Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2007, p. 1505-1515, Vol. 27, No. 4
0270-7306/07/$08.00+0 doi:10.1128/MCB.01158-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Department of Biochemistry and Biophysics, University of Pennsylvania School of Medicine, 813A Stellar-Chance, 422 Curie Blvd., Philadelphia, Pennsylvania 19104-6059
Received 27 June 2006/ Returned for modification 12 September 2006/ Accepted 17 November 2006
|
|
|---|
|
|
|---|
In the yeast Saccharomyces cerevisiae, trehalose levels vary depending on the environment of the cell. The levels are almost undetectable during normal exponential growth. After heat shock, trehalose levels increase rapidly and dramatically, along with the accumulation of heat shock proteins (HSPs) (26, 28). This rapid increase in trehalose has been attributed to the increase in both the translation of the genes involved in the synthesis of trehalose (TPS1 and TPS2) (4, 41, 58) and the substrates required for trehalose synthesis (1, 61). In addition, the enzymatic activity of TPS1 increases during the heat shock response (1, 38). High trehalose levels can stabilize enzymatic activity and can prevent the aggregation of exogenous proteins in vivo during heat shock (45, 46). Trehalose is degraded in the cytoplasm by neutral trehalase, encoded by the gene NTH1 (26, 31, 38, 40, 59). The transcription of NTH1 is stress responsive (62); however, the activity of Nth1 is greater during recovery from stress (39), allowing Nth1 to successfully compete with the biosynthetic pathway and reduce intracellular trehalose levels (28). This degradation of trehalose is critical for recovery from heat shock (59) as very high levels of trehalose can interfere with normal protein activity by stabilizing proteins in nonnative conformations and inhibiting the refolding of these denatured proteins by HSPs (12, 43, 44, 46, 56). Taken together, these data have led to a temporal model of trehalose function as a cochaperone during the heat shock response: trehalose functions to protect proteins at the initial stages of the heat shock response before HSPs have been fully induced, but trehalose must be degraded in order for the HSPs to fully assist the cell in recovery from heat shock (47).
In S. cerevisiae, the transcriptional response to heat shock is controlled by two sets of transcription factors, the heat shock transcription factor (Hsf1) and the partially redundant transcription factors Msn2 and Msn4 (Msn2/4). The Msn2/4 transcription factors, which are found only in yeast, bind to stress response elements found in the promoters of many heat shock genes (35). The activity of Msn2/4 is regulated by nuclear localization and phosphorylation (20, 29). Hsf1 is part of a family of conserved transcription factors critical to the heat shock response in all eukaryotes (57). All heat shock transcription factors (HSFs) share a conserved central core, consisting of a DNA-binding domain, a flexible linker, and a trimerization domain, which are essential for binding to heat shock elements (42). Stress response elements and heat shock elements are found in overlapping sets of promoters, allowing Msn2/4 and Hsf1 to provide distinct contributions to the heat shock response (2, 7).
The mechanism by which Hsf1's transcriptional activity is regulated in response to heat shock is not well understood. In yeast, Hsf1 is localized to the nucleus, with a low level of constitutive transcriptional activity that is necessary for normal cellular processes (50, 60). Following a mild stress, such as heat shock, Hsf1 becomes transcriptionally active and the expression of HSP mRNA dramatically increases. During a prolonged stress, Hsf1 activity gradually decreases to a new plateau, while removal of stress causes Hsf1 activity to return rapidly to near-constitutive levels. The dramatic changes in Hsf1 activity during heat shock involve several components, including hyperphosphorylation (24, 50) and conformational changes (9, 32). Hsf1 is also thought to be negatively regulated through interactions with several heat shock proteins, including Hsp82 and members of the Hsp70 family, under both constitutive and heat shock conditions (6, 10, 13, 23, 51). To date, no specific signal that positively regulates Hsf1 activity during a heat shock has been identified.
We have previously shown that high concentrations of trehalose can increase the structure of the S. cerevisiae Hsf1 C-terminal activation domain in vitro, and this structural change is enhanced by temperature (8). We hypothesized that the effects of trehalose and elevated temperature on Hsf1's structure in vitro were linked to its dramatic increase in transcriptional activity after heat shock. In this paper, we show that trehalose is required for the robust increase in transcription of heat shock protein genes by Hsf1 during the initial response to heat shock. In addition, a high trehalose level maintains Hsf1 in a highly active state, preventing the decrease in activity of Hsf1 that occurs during a sustained heat shock response. The enhanced transcriptional response does not require the other heat-responsive transcription factors Msn2/4 but is dependent upon heat and Hsf1. Despite the structural enhancement of the C-terminal activation domain (CAD) observed in vitro, the enhanced transcriptional response does not require the presence of the C-terminal activation domain, suggesting that any structural changes in vivo must be more global. In addition, the increase in transcriptional activity is correlated with an increase in Hsf1 phosphorylation. By showing that trehalose modifies the dynamic range of Hsf1's heat-induced transcriptional activity, we have identified a novel and physiologically relevant function of trehalose as a positive regulator of the transcriptional response to heat shock.
|
|
|---|
Yeast strains and media.
All yeast strains were derived from the S. cerevisiae W303-1A (MATa ade2-1 trp1-1 can1-100 leu2,3-112 his3-11,15 ura3-1) strains YHN963, YHN1172, and YHN1189, which have been described previously (17). The YHN963 strain contains both the msn2
and msn4
alleles. YHN1172 was derived from YHN963, in which native HSF1 is under a dual tetracycline repression system, allowing for strong repression of HSF1 transcription upon the addition of 20 µg/ml doxycycline. YHN1189, also derived from YHN963, contains a 13Myc tag at the 3' end of the gene encoding Hsf1 protein. Deletion of the C-terminal end of the Hsf1 protein was done as previously described (14). Briefly, a URA3-marked version of the hsf1(1-583) allele was used to replace the HSF1 allele from YHN963 to create YHN2018.
Gene knockouts of NTH1 or TPS1 in YHN963, YHN1172, YHN1189, and YHN2018 were performed using drug-resistant-gene disruption cassettes, as previously described (19, 22). Briefly, primers were used to amplify the hphMX4 cassette from the plasmid pAG32. For the nth1
strains, primers LC9 (ATAAACAAAAAAAGAAAAATTAACAAAAAAAATCAGTAGAGCATAGGCCACTAGTGG ATCTG) and LC10 (TACCTGGAGTATATATATATATATATATATATTATCTCAACAGCTGAAGCTTCGTACGC) were used. For the tps1
strains, primers LC1 (AACTAGGTACTCACATACAGACTTATTAAGACATAGAACTGCATAGGCCACTAGTGGATCTG) and LC2 (GGACCAGGAATAGACGATCGTCTCATTTGCATCGGGTTCACAGCTGAAGCTTCGTACGC) were used. The various yeast strains were then transformed with the amplified cassettes, and proper integration of the reporter was verified by PCR. The deletion strains were then transformed with the appropriate plasmids, either empty vectors or vectors that overexpressed NTH1 and TPS1, in order to create the set of strains used for experiments (Table 1).
|
View this table: [in a new window] |
TABLE 1. Strains used in this study
|
strains cannot grow with glucose as a carbon source (4, 54, 58), all strains were grown in synthetic complete media with 2% galactose as a carbon source. Amino acids were supplemented as necessary. Aminoglycosides were used as necessary at concentrations of 200 µg/ml Geneticin G418 (Invitrogen), 200 µg/ml hygromycin B (Roche), and 100 µg/ml CloNAT (Warner). Cells were grown at 30°C to mid-logarithmic phase (optical density at 600 nm of 0.3 to 0.5). Cells were then aliquoted into prewarmed flasks at 40°C for the times indicated in the figures. For experiments concerning recovery from heat shock, the flasks of cells that were allowed to recover from heat shock were transferred to a 30°C water bath for the indicated times. To test for viability, heat-shocked and recovering cells were serially diluted into sterile water, spotted onto agar plates, and grown at 30°C for 2 days. Determination of trehalose levels. Trehalose was isolated from yeast cells as previously described (62). Briefly, yeast cells were subjected to heat as described above and were harvested by pelleting. Cells were washed twice in ice-cold water, the cell pellets were resuspended in a volume of ice-cold water equal to the measured wet weight, and a small aliquot was taken for determining cell counts. The remaining cells were placed in a boiling water bath for 20 min. Cells were then spun down at maximum speed in a tabletop microcentrifuge, and 3 µl of the supernatant was applied to a Silica Gel 60 plate (Merck). Standard dilutions of trehalose (Sigma) were also applied to the plate. Thin-layer chromatography (TLC) was performed by using a solution of 5:3:2 butanol-ethanol-water. The trehalose was visualized by spraying the plate with a 20% H2SO4 solution, followed by charring treatment in a 95°C oven. The trehalose was then quantitated using spot densitometry on the Fluorchem 8800 cooled-charge-coupled-device (CCD) detection system (Alpha Innotech). All graphical representations of trehalose levels represent data averaged from at least three independent experiments.
RNA preparation and Northern blot analysis. Total RNA isolation and Northern blot analysis were performed as previously described (17). Briefly, total RNA was isolated from yeast by using the hot acidic phenol method. RNA samples were quantified, and 10 µg of total RNA was run on a 1% agarose denaturing gel containing 18% formaldehyde. The RNA was transferred onto ZetaProbe nylon membranes (Bio-Rad) by capillary action and UV cross-linked. The membranes were probed with biotin-labeled DNA probes generated by the incorporation of the biotin-16-dUTP nucleotide (Pierce) into PCR products from plasmids containing the ORFs HSP12, HSP26, HSP82, HSP104, SSA4, and SSA3. The membranes were then developed using the North2South chemiluminescent detection kit (Pierce), and the signal was quantitated using a Fluorchem 8800 cooled-CCD detection system (Alpha Innotech). All Northern blot analyses were repeated at least three times, with representative gels shown in the figures. Graphical representations of HSP mRNA levels represent data averaged from at least three independent experiments.
Phosphorylation analysis. Cells containing Myc-tagged HSF1 were collected by centrifugation after the indicated length of heat shock, frozen in liquid N2, and stored at 70°C until further use. Cell pellets were resuspended in 2x LDS buffer (Invitrogen) containing yeast-specific protease inhibitor cocktail and serine/threonine phosphate inhibitor cocktail, with a final concentration of cells at an optical density at 600 nm of 7.5 units per 100 µl of buffer. Cells were heated at 100°C for 5 min and then placed into an ice bath for 5 min. Approximately 80 µl of glass beads was added, and the samples were vortexed for 10 min at 4°C. Samples were clarified by centrifugation, supernatants were transferred into fresh tubes, and the pellets were treated to a second round of lysis. Proteins were resuspended in 2x LDS buffer (Invitrogen) and were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and blotted onto an Immobilon P polyvinylidene difluoride membrane (Millipore). Hsf1 was detected by Western blotting using anti-Myc(9B11) (Cell Signaling) and horseradish peroxidase-conjugated anti-mouse immunoglobulin G (Amersham). Membranes were developed using Immobilon Western chemiluminescent horseradish peroxidase substrate (Millipore). The signal was quantitated by using a Fluorchem 8800 cooled-CCD detection system (Alpha Innotech). All Western blot analyses were repeated at least three times with independent samples; for representative gels, see Fig. 8.
![]() View larger version (47K): [in a new window] |
FIG. 8. Changes in Hsf1 phosphorylation correlate with changes in trehalose-dependent transcriptional activity. Western blot analysis (A, C, E, G, and H) or immunoprecipitation-Western blot analysis (B, D, F, and I) was performed on the control strain (labeled C; YHN2020) or LT (YHN2058), HT (YHN2023), and VHT (YHN2022) strains carrying Myc-tagged HSF1. Cells were heat shocked and allowed to recover for the indicated times. Calf intestinal alkaline phosphatase (CIP) treatment (B, D, F, and I) confirmed that the shift in mobility of the Myc-HSF1 gene product was due to phosphorylation. +, present; , absent.
|
|
|
|---|
strain which has previously been shown to have a robust stress response (2, 14). In addition, we chose a 40°C heat shock because Hsf1 is more highly activated than Msn2/4 at that temperature (41, 49, 50). After analyzing a number of strains, we chose three strains for further study based on their significant differences in intracellular trehalose concentrations under constitutive and heat shock conditions (Table 1). These strains included a tps1
strain and two nth1 knockout strains, one containing only the nth1
allele and the other containing the nth1
allele and vectors overexpressing TPS1 and NTH1 from the heterologous ADH1 promoter (e.g., nth1
PADH1-TPS1 PADH1-NTH1).
The tps1
strain had significantly lower levels of trehalose than the control strain at all time points prior to and during the heat shock (Fig. 1A). In the control strain, trehalose levels increased after 10 min of heat shock and continued to increase during the heat shock. In contrast, the trehalose levels in the tps1
strain did not increase significantly and never even reached the constitutive level of trehalose found in the control strain. The lower trehalose levels in the tps1
strain were not due to increased cell death during heat shock, as no change in cell viability was observed until after 40 min of heat shock (data not shown). Therefore, this strain will be referred to hereinafter as the low-trehalose (LT) strain.
![]() View larger version (24K): [in a new window] |
FIG. 1. Changes in trehalose levels during the heat shock response. Relative trehalose levels, determined by thin-layer chromatography and normalized to cell counts, are shown over the course of a 40°C heat shock for the control (YHN450), LT (YHN455), HT (YHN437), and VHT (YHN454) strains. (A) The LT strain (gray bars), which harbors a TPS1 deletion, has decreased levels of trehalose compared to the control strain (black bars). (B) The HT (gray bars) and VHT (white bars) strains, which harbor NTH1 deletions (nth1 PADH1-TPS1 PADH1-NTH1 and nth1 , respectively), have increased levels of trehalose compared to the control strain (black bars). Error bars show standard errors of the mean (SEM). *, P < 0.05; **, P < 0.01.
|
and nth1
PADH1-TPS1 PADH1-NTH1strains until after 40 min of heat shock. At these later heat shock times, the nth1
strain had approximately three to four times the trehalose levels of the control strain, while the nth1
PADH1-TPS1 PADH1-NTH1 strain had approximately two to three times as much trehalose as the control strain. The high levels of trehalose did not appear to affect cell growth and viability (data not shown). The nth1
and nth1
PADH1-TPS1 PADH1-NTH1 strains will be referred to hereinafter as the very-high-trehalose (VHT) and high-trehalose (HT) strains, respectively. To summarize, we have been able to manipulate yeast to synthesize different trehalose levels under both constitutive and heat shock conditions.
Low trehalose levels correspond to reduced HSP mRNA levels.
Trehalose levels increase during a normal heat shock, along with HSP mRNA and protein levels (21, 26). To determine if trehalose is necessary for HSP gene transcription, we measured HSP mRNA levels in our LT and control strains throughout the heat shock response (Fig. 2). The msn2/4
control strain had a typical response to a 40°C heat shock, with low HSP mRNA levels prior to heat shock, a peak level reached after 5 to 20 min, and then a gradual decrease to a new plateau level. The LT strain had a more diminished response. Prior to heat shock, the LT strain had low HSP mRNA levels, similar to the control strain. During the first 5 to 10 min of the heat shock response, the HSP mRNA levels rose slightly in the LT strain but significantly less than in the control strain. As the heat shock progressed, the LT strain continued to have significantly lower levels of HSP mRNAs. Depending on the HSP gene, maximal levels in the LT strain occurred 5 to 10 min earlier and were 1.5- to 6-fold lower than the levels reached in the control strain. In addition, the plateaus were 1.4- to 6.75-fold lower than those in the control strain. Thus, trehalose is critical for the heat-induced expression of HSP mRNAs.
![]() View larger version (37K): [in a new window] |
FIG. 2. Reduced HSP mRNA levels are correlated with decreased trehalose levels. (A) Northern blot analysis showing HSP mRNA levels over the course of a 40°C heat shock for the LT (YHN455) and control (YHN450) strains. (B) Graphical representation of HSP26 mRNA levels, normalized to ACT1, shows that the LT strain (gray squares) has lower heat-induced transcript levels than the control strain (black circles). Error bars show SEM. *, P < 0.05; **, P < 0.01.
|
![]() View larger version (24K): [in a new window] |
FIG. 3. Elevated HSP mRNA levels are correlated with increased trehalose levels. (A) Northern blot analysis showing HSP mRNA levels over the course of a 40°C heat shock for the HT (YHN437), VHT (YHN454), and control (YHN450) strains. (B) Graphical representation of HSP26 mRNA levels, normalized to ACT1, shows that the HT (gray squares) and VHT (white squares) strains have higher heat-induced transcript levels than the control strain (black circles). Error bars show SEM. *, P < 0.05; **, P < 0.01.
|
![]() View larger version (30K): [in a new window] |
FIG. 4. The nth1 knockout strains behave differently during prolonged exposure to heat stress. The HT (YHN437), VHT (YHN454), and control (YHN450) strains were subjected to heat shocks of up to 2.5 h. (A) Trehalose levels of both the HT (gray bars) and VHT (white bars) strains are significantly increased over that of the control strain (black bars) at every time point. (B) Northern blot showing the levels of several HSP mRNAs during a prolonged heat shock. (C) Graphical representation of Northern blot of HSP26 mRNA normalized to ACT1 reveals strain differences between the HT (gray squares), VHT (white squares), and control (black circles) strains. Error bars show SEM. *, P < 0.05; **, P < 0.01.
|
Trehalose and heat are required for elevated HSP mRNA levels. Increased trehalose levels enhance the sustained response to heat shock; however, increased levels of trehalose prior to heat treatment have no effect on the constitutive levels of HSP mRNAs (Fig. 3). Recovery from heat stress is normally associated with a reduction in both HSP mRNA and trehalose levels (21), but trehalose levels in the HT strain remained high during recovery (Fig. 5A). To determine if high levels of trehalose alone are sufficient to maintain elevated HSP mRNA levels in the absence of heat, the control and HT strains were exposed to a 1-h heat shock, followed by recovery at a constitutive temperature (30°C) for up to 1.5 h. In both strains, the HSP mRNA levels decreased, beginning at the first recovery time point (Fig. 5B and C). Despite the increased levels of trehalose in the HT strain, the extents of reduction in HSP mRNA levels were similar in both strains, suggesting that continuous exposure to heat is critical for the trehalose-dependent effect on transcription. These results confirm that both heat and trehalose are required for the elevated levels of HSP mRNA.
![]() View larger version (29K): [in a new window] |
FIG. 5. Increased trehalose levels are unable to prevent recovery from heat stress. After a 60-min heat shock (HS) at 40°C, the HT (YHN437) and control (YHN450) strains were allowed to recover for up to 90 min at a constitutive temperature (30°C). (A) Trehalose levels remain high during recovery in the HT strain (gray bars), while trehalose levels decrease in the control strain (black bars). (B) Northern blot analysis showing HSP mRNA levels upon recovery from heat shock. (C) Graphical representation of HSP26 mRNA levels, normalized to ACT1, shows that the HT (gray squares) and control (black circles) strains have similar decreases in HSP mRNA levels. Error bars show SEM. *, P < 0.05; **, P < 0.01.
|
, we wanted to confirm that the elevated HSP mRNA levels in the nth1 knockout strains require Hsf1. Because HSF1 is an essential gene, we used a tetracycline-regulated dual-expression system to repress HSF1 transcription (5, 17). In this system, the addition of doxycycline results in a loss of HSF1 mRNA (16) but has no effect on the trehalose levels (data not shown). After a 60-min heat shock, the doxycycline-treated control and HT strains showed little or no heat-induced increase in HSP mRNA levels (Fig. 6). In fact, there was no detectable difference in HSP mRNA levels between the control and HT strains. The same held true for the VHT strain (data not shown). These results confirm that the elevated HSP mRNA levels in response to high trehalose levels require the transcriptional activator Hsf1, suggesting that trehalose affects Hsf1's transcriptional activity.
![]() View larger version (19K): [in a new window] |
FIG. 6. HSF1 is required for the trehalose-dependent increase in HSP mRNA levels during heat shock. Strains containing a tetracycline-repressible HSF1 allele were grown for 16 h in medium containing doxycycline, followed by heat shock for 60 min at 40°C. (A) Northern blot analysis showing HSP mRNA levels for the HT (YHN459) and control (YHN456) strains with the conditional tetracycline-repressible Hsf1 allele. (B) Graphical representation of HSP26 mRNA levels, normalized to ACT1, shows that the HT and control strains had a loss in heat-induced expression upon depletion of HSF1. Error bars show SEM. **, P < 0.01; +, present; , absent.
|
CAD strain with high trehalose levels had enhanced HSP mRNA levels compared to the HSF
CAD control strain (Fig. 7), similar to what was seen with the HT and control strains containing the wild-type HSF1 allele (Fig. 3). This enhanced transcription occurred even for those HSP genes, such as HSP26 and HSP82, which are dependent primarily on the CAD for maximal heat shock induction (14). These results suggest that the mechanism by which trehalose increases activity is not specific to the C-terminal activation domain.
![]() View larger version (45K): [in a new window] |
FIG. 7. The C-terminal activation domain is not required for a trehalose-dependent increase in HSP mRNA levels during heat shock. (A) Northern blot analysis showing HSP mRNA levels over the course of a 40°C heat shock for the HSF CAD HT (YHN2066) and HSF CAD control (YHN2063) strains containing an hsf1 (1-583) allele. (B) Graphical representation of HSP26 mRNA levels, normalized to ACT1, shows that the HSF CAD HT strain (gray squares) has higher heat-induced transcript levels than the HSF CAD control strain (black circles). Error bars show SEM. *, P < 0.05.
|
We used Western blot analysis to determine the phosphorylation status of Myc-tagged Hsf1 in the control, LT, HT, and VHT strains (Fig. 8). In all strains, Hsf1 had the same electrophoretic mobility prior to heat shock (compare lanes 1 and 2 in Fig. 8A, C, and E,), showing that constitutive Hsf1 phosphorylation levels were the same in all strains despite differences in intracellular trehalose levels. However, the electrophoretic mobility of heat-induced Hsf1 differed quantitatively and temporally in response to heat shock, depending on the strain and its levels of trehalose. Hsf1 from the LT strain had lower levels of hyperphosphorylation than that from the control strain, and differences were evident after 5 min of heat shock (Fig. 8A), the same time at which the HSP mRNA levels in these strains differed. The HT and VHT strains showed even greater differences from the control strain in their levels of Hsf1 hyperphosphorylation (Fig. 8C and E). The enhanced mobility of Hsf1 from the HT and VHT strains was observed after 40 min of heat shock, the same time at which significant differences in HSP mRNA levels were observed (Fig. 3). Hsf1 from the VHT strain had a level of mobility between those of Hsf1 proteins from the control and HT strains (Fig. 8G). The changes in the mobility of Hsf1 in all strains were no longer observed when the lysates were treated with phosphatase (Fig. 8B, D, and F), confirming that the mobility differences were due to differences in phosphorylation. Correlation between Hsf1 modification and activity was also verified during recovery from heat shock, as both Hsf1 transcriptional activity and phosphorylation decreased during this time (Fig. 5 and 8H). Taken together, these data indicate that the trehalose-dependent changes in HSP mRNA levels correlate temporally with changes in Hsf1 phosphorylation during the heat shock response, confirming that trehalose levels influence heat-induced Hsf1 activity.
|
|
|---|
Trehalose is required for the heat-induced increase of HSP mRNAs in the absence of Msn2/4 (Fig. 2). At very low levels of trehalose, HSP mRNA levels increased only nominally within the first 5 min of heat shock and then decreased or reached a plateau. Our results are in general agreement with previous studies of HSP levels in tps1
strains with wild-type MSN2/4 alleles. HSP26, HSP104, and SSA4 mRNA levels reached in the tps1
MSN2/4 strain were two- to eightfold lower than those reached in the parent MSN2/4 strain after a 1-h, 39°C heat shock (25), similar to what was seen at the 40-min time point for msn2/4
strains (Fig. 2). However, a milder 35°C heat shock produced different results, with no difference in Hsp104 or Hsp26 protein levels between the tps1
MSN2/4 strain and the parent MSN2/4 strain (46). We suspect that Msn2/4 was a major contributor to HSP104 and HSP26 expression in this experiment, as Msn2/4 is more highly activated than Hsf1 at a lower heat shock temperature (41, 49, 50).
The role of trehalose in enhancing HSP gene transcription is dependent on the continued presence of heat. At constitutive temperatures, the nth1 knockout strains have significantly increased levels of trehalose compared to the control strain, but the strains all have the same constitutive levels of HSP mRNA (Fig. 3). During recovery from heat shock, HSP mRNA levels in the HT strain decreased despite the retention of high trehalose levels (Fig. 5), showing that trehalose alone is not sufficient to maintain an elevated level of HSP expression. If trehalose merely prevented the degradation of HSP mRNA during heat shock, the mRNA levels would not have decreased during recovery while high trehalose levels were maintained. Instead, trehalose increases the normal transcriptional response to heat shock.
The trehalose-dependent increase in HSP gene transcription is mediated through Hsf1. When cells are depleted of Hsf1, the heat-induced HSP mRNA levels are suppressed to the same extent in both the control and HT strains, despite the continued high levels of trehalose in the HT strain (Fig. 6). In support of Hsf1's dependence on trehalose, the phosphorylation of Hsf1 correlates with the trehalose-dependent changes in HSP mRNA levels (Fig. 8). However, this dependence is complex, with trehalose requirements varying throughout the heat shock response. A minimum level of trehalose is required for the initial response to heat shock, as the LT strain has a severely reduced level of heat-induced Hsf1 activity (Fig. 2). The control, HT, and VHT strains all have similar HSP profiles for the first 15 to 20 min, confirming that trehalose levels above a certain threshold are required for the initial response of Hsf1 to heat shock (Fig. 3). During a prolonged heat shock, a higher threshold of trehalose is necessary to maintain and even amplify Hsf1's activity, but even this level is tightly controlled, as the VHT strain does not have as much Hsf1 activity as the HT strain (Fig. 4). Previous studies have shown that excess trehalose can interfere with protein activity by stabilizing proteins in nonnative conformations and may interfere with HSP function on unfolded proteins (46). The trehalose-dependent increase in HSP gene transcription may be diminished when trehalose levels become so high that they interfere with the specific transcriptional process, perhaps by inhibiting the ability of Hsf1 to be hyperphosphorylated. It is unlikely that very high trehalose levels generally inhibit transcription, as ACT1 mRNA and rRNA levels are not affected and total RNA levels per cell volume are the same regardless of trehalose levels (data not shown). Thus, the levels of trehalose serve to modify the dynamic range of Hsf1 activity in specific ways: trehalose is required for maximal Hsf1 activity at the initiation of heat shock, while a higher, yet limited, threshold of trehalose is required for sustained transcriptional activity.
Given that trehalose is known to modify protein structure and activity in vivo, there are three likely models for the mechanism of its action on Hsf1 during heat shock. First, trehalose might act directly on Hsf1 by promoting and maintaining the structure of Hsf1 activation domains in a highly active state and thus increasing HSP mRNA transcription during heat shock. In support of this idea, we have shown that trehalose changes the conformation of the C-terminal activation domain in vitro, with increases in both the secondary and tertiary structures (8). However, the trehalose-dependent increase in Hsf1 activity does not depend on the presence of this domain (Fig. 7). In a strain lacking the C-terminal activation domain, all HSP mRNAs are enhanced with high trehalose (Fig. 7), regardless of whether the heat-induced expression of the HSP is dependent primarily on either the N- or the C-terminal activation domain (14). Therefore, if trehalose influences Hsf1 structure in vivo, it likely affects the global structure. Any trehalose-induced conformational change might be responsible for the increased phosphorylation of Hsf1, as trehalose could maintain Hsf1 in a structurally accessible state for a kinase or a structurally inaccessible state for a phosphatase. Second, trehalose could act more indirectly on Hsf1 by stabilizing a kinase or destabilizing a phosphatase, altering their activities during a sustained heat shock response. Hsf1 would therefore be maintained in a hyperphosphorylated, and presumably more transcriptionally active, state. In support of this mechanism, trehalose is known to stabilize enzymatic activity at high temperatures (27, 30, 63) and has been correlated with PKC1 activity (36). Finally, the known role of trehalose as a chemical cochaperone may affect Hsf1 activity by interfering with the feedback regulation of Hsf1 by HSPs. The high levels of trehalose, which are known to prevent refolding of proteins by HSPs, could maintain the high levels of misfolded proteins necessary to continue the stimulation of the heat shock response (47). By functioning as a positive regulator of Hsf1, trehalose may effectively balance the levels between trehalose and HSPs during the heat shock response. Alternatively, trehalose might protect Hsf1 from specific HSPs that function as negative regulators during the heat shock response and prevent the deactivation of Hsf1 (10, 13, 23, 51). We are currently investigating all of these possibilities to determine how trehalose promotes Hsf1 activity and enhances the expression of HSPs during the heat shock response.
We thank Amanda Bulman and Scott Ferguson for the critical initial discussions about this project and Sara Achenbach and Dawn Eastmond for continued discussions about this project.
Published ahead of print on 4 December 2006. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»