HIF-
protein stability regulation are evolutionarily conserved. Only one PHD ortholog has been detected in Caenorhabditis elegans. In contrast, three PHDs have been identified in mammalian cells, namely, PHD1, PHD2, and PHD3, whose alternative names are EglN2, EglN1, and EglN3, respectively. They share a highly conserved C-terminal domain carrying enzymatic activity, whereas each protein has a distinct N-terminal domain (16). Of note, PHD2 appears to be the predominant form that regulates HIF-1
protein stability in vivo (4).
The PHDs belong to an
-ketoglutarate (2-oxoglutarate)-dependent dioxygenase superfamily (7, 16, 26), which uses O2 as a cosubstrate to add a hydroxyl group to specific proline residues within the HIF-
ODDs (20). Unlike some members of the dioxygenase family, the requirement for O2 as a substrate is absolute and cannot be substituted by an H2O molecule (20, 43). Ferrous iron (Fe2+) is also required for the enzyme to be assembled into its active conformation. In PHD2, the dominant prolyl hydroxylase for HIF-1
protein in vivo, the Fe2+ resides in a largely hydrophobic active site (42). During a complete reaction, the Fe2+ is transiently oxidized to Fe4+ and restored to the Fe2+ state (13, 46). However, when
-ketoglutarate is converted into succinate without hydroxylation of a peptide substrate, this Fe2+ is oxidized to Fe3+ during the reaction. During this process ascorbate is required to reduce the Fe3+ back to Fe2+ in order for the enzyme to be recycled (13, 46). Therefore, intracellular ascorbate and Fe2+ levels can also affect PHD enzymatic activity and HIF-
protein accumulation (33, 34).
Other important factors that regulate PHD activity are its substrate and product,
-ketoglutarate and succinate, respectively. Not surprisingly, succinate functions as a competitive inhibitor which is reversible by
-ketoglutarate (35, 54). Both
-ketoglutarate and succinate are tricarboxylic acid (TCA) cycle intermediates, suggesting that cross talk between energy production and hypoxic transcriptional responses is an important consideration. Another TCA cycle intermediate, fumarate, has also been reported to function as a PHD inhibitor (25). Patients harboring germ line mutations within genes encoding succinate dehydrogenase or fumarase complex components develop tumors such as pheochromocytoma and paraganglioma (15, 49). Recent studies suggest that abnormal succinate and fumarate levels contribute to the highly vascular nature of such tumors due to perturbed PHD activity and elevated basal levels of HIF-
protein (25, 35, 54). The fact that VEGF is a HIF target gene likely explains their highly vascular nature. Although not currently linked to any human malignancies, several other glucose metabolites such as oxaloacetate have also been shown to affect PHD activity in multiple human cancer cell lines, such as U87 and U251 human glioma cells and human O22 head and neck cancer cells (36).
Reactive oxygen species (ROS) have been shown to regulate HIF-
protein levels in vivo and in vitro as well. We previously observed that increased mitochondrial ROS during hypoxia correlate with HIF-
stabilization (11, 12) and that exogenous ROS promote HIF accumulation under normoxia (12, 41). Tumors treated with ionizing irradiation exhibit elevated HIF-1
levels due to increased ROS (45). Furthermore, JunD-null mouse embryonic fibroblasts exhibit normoxic HIF-1
protein stabilization due to lower levels of ROS scavenging enzymes such as microsomal glutathione-S-transferase-1 and cysteine dioxygenase (17). Cells overexpressing mitochondrial superoxide dismutase exhibit higher baseline levels of HIF-1
, presumably due to increased levels of H2O2 (57), while macrophages produce ROS in response to bacterial infection and exhibit higher levels of HIF-1
protein due to enhanced transcription (5). Other nonhypoxic signals such as thrombin also stimulate HIF-1
transcription via ROS production (47). Taken together, these results suggest ROS are critical to HIF regulation in a variety of conditions. Paradoxically, ROS levels increase when cells encounter hypoxia. Therefore, we proposed that ROS contribute to HIF-
protein stabilization under low-O2 conditions (8, 11, 12, 18, 41).
Cells lacking functional mitochondria are defective in HIF-
protein accumulation under low O2 (8, 11, 12, 18, 41). Two possible mechanisms can explain these results. One is that ROS are required for hypoxic HIF-
protein stabilization; hypoxic cells lacking functional mitochondria fail to increase mitochondrial ROS levels or stabilize HIF-
protein (8, 18, 30, 41). An alternative interpretation is that mitochondria function as "O2 sinks" to limit O2 availability for other O2-consuming cellular processes, including HIF hydroxylation during hypoxia (14, 19). Inhibiting mitochondria would allow enzymes such as PHDs to obtain enough O2 to remain active even during O2 deprivation. Unfortunately, cells deficient for functional mitochondria cannot distinguish between these two possibilities, since they do not separate the process of ROS production from O2 consumption. However, published data using ROS scavengers to attenuate HIF accumulation under hypoxia support mitochondrial ROS regulation of HIF-
stability (8, 11, 12, 18, 52).
Although prolyl hydroxylation is a critical step during HIF regulation, there is currently no convenient way to measure PHD activity. Standard in vitro biochemical assays measure the conversion of radiolabeled
-ketoglutarate to CO2 (20). Although quantitative, this method is limited to in vitro studies and often encounters high background signals due to uncoupled reactions. It also requires special equipment to handle radioactive gas. Another widely used method of measuring HIF prolyl hydroxylation is the pVHL capture assay (16). However, this technique involves multiple steps such as immunoprecipitation or far-Western assays. The most convenient way of measuring HIF prolyl hydroxylation is to use a hydroxyproline-specific HIF-1
antibody (10). Unfortunately, none of these methods allows the simultaneous detection of both hydroxylated and nonhydroxylated HIF-
, making them less amenable to data quantitation. Fusion proteins containing the human HIF-1
ODD exhibit differential migration upon sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) when hydroxylated (22, 27). Taking advantage of this finding, we constructed a GAL4-HA-HIF1
ODD fusion protein and used its differential migration as a read-out of PHD activity in vivo and in vitro. Our studies demonstrate that multiple factors, such as Fe2+, TCA cycle intermediates, and ROS levels, as well as mitochondrial respiration rates, modulate PHD activity. Importantly, all of these factors are affected by mitochondrial function, underscoring its role in coordinating cellular responses to O2 deprivation.
|
|
|---|
Plasmid and transfection.
The "GHO" protein contains a GAL4 DNA-binding domain, an HA tag, and the human HIF-1
ODD domain (amino acids 496 to 626) (27). GHO and GHO(P
A) cDNA were cloned into pCDNA3 (Hygro) vector (Invitrogen) and transfected into HEK 293T cells by using the calcium phosphate precipitation method. Hygromycin-resistant clones were selected and screened for GHO or GHO(P
A) protein expression. GHO cDNA was also cloned into station II vector (41) and transfected into Vhl-null ES cells via electroporation. Hygromycin-resistant clones were selected and screened for GHO protein expression.
In vitro hydroxylation assay.
When cell lysate was used as a source of HIF prolyl hydroxylases, 107 HEK 293T cells were lysed in 1 ml of HEB buffer (20 mM Tris-HCl [pH 7.4], 5 mM KCl, 1.5 mM MgCl2) containing protease inhibitors and phosphatase inhibitors. For each 50-µl reaction, 200 µg of total protein was used. A wheat germ in vitro transcription-translation (IVT) system was used to generate unhydroxylated GHO and GHO(P
A) proteins according to manufacturer's instructions (Promega). IVT GHO and GHO(P
A) proteins were used as substrates for in vitro reactions. Recombinant glutathione S-transferase (GST)-conjugated human PHD2 (wtPHD2) and PHD2(H313Y) (mPHD2) proteins were kindly provided by Matthew Coleman (University of Pennsylvania). Each reaction was carried out at 37°C for 15 min and terminated by adding 12.5 µl of 5x SDS loading buffer.
Hypoxic culture conditions. All experiments conducted to measure hypoxic responses were carried out in an In Vivo2 hypoxic workstation (Ruskinn Technologies, Leeds, United Kingdom). In vitro reactions carried out under hypoxic conditions were terminated by adding SDS loading buffer inside of the hypoxic workstation. For cell-based assays, cells were lysed inside the hypoxic workstation.
Measurement of the respiration rate. The O2 consumption rates were measured by a polarographic O2 electrode (Cameron Instrument Col, Port Arkansas, TX) in a water-jacketed respirometer chamber at 37°C. Mitochondrial respiration was calculated by subtracting KCN-independent oxygen consumption from the total O2 consumption.
Chemicals and reagents.
MitoQ was kindly provided by Michael Murphy of the Medical Research Council Dunn Human Nutrition Unit, Wellcome Trust, United Kingdom. All other chemicals were purchased from Sigma-Aldrich. Anti-human HIF-1
antibody and anti-mouse immunoglobulin G antibody was obtained from Transduction Laboratories. Anti-HA antibody was obtained from Roche. Anti-hydroxy-HIF-1
antibody was generated as previously described (9).
Quantitative reverse transcription-PCR (RT-PCR).
RNA was prepared by using RNAzolB (Tel-Test Labs) according to instructions provided by the manufacturer. Superscript II (Invitrogen) was used to generate cDNA from DNase I-treated RNA. Real-time quantitative PCR was performed using an ABI Prism 7900HT (Applied Biosystems) with standard SYBR green detection assays. The primers were as follows: HIF-1
(TTTTACCATGCCCCAGATTCA and AGTGCTTCCATCGGAAGGACT), ACTIN-B (GCCCTGAGGCACTCTTCCA and ATGCCACAGGACTCCATGC), and PGK-1 (TGGCTTCTGGCATACCTGCT and GCTGCTTTCAGGACCACAGCT).
|
|
|---|
, HIF-2
, and HIF-3
is a key step in the regulation of their stability. During this process, an oxygen atom from dioxygen (O2) is integrated into a hydroxyl group, covalently modifying two proline residues (Fig. 1A).
-Ketoglutarate is simultaneously converted to carbon dioxide (CO2) and succinate, which contains the other oxygen atom from O2. PHD binds Fe2+, and ascorbate is required to reduce any Fe2+ oxidized to Fe3+ back to Fe2+, maintaining enzymatic activity (Fig. 1A). In order to readily assess in vivo and in vitro PHD activity, we generated a fusion protein containing the HIF-1
ODD (amino acids 496 to 626) that changes its mobility on SDS-PAGE upon prolyl hydroxylation (Fig. 1B). The unhydroxylated peptide migrates more slowly relative to the hydroxylated form (27). Although two human HIF-1
proline residues can be hydroxylated (402 and 564), this fusion protein contains only proline 564. HIF-1
is stable under normoxic conditions when proline 564 is mutated to alanine (27, 28, 58). Since this protein is a fusion of a GAL4 (ß-galactosidase) DNA-binding domain, an HA (hemagglutinin HA1 fragment) peptide, and human HIF-1
ODD domain, we called it the "GHO" reporter protein.
![]() View larger version (28K): [in a new window] |
FIG. 1. A fusion protein containing the human HIF-1 ODD exhibits differential mobility during SDS-PAGE when hydroxylated. (A) Schematic illustration of the prolyl hydroxylation reaction. (B) Proposed hydroxylation of the GHO fusion protein by PHDs. GHO contains a single proline residue that can be hydroxylated (red bold). (C) Bacterially produced GST-wtPHD2 was used to hydroxylate wheat germ IVT-produced GHO protein in vitro. HA antibody was used to detect both the hydroxylated and the unhydroxylated GHO species. Samples from identical experiments were also run on duplicate gels, probed with anti-HA and anti-HIF hydroxyproline antibody, respectively. In vitro-translated GHO(P A) protein with the critical proline residue mutated to alanine was assayed in in vitro hydroxylation reactions and detected by anti-HA antibody. (D) HEK 293T cell lysates were prepared in HEB buffer and used to hydroxylate wheat germ IVT GHO protein (upper panel). Reactions included the indicated amounts of FeCl2 and ascorbate under normoxic conditions with 1 mM DFX or inside a hypoxia workstation at 1.5% O2. Densitometry analysis was performed to quantify relative GHO hydroxylation levels under each condition, and the results were plotted in a histogram. In the lower panel, GHO protein was transiently expressed in HEK 293T cells. In lanes 2 to 4, Flag-tagged human PHD1, PHD2, and PHD3 were individually coexpressed with the GHO protein. In lanes 5 to 7, transfected cells were treated with 100 µM DFX, 100 µM CoCl2, and 1.5% O2, respectively, for 4 h prior to harvest.
|
protein stability in vivo (4). Therefore, we obtained bacterially produced GST-human PHD2 (wtPHD2), as well as a mutant PHD2 with histine 313 in the catalytic domain mutated to a tyrosine (mPHD2). We used the wheat germ IVT system to produce unhydroxylated GHO fusion protein (27). In an in vitro hydroxylation assay, when Fe2+, ascorbate, and
-ketoglutarate were added to wtPHD2, IVT-produced GHO proteins exhibited a substantial increase in the intensity of the lower hydroxylated species (Fig. 1C, lane 3). This indicates that a significant amount of GHO protein had been hydroxylated (Fig. 1C, left, upper panel). When mPHD2 was used, no GHO mobility shift was observed in the presence of all cofactors and cosubstrates (Fig. 1C, lane 1), indicating the effects on migration were the result of PHD enzymatic activity. Hydroxylation was further confirmed on duplicated blots containing samples subjected to identical conditions probed with both HA antibody and anti-hydroxy HIF-1
antibody, respectively (Fig. 1C, left, lower two panels). Importantly, when a mutant GHO protein in which the critical proline had been mutated to an alanine residue, GHO(P
A), was used as the substrate in identical reactions, no mobility shift was observed, demonstrating that proline hydroxylation was required (Fig. 1C, right). We also used HEK 293T cell lysate as a source of PHD activity to perform in vitro hydroxylation assays. When Fe2+ or ascorbate was added, the percentage of the faster migrating band increased from 18% to 57 and 48%, respectively, indicating increased PHD enzymatic activity in these reactions (Fig. 1D). Desferrioxamine (DFX) inhibits PHD activity, presumably by acting as an Fe3+ chelator, while O2 is a cosubstrate for the prolyl hydroxylation reaction (16). Indeed, adding DFX to the reaction or performing the same assay at 1.5% O2 resulted in decreased intensity of the lower band (for DFX, from 57 to 40% in the presence of Fe2+ and from 48 to 26% in the presence of ascorbate; for hypoxia, from 57 to 42% in the presence of Fe2+ and from 48 to 32% in the presence of ascorbate). These results indicate that PHD activity decreased under these conditions (Fig. 1D). Importantly, similar experiments have been performed multiple times, giving comparable results, and representative assays are presented here.
In order to verify that the GHO peptide was useful as a measurement for PHD enzymatic activity in vivo, we transfected the GHO construct into HEK 293T cells along with either human PHD1, PHD2, or PHD3. Expression of Flag-tagged PHDs was confirmed by Western analysis with an anti-Flag antibody (data not shown). Without PHD cotransfection, ca. 50% of the GHO protein transiently expressed in HEK 293T cells migrated more slowly, indicating about half of the peptide was hydroxylated (Fig. 1D, lane 1). When each PHD was overexpressed, the amount of GHO migrating as the faster form increased to 75 to 92% (Fig. 1D, lanes 2, 3, and 4). This further confirms that the slower-migrating form is unhydroxylated GHO fusion protein and the faster-migrating species is hydroxylated. In addition, all GHO proteins migrated more slowly when cells were treated with the hypoxia mimetics DFX and CoCl2 (Fig. 1D, lanes 5 and 6), further validating that the slower-migrating form is unhydroxylated.
Multiple factors affect GHO hydroxylation in vitro.
The HIF prolyl hydroxylation reaction involves multiple factors that vary in concentration under different conditions in vivo. Therefore, it was important to investigate how different levels of either cofactors or potential inhibitors affect hydroxylation. We used HEK 293T cell lysate as a PHD source to hydroxylate IVT-produced GHO protein. Cell lysates in reactions lacking exogenous Fe2+ and ascorbate exhibited PHD activities that were insufficient to hydroxylate significant amounts of GHO protein (Fig. 2A). However, when Fe2+ and ascorbate were added, the abundance of the lower hydroxylated form increased from 17% to 52 and 46%, respectively (Fig. 2A). Addition of
-ketoglutarate, along with ascorbate and Fe2+, further increased the amount of the hydroxylated GHO protein to 77% (Fig. 2A).
![]() View larger version (56K): [in a new window] |
FIG. 2. Iron (Fe), ascorbate, and TCA cycle intermediates promote GHO prolyl hydroxylation in vitro. (A) Bacterially produced GST-wtPHD2 was used to hydroxylate GHO protein in HEB buffer with or without FeCl2, ascorbate, and -ketoglutarate at the indicated concentrations. (B) HEK 293T cell lysate was used to hydroxylate in vitro-translated GHO protein in the presence of different concentrations of additional FeCl2, ascorbate, and -ketoglutarate, respectively. (C) HEK 293T cell lysate supplemented with 100 µM ascorbate was used in the in vitro hydroxylation assay at the indicated conditions. (D) HEK 293T cell lysate supplemented with 100 µM ascorbate was used to hydroxylate GHO in vitro with the indicated concentrations of glucose metabolites added.
|
-ketoglutarate. Interestingly, in vitro hydroxylation of GHO using HEK 293T cell lysate was extremely sensitive to exogenous Fe2+ (Fig. 2B), where the addition of as little as 1 µM FeCl2 increased GHO hydroxylation from 45 to 53% (Fig. 2B). The addition of 10 to 1,000 µM ascorbate also enhanced GHO hydroxylation, presumably by reducing Fe3+ to Fe2+ in these assays (Fig. 2B). By lysing cells in a volume 10 to 20 times that of the original pellet,
-ketoglutarate concentrations in an in vitro reaction should be well below the reported Km, which is ca. 50 µM (20). Surprisingly, exogenous
-ketoglutarate did not further increase GHO hydroxylation when added alone (Fig. 2B); in fact,
-ketoglutarate slightly inhibited the overall GHO hydroxylation at high concentrations (comparing 39% GHO hydroxylation with 1,000 µM
-ketoglutarate to 45% GHO hydroxylation in control samples). These results suggested that PHD activity is not only affected by the concentration of cofactors and cosubstrates but also by their relative levels.
Two TCA cycle intermediates are involved in HIF-
prolyl hydroxylation reactions:
-ketoglutarate as a substrate and succinate as a product. For many enzymes, the product can serve as a competitive inhibitor of the substrate. We have reported that intracellular succinate accumulation due to defective succinate dehydrogenase activity results in lower PHD activities and elevated HIF-
protein levels under normoxic conditions (54). Fumarate is another TCA cycle intermediate previously shown to negatively regulate intracellular PHD activity (25). In a dose-response analysis comparing the inhibitory effect of succinate and fumarate, fumarate appeared to be a more potent inhibitor of GHO protein hydroxylation (Fig. 2C, lanes 1 to 5). Adding 3 mM
-ketoglutarate reversed the inhibitory effect of 1 mM succinate but failed to influence the effect of 1 mM fumarate (Fig. 2C, lanes 6 to 9). Malate, which is downstream of fumarate in the TCA cycle, also inhibited the hydroxylation reaction in a manner that was not reversed by
-ketoglutarate (Fig. 2C), suggesting that other TCA cycle intermediates modulate PHD activity by distinct mechanisms from those of succinate. Since Fe2+ levels significantly affect PHD activity in our in vitro assay, we speculate that malate may exert its inhibitory effect via an iron and ascorbate reversible mechanism. Indeed, we observed the loss of malate inhibition when 1 mM ascorbate or 50 µM FeCl2 was added (Fig. 2C, lower two panels). These results imply that malate may promote uncoupled catalytic reactions resulting in oxidation of the PHD bound Fe2+. Interestingly, PHD inhibition by fumarate is much less sensitive to addition of ascorbate and Fe2+ (Fig. 2C, lower two panels, last lanes), further suggesting distinct inhibitory mechanisms by various TCA cycle intermediates.
Pyruvate, lactate, and oxaloacetate are all abundant in the cytosol. We examined their effect on PHD activity in our 293T cell lysate-based in vitro assay. However, we did not detect any obvious inhibitory activity of these three compounds (Fig. 2D). This suggests that PHD enzymes are not simply inhibited by any nonspecific glucose metabolites. In conclusion, our results indicate that the concentrations of multiple factors, including Fe2+, ascorbate, and various TCA cycle intermediates, can alter PHD activity in vitro.
GHO mimics the stability of endogenous HIF-1
protein.
To evaluate GHO hydroxylation within intact cells, we generated stable HEK 293T transformants expressing GHO peptide. At 21% O2, GHO expression was barely detectable (Fig. 3A, left panel, lane 1; compare this also to the HIF-1
levels shown below); however, the proteasome inhibitor calpain inhibitor I (ALLN) increased GHO protein levels (Fig. 3A, lane 2). Upon DFX or 1.5% O2 treatment, GHO abundance increased dramatically (Fig. 3A, lanes 3 and 4). Moreover, lysates obtained from DFX-treated and hypoxic cells exhibited slower migration of GHO protein than in ALLN-treated cells (Fig. 3A), suggesting it was unhydroxylated. In sharp contrast, the GHO(P
A) protein, which cannot be hydroxylated, was readily detected by Western analysis under normoxic conditions (Fig. 3A, right panel, lane 1). Treatment with DFX or hypoxia failed to further increase the level of GHO(P
A) protein levels or alter its migration (Fig. 3A, right panel, lane 3 and 4). Taken together, these experiments strongly suggest that the GHO protein is degraded at 21% O2 as a consequence of its prolyl hydroxylation.
![]() View larger version (48K): [in a new window] |
FIG. 3. GHO protein stability mimics that of endogenous HIF-1 protein in HEK 293T cells. (A) GHO and GHO(P>A) protein were stably expressed in HEK 293T cells. Cells were treated with 100 µM ALLN, 100 µM DFX, and 1.5% O2 for 4 h prior to harvest. (B) HEK 293T stable transformants expressing GHO protein were treated with 1.5% O2 for 6 h or 24 h, respectively. Cells were removed from the hypoxia workstation and lysed at the indicated times after reoxygenation. Cells harvested inside the workstation were used as time zero. Untreated normoxic cells (N) and cells exposed to 100 µM DFX for 4 h (D) were used as controls. A nonspecific band (NS) serves as a loading control. (C) HEK 293T cells expressing GHO protein were exposed to 1.5% O2 for 24 h. At 1 h prior to reoxygenation, 100 µM ALLN was added to the medium. Cells were harvested at the indicated times after reoxygenation. Normoxic cells treated with ALLN only (N) were used as a control. Four independent experiments were performed, and the results of GHO hydroxylation were quantified and are presented as a bar graph.
|
protein abundance (Fig. 3B, lower panel). Impressively, the kinetics of HIF-1
accumulation and degradation were identical to the stably expressed GHO protein. In cells exposed to 1.5% O2 for 24 h, both HIF-1
and GHO protein were degraded more rapidly upon reoxygenation compared to cells that had been exposed for only 6 h (Fig. 3B). In order to more clearly measure the kinetics of GHO protein hydroxylation upon reoxygenation, we grew GHO-expressing cells at 1.5% O2 for 24 h and added the proteasome inhibitor ALLN to block protein degradation. When these cells were reexposed to 21% O2, GHO hydroxylation instantly resumed (Fig. 3C). After 40 s of reoxygenation, GHO was 42% hydroxylated, compared to less than 10% hydroxylation before reoxygenation. GHO hydroxylation was completely restored to normoxic levels after only 6 min of reoxygenation (Fig. 3C). Since PHD2 and PHD3 expression is regulated by HIF-
proteins (2), our results are consistent with the concept that cells exposed to prolonged hypoxia have elevated PHD hydroxylase activities when O2 levels are restored. The synchronized expression pattern of endogenous HIF-1
and GHO proteins in this hypoxia-reoxygenation experiment further validates the use of GHO as a tool to assess PHD activities in tissue culture cells.
GHO protein is hydroxylated in hypoxic cells treated with mitochondrial respiration inhibitors.
cyt c-null embryonic cells lack a functional respiratory electron transport chain and consume significantly less O2 than do wild-type cells (41). Since a functional electron transport chain is an important source of ROS, these cells also fail to generate mitochondrial ROS during hypoxia (18, 41). We confirmed our previous finding that cyt c-null cells cannot stabilize HIF-1
protein after growth at 1.5% O2 for 4 h and hypothesized that this is due to decreased mitochondria ROS (Fig. 4A). As shown previously (41), HIF-1
protein was stabilized in cyt c-null cells by the proteasome inhibitor ALLN under both normoxic and hypoxic conditions in cyt c-null cells (Fig. 4A). Using a HIF hydroxy proline specific antibody, we observed that HIF-1
prolyl hydroxylation levels in hypoxic cyt c-null cells were as high as in normoxic cells (Fig. 4A). This observation strongly suggests that without functional mitochondria, PHDs remain active under hypoxic conditions, causing HIF-1
instability.
![]() View larger version (49K): [in a new window] |
FIG. 4. Cells lacking a functional mitochondrial respiratory chain retain PHD activity under low O2. (A) Wild-type and cyt c-null embryonic cells were exposed to 1.5% O2 or 100 µM DFX for 4 h in the presence or absence of 10 µM MG132 as indicated. Total HIF-1 protein and hydroxy HIF-1 protein levels were measured by Western blotting. Of note, samples assayed for HIF-1 accumulation demonstrated multiple alternatively phosphorylated species. Identical lysates were rerun on SDS-polyacrylamide gels to probe for hydroxylated HIF-1 so that HIF-1 appears as a single species at 100 kDa. (B) HEK 293T cells stably expressing the GHO protein were exposed to 1.5% O2 or 100 µM DFX for 4 h in the presence of different concentrations of mitochondrial inhibitors rotenone or myxothiazol. (C) The inhibition of HEK 293T cell respiration by different doses of rotenone or myxothiazol was measured as cellular KCN-dependent O2 consumption. All respiration rates were normalized to that of untreated cells.
|
and HIF-2
fail to accumulate under hypoxic conditions in multiple cell lines treated with these mitochondrial inhibitors (11, 41). In order to demonstrate that diminished HIF-
stabilization upon mitochondrial inhibition is due to sustained PHD activity at 1.5% O2, we used HEK 293T transformants expressing the GHO reporter protein. When normoxic cells were treated with ALLN, the GHO peptide was detected as a single band (Fig. 4B, lanes 1 to 3). Rotenone and myxothiazol treatment did not change GHO mobility (Fig. 4B), suggesting that under normoxic conditions all GHO peptides are hydroxylated and unaffected by these mitochondrial poisons. As expected, hypoxia inhibited GHO prolyl hydroxylation, reducing the quantity of the hydroxylated form (Fig. 4B, lane 4). In contrast, when treated with either rotenone or myxothiazol, GHO prolyl hydroxylation levels did not change in cells grown at 1.5% O2, indicated by the maintenance of the hydroxylated form under various conditions (Fig. 4B, lanes 5 to 9). Rotenone and myxothiazol effects on GHO hydroxylation levels were also dose dependent (Fig. 4B), as confirmed by their ability to inhibit cellular respiration (Fig. 4C). DFX likely inhibits PHD function by chelating iron, therefore bypassing any mitochondrial signal. The addition of rotenone or myxothiazol to DFX-treated cells had no effect on its inhibitory effect on GHO prolyl hydroxylation (Fig. 4B, lanes 10 to 12). These results suggest that O2 deprivation inhibits PHD activity via a mechanism that requires functional mitochondria in hypoxic cells.
Mitochondrial inhibitors restore GHO prolyl hydroxylation in hypoxic VHL-deficient RCC cells.
We performed similar experiments in 786-O cells, a human renal clear cell carcinoma (RCC) line lacking the HIF-
ubiquitin ligase component pVHL (24). In these cells, HIF-
protein is stabilized under normoxic conditions, while the hydroxylation is still maintained. The use of these cells allowed us to monitor GHO hydroxylation status without using proteasome inhibitors, which was toxic after prolonged treatment. As expected, GHO protein was hydroxylated but not degraded in normoxic 786-O cells (Fig. 5A, lane 1). Growing 786-O cells at 1.5% O2 for 4 h reduced the fraction of hydroxylated GHO protein from 79 to 43% (Fig. 5A, lane 5). In contrast, hypoxic cells treated with rotenone or myxothiazol retained 61 to 66% of the hydroxylated GHO protein (Fig. 5A, lanes 6 and 7).
![]() View larger version (33K): [in a new window] |
FIG. 5. Hypoxic 768-O cells treated with mitochondrial inhibitors resume GHO hydroxylation. (A) 786-O stable transformants expressing GHO protein were exposed to 21% O2 or 1.5% O2 for 4 h in the presence or absence of DFX, rotenone, or myxothiazol as indicated. GHO protein was detected by Western analysis with HA antibody; densitometry analysis was used to measure GHO protein hydroxylation levles. (B) GHO-expressing 786-O cells were cultured at 1.5% O2 overnight; rotenone or myxothiazol were added in the hypoxic workstation, and cells were harvested at different times after drug treatment as indicated. Normoxic and DFX-treated cells were used as controls. Levels of GHO protein hydroxylation were measured by Western blot and densitometry analyses. The inhibition of 786-O cellular respiration by different doses of rotenone or myxothiazol was measured as cellular KCN-dependent O2 consumption. All respiration rates were normalized to that of untreated cells. (C) The indicated concentrations of MitoQ were added to culture medium for 4 h. After an additional 4 h of hypoxic and normoxic incubation, cells were harvested for analysis. Three parallel sets of samples were used. One set was harvested for HIF-1 and actin Western analysis. Another was treated with 100 µM ALLN to block protein degradation and harvested for GHO protein Western analysis. The third set was harvested at the same time for respiration measurements.
|
It is not clear from our results whether mitochondrial poisons reverse hypoxic inhibition of PHD activities via increasing O2 availability or by blocking ROS production. The use of antioxidants can potentially distinguish between these two mechanisms. However, previous antioxidant studies yielded inconsistent results (11, 12, 18, 19). Since most pharmacological and enzymatic antioxidants may possess nonspecific or secondary effects, we attempted to circumvent this problem by using mitoubiquinone (MitoQ). This compound was described as a mitochondrion-specific ROS scavenger with minimal effects on respiration that reverses hypoxic stabilization of HIF-1
protein in Hep3B cells (52). We added various concentrations of MitoQ to 293T GHO cell cultures and measured its effect on HIF-1
abundance during hypoxia. MitoQ reversed hypoxic HIF-1
accumulation at 1 µM in this experiment (Fig. 5C). In parallel samples, 100 µM ALLN was added to block protein degradation so that both hydroxylated and unhydroxylated forms of GHO protein could be detected. In these samples, the GHO hydroxylation pattern suggests that the hypoxic inhibition of PHD enzyme was reversed by higher concentrations of MitoQ (Fig. 5C). However, when we checked the respiration rates on additional samples harvested at the same time, we found that MitoQ blocked respiration at the same concentration it effectively inhibited hypoxic HIF-1
accumulation (Fig. 5C, histogram). We obtained similar results using GHO expressing Vhl/ ES cells (data not shown). Therefore, we found that MitoQ could not help us to distinguish between these two mechanisms. However, this finding further supports the hypothesis that functional mitochondria are required for HIF-1
regulation.
Exogenous ROS inhibit GHO hydroxylation in vivo and in vitro.
Exogenous ROS (H2O2) have been shown to promote HIF-
protein accumulation under normoxic conditions (12, 18, 41). We therefore predicted that ROS treatment would abolish GHO prolyl hydroxylation in normoxic cells. Glucose oxidase is a continuous source of ROS when applied exogenously to cultured cells since it oxidizes glucose to yield H2O2 (Fig. 6A). The addition of catalase eliminates H2O2 by converting it to H2O. To test the effect of exogenous ROS on GHO hydroxylation, glucose oxidase was added to the media of HEK 293T cells expressing the GHO fusion protein. Proteasome inhibitors were also used to stabilize GHO protein under all conditions. We observed that the addition of glucose oxidase to culture medium inhibited GHO prolyl hydroxylation in a dose-dependent manner, as indicated by the disappearance of the hydroxylated band (Fig. 6B, lanes 2 to 5). As expected, adding catalase to the medium reversed this inhibitory effect, demonstrating that the effect of glucose oxidase was due to the H2O2 production (Fig. 6B, lanes 6 to 10). Similar experiments using GHO expressing pVHL-deficient 786-O cells (Fig. 6C) and RCC4 cells (Fig. 6D) yielded identical results. In addition, tert-butyl-H2O2, a stabilized form of H2O2, also blocked GHO prolyl hydroxylation when added to the medium (Fig. 6D, lanes 5 and 6).
![]() View larger version (41K): [in a new window] |
FIG. 6. Exogenous hydrogen peroxide (H2O2) inhibits GHO prolyl hydroxylation in vivo and in vitro. (A) Diagram of H2O2 production by glucose oxidase and subsequent metabolism by catalase. (B) HEK 293T cells stably expressing GHO were treated with increasing amounts of glucose oxidase in the presence or absence of catalase for 2 h as indicated. The experiment was carried out in the presence of 100 µM ALLN to prevent GHO protein degradation. Densitometry analysis estimated GHO hydroxylation. (C) 786-O cells stably expressing GHO protein were treated with various amounts of glucose oxidase with or without catalase as indicated. Western blots were probed for GHO protein, and the levels of hydroxylation were measured by densitometry. (D) RCC4 cells stably expressing GHO protein were treated with various amounts of glucose oxidase or tert-butyl H2O2 as indicated. DFX treatment was used as a control. Western blots were probed for GHO protein, and the levels of hydroxylation were measured by densitometry. (E) Bacterially produced GST-wtPHD2 was used to hydroxylate IVT-produced GHO protein in vitro. All reactions contained 1 mM -ketoglutarate, 100 µM ascorbate, and 100 µM FeCl2. Additional glucose oxidase, glucose, and/or catalase were added to different reactions as indicated. GHO prolyl hydroxylation was detected by Western blotting and quantitated by densitometry assay.
|
Exogenous H2O2 stabilizes HIF-1
protein but does not significantly increase HIF-1
transcript levels.
Since exogenous ROS inhibit GHO prolyl hydroxylation, increased HIF-1
protein levels generated by exogenous ROS have been primarily attributed to protein stability. However, it has been reported that ROS can stimulate HIF-1
transcription as well (5, 47). To investigate whether increased HIF-1
transcription was observed upon exogenous H2O2 treatment, we treated Hep3B cells with different doses of either H2O2 or glucose oxidase for various time intervals. Quantitative RT-PCR and Western analysis demonstrated that although HIF-1
protein levels increased after H2O2 treatment, HIF-1
transcript levels did not (Fig. 7A). As expected, prolonged glucose oxidase treatment resulted in increased HIF-1
protein levels and elevated expression of the downstream target phosphoglycerate kinase gene (PGK-1) (Fig. 7A). We did not observe an increase in PGK-1 expression after 1 h of H2O2 or DFX treatment due to the time required for HIF downstream target gene stimulation (Fig. 7A). We conducted similar experiments in HEK 293T cells with brief H2O2 exposures and also failed to observe any increase in HIF-1
transcription (data not shown). In fact, we actually detected a decrease in HIF-1
transcript levels, which we attributed to possible toxicity effects from exogenous H2O2 (Fig. 7A). These data suggest that exogenous H2O2 treatment increases HIF-1
by stabilizing the protein and not by promoting transcription in our experiments. We also performed HIF-1
immunofluorescence experiments on H2O2 and glucose oxidase-treated Hep3B cells. As expected, these treatments resulted in nuclear accumulation of HIF-1
protein (Fig. 7B).
![]() View larger version (24K): [in a new window] |
FIG. 7. Exogenous H2O2 does not stimulate HIF-1 transcription but stabilizes HIF-1 protein via PHD inhibition. (A) Hep3B cells were treated with 100 mM DFX and different doses of H2O2 for 60 min or various concentrations of glucose oxidase for 8 h. HIF-1 protein was detected by Western blotting, and a nonspecific band provided a loading control. RNA was extracted for quantitative RT-PCR analysis to measure HIF-1 and PGK-1 transcript levels. All data are presented as levels relative to untreated cells. (B) Hep3B cells were grown on coverslips and treated as indicated. Immunofluorescence analysis was performed with antibody recognizing human HIF-1 . DAPI containing mounting medium was used to stain for nuclei. (C) Vhl-null ES cells were treated with 100 mM DFX or 1 mM H2O2 for 90 min in the presence or absence of 100 µM ascorbate. GHO protein was assessed by Western blot analysis.
|
protein levels by affecting transcription, we investigated how H2O2 treatment inhibits PHD activity in vivo. It is possible that exogenous H2O2 inhibits PHD function in vivo by the same mechanisms shown in vitro: via Fe2+ oxidation. To test this hypothesis, we treated GHO-expressing Vhl-null ES cells (37) with 100 µM DFX or 1 mM H2O2 for 90 min in the presence or absence of 200 µM ascorbic acid. DFX is a specific chelator of Fe3+, and its inhibitory effect on PHD is probably due to deprivation of intracellular Fe pools. In the presence of ascorbate, all chelatable iron is in the reduced Fe2+ state. We therefore observed a reversal of the DFX-mediated inhibition of GHO prolyl hydroxylation in the presence of ascorbate (Fig. 7C, lanes 4 to 6). The addition of ascorbate also blocked the H2O2-mediated inhibition of GHO prolyl hydroxylation (Fig. 7C). The similar effect of ascorbate on DFX- and H2O2-mediated hydroxylase inhibition suggests that exogenous H2O2 inhibits HIF PHD by oxidizing cellular Fe2+. Taken together, these data suggest that exogenous ROS induced HIF-1
protein accumulation by decreasing its prolyl hydroxylation. |
|
|---|
ODDs is a critical step regulating HIF transcriptional activity in O2 replete cells. Monitoring these critical modifications enables us to evaluate factors affecting HIF-
protein stability. However, as stated in the introduction, widely used analyses of PHD activity are either inconvenient or not readily available. We therefore used a system based on a fusion protein containing the HIF-1
ODD domain, which we call GHO. When hydroxylated on the critical ODD proline residue (P564), GHO protein exhibits differential mobility upon standard SDS-PAGE. As such, this method provides the opportunity to observe both hydroxylated and unhydroxylated forms of the GHO protein by standard Western analysis. When used in in vitro hydroxylation reactions, GHO protein mobility changed exactly as predicted in response to known regulators of the PHDs. We also demonstrated that when stably expressed, the GHO protein is stabilized and degraded with kinetics identical to endogenous HIF-1
protein. These data suggest that the GHO fusion protein is a useful tool for studying factors regulating HIF-
prolyl hydroxylation both in vitro and in vivo.
-Ketoglutarate is required as a cosubstrate for the hydroxylation reaction, as demonstrated in our in vitro assay using bacterially purified PHD2. However, we were surprised to detect a mild but reproducible inhibition of GHO hydroxylation when
-ketoglutarate alone was added to the in vitro hydroxylation assays. It has been reported that without the peptide substrate, prolyl hydroxylases can undergo an uncoupled reaction to convert
-ketoglutarate to succinate (13). During this process, the Fe2+ is oxidized to Fe3+, rendering the enzyme inactive, an effect reversed by the addition of ascorbate to the reaction. Since the GHO peptide is the last component added to our in vitro assays and its availability can be limited in these reactions, this process could explain the inhibitory effect of high concentrations of
-ketoglutarate. A similar mechanism may operate in vivo as it has been reported that cellular PHD levels are in excess over available HIF-
subunits under normoxic conditions (1). Since the concentration of HIF-
molecules increases during hypoxia, overall intracellular hydroxylase activity may also increase because of fewer uncoupled reactions. This likely contributes to the rapid resumption (as little as less than 40 s) of HIF prolyl hydroxylation during hypoxia-reoxygenation events.
We found that when HEK 293T cell lysate was used as a source of PHD activity, in vitro reactions were extremely sensitive to addition of Fe2+. This suggests that factors altering intracellular Fe2+ levels may have profound effects on PHD activity in vivo. Since intracellular redox status is another factor that affects Fe2+ levels, it is conceivable that the redox status of cells modulates the activities of the PHDs. It is interesting that the expression of transferrin, important for iron uptake, is induced by HIF transcriptional activity (51). Therefore, in cells whose iron levels change as a result of HIF activity, iron concentration can potentially function as a feedback signal regulating HIF-
subunit expression.
Other TCA cycle intermediates such as fumarate and succinate have been reported to inhibit the PHDs (25, 54). These effects were confirmed in our in vitro hydroxylation assays. The inhibitory effects of these two compounds were reversed by adding
-ketoglutarate to the system, suggesting they compete for a common binding site within PHD enzymes. It has been proposed that succinate dehydrogenase and fumarase deficiency cause intracellular accumulation of succinate and fumarate, which leads to compromised PHD activity in vivo. However, in most tissues, most of the succinate and fumarate are produced and consumed in the mitochondria. It is unclear how much of these compounds actually accumulate in the cytoplasm. Because 0.1 to 1 mM concentrations are required for succinate and fumarate to inhibit PHD activity in vitro, it may be possible that additional cellular factors sensitize PHDs to modest cytosolic increases of succinate and fumarate.
Unlike succinate and fumarate, several other glucose metabolites such as pyruvate, lactate, oxaloacetate, and malate are abundant in the cytoplasm. Therefore, they have the potential to modulate HIF-
levels when glucose metabolism fluctuates, such as during hypoxia. Using our cell lysate-based in vitro hydroxylation assay we did not detect any inhibitory effect of pyruvate, lactate, and oxaloacetate on PHD activity. However, malate, another TCA cycle intermediate, inhibited in vitro GHO hydroxylation. Interestingly, this inhibition is
-ketoglutarate independent. Since additional Fe2+ and ascorbate reverse this inhibitory effect, we speculate that malate may promote uncoupled enzyme reactions to lock PHDs into the inactive Fe3+ binding state. Finally, although our in vitro data suggest these glucose metabolites directly affect PHD enzymes, we cannot rule out the possibility that they affect GHO hydroxylation by altering other factors such as substrate conformation.
It is interesting that a previous study using a cell-based assay also suggests that multiple glucose metabolites such as pyruvate and oxaloacetate can inhibit PHD enzymes. Such effects were reversed by reducing agents such as ascorbate, cysteine, or histidine (36). Fumarate was not inhibitory to the PHDs in this previous study. Our in vitro assay differs from this previous study regarding which particular metabolites have inhibitory effects. These differences may stem from distinct experimental protocols. For example, in a cell-based assay, unknown cellular factors might affect the sensitivities of PHDs to different inhibitory agents. In that previous study, data obtained from an in vitro pVHL binding assay required very high levels (up to 10 mM) of pyruvate and oxaloacetate compared to a cellular assay. It will be important in future studies to investigate how different factors affect PHD activity under various in vivo conditions.
Previous studies have indicated that functional mitochondria are required for hypoxic HIF-
stabilization (8, 11, 12, 18, 41). Our results directly demonstrate that when cells are treated with mitochondrial inhibitors, PHDs remain active under hypoxic conditions. Since inhibiting mitochondrial activity can theoretically lead to both increased O2 availability for the hydroxylation reaction (14, 19) and decreased ROS, it is difficult to conclude whether either or both consequences are responsible for inhibition of hypoxic HIF stabilization. We attempted to distinguish between these two mechanisms by using MitoQ, a mitochondrion-specific ROS scavenger. However, we determined that MitoQ inhibited both ROS production and respiration in our experimental system. It will be important in future studies to identify specific mitochondrial antioxidants that can clearly distinguish between ROS production and O2 consumption to fully address the question of the relative contributions by them to HIF-
hypoxic accumulation.
Regardless of whether mitochondrial ROS play a significant role in hypoxic HIF prolyl hydroxylase inactivation, there is little doubt that H2O2 can function on its own to stabilize the HIF-1
protein. Although some data suggest that H2O2 causes an increase in HIF-1
gene transcripts (47), we observed that exogenous H2O2 primarily increased HIF-1
protein by inhibiting PHD activity, therefore blocking HIF-1
degradation. Our examination failed to detect any increase of HIF-1
transcripts even after prolonged H2O2 exposure. Moreover, ascorbate, which reduces Fe3+ to Fe2+, can reverse the effect of added H2O2. This suggests that exogenous H2O2 induces HIF-1
protein accumulation in a manner similar to that of cells with elevated levels of endogenous ROS due to impaired scavenging ability (17).
In conclusion, by using a fusion protein that migrates differentially upon prolyl hydroxylation, we studied factors modulating PHD activity in vivo and in vitro. Mitochondria are the major organelles required for cellular Fe storage and usage, the TCA cycle, most O2 consumption, and ROS production. Our study demonstrates that a large number of these factors whose availability can be influenced by mitochondrial function and activity modulate intracellular PHD function. Considering the fact that HIF-mediated transcriptional activation is a critical regulator of cellular metabolism and mitochondrial activity (32, 48), our work delineates a complex interplay between mitochondrial function and cellular hypoxic responses.
This study was supported by the Howard Hughes Medical Institute, NIH grant CA104838, and the Abramson Family Cancer Research Institute. M.C.S. is an investigator of the Howard Hughes Medical Institute.
Published ahead of print on 13 November 2006. ![]()
Y.P. and K.D.M. contributed equally to this study. ![]()
Present address: Molecular Genetics and Microbiology, Duke University, Durham, NC 27710. ![]()
|
|
|---|
in normoxia. EMBO J. 22:4082-4090.[CrossRef][Medline]
. Blood 103:1124-1130.
. Mol. Cell. Biol. 25:6415-6426.
during hypoxia: a mechanism of O2 sensing. J. Biol. Chem. 275:25130-25138.
by pVHL. Nature 417:975-978.[CrossRef][Medline]
for hydroxylation by the prolyl hydroxylases PHD1, PHD2, and PHD3. J. Biol. Chem. 277:39792-39800.
targeted for VHL-mediated destruction by proline hydroxylation: implications for O2 sensing. Science 292:464-468.
to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292:468-472.
, HIF2
, and Ah receptor mRNAs in the developing mouse. Mech. Dev. 73:117-123.[CrossRef][Medline]
by modulation of the labile iron pool in differentiating U937 macrophages: effect of natural resistance-associated macrophage protein 1. Cancer Res. 66:2600-2607.
-pVHL complex: hydroxyproline recognition in signaling. Science 296:1886-1889.
by transcriptional and translational mechanisms. J. Biol. Chem. 277:48403-48409.
. FEBS Lett. 579:2669-2674.[CrossRef][Medline]
prolyl hydroxylase. Cancer Cell 7:77-85.[CrossRef][Medline]
binding to VHL is regulated by stimulus-sensitive proline hydroxylation. Proc. Natl. Acad. Sci. USA 98:9630-9635.This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»