This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Douglas, P.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Douglas, P.
Right arrow Articles by Meek, K.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, March 2007, p. 1581-1591, Vol. 27, No. 5
0270-7306/07/$08.00+0     doi:10.1128/MCB.01962-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The DNA-Dependent Protein Kinase Catalytic Subunit Is Phosphorylated In Vivo on Threonine 3950, a Highly Conserved Amino Acid in the Protein Kinase Domain{triangledown} ,{dagger}

Pauline Douglas,1 Xiaoping Cui,2 Wesley D. Block,1 Yaping Yu,1 Shikha Gupta,2 Qi Ding,2 Ruiqiong Ye,1 Nick Morrice,3 Susan P. Lees-Miller,1* and Katheryn Meek2

Departments of Biochemistry and Molecular Biology and Oncology, University of Calgary, Calgary, Alberta, Canada T2N 4N1,1 College of Veterinary Medicine and Department of Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, Michigan 48824,2 MRC Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, Scotland, United Kingdom3

Received 18 October 2006/ Returned for modification 14 November 2006/ Accepted 1 December 2006


arrow
ABSTRACT
 
The protein kinase activity of the DNA-dependent protein kinase (DNA-PK) is required for the repair of DNA double-strand breaks (DSBs) via the process of nonhomologous end joining (NHEJ). However, to date, the only target shown to be functionally relevant for the enzymatic role of DNA-PK in NHEJ is the large catalytic subunit DNA-PKcs itself. In vitro, autophosphorylation of DNA-PKcs induces kinase inactivation and dissociation of DNA-PKcs from the DNA end-binding component Ku70/Ku80. Phosphorylation within the two previously identified clusters of phosphorylation sites does not mediate inactivation of the assembled complex and only partially regulates kinase disassembly, suggesting that additional autophosphorylation sites may be important for DNA-PK function. Here, we show that DNA-PKcs contains a highly conserved amino acid (threonine 3950) in a region similar to the activation loop or t-loop found in the protein kinase domain of members of the typical eukaryotic protein kinase family. We demonstrate that threonine 3950 is an in vitro autophosphorylation site and that this residue, as well as other previously identified sites in the ABCDE cluster, is phosphorylated in vivo in irradiated cells. Moreover, we show that mutation of threonine 3950 to the phosphomimic aspartic acid abrogates V(D)J recombination and leads to radiation sensitivity. Together, these data suggest that threonine 3950 is a functionally important, DNA damage-inducible phosphorylation site and that phosphorylation of this site regulates the activity of DNA-PKcs.


arrow
INTRODUCTION
 
In response to DNA double-strand breaks (DSBs), the DNA-dependent protein kinase (DNA-PK) initiates the process of nonhomologous DNA end joining (NHEJ) by recognizing and then binding to DNA ends (21, 25). Our early work demonstrated that when bound to DNA ends, purified DNA-PK undergoes autophosphorylation on all three component polypeptides, the Ku70/80 heterodimer and the large catalytic subunit, DNA-PKcs (6). In vitro, autophosphorylation results in loss of protein kinase activity and disassembly of the kinase complex (6). From these data, we proposed that kinase inactivation and disassembly might be just as important for completing DNA repair as the function of DNA-PK in initiating repair (21, 25).

Recently, significant effort from several laboratories, including our own, has focused on defining and characterizing autophosphorylation sites within DNA-PKcs (5, 8, 11, 14, 30, 33). We have previously identified two major clusters of in vitro autophosphorylation sites in DNA-PKcs. The ABCDE cluster contains phosphorylation sites at serines 2612 and 2624 and threonines 2609, 2620, 2638, and 2647 (14), and the PQR cluster contains phosphorylation sites at serines 2023, 2029, 2041, 2053, and 2056 (8). Threonines 2609, 2638, and 2647 in the ABCDE cluster and serine 2056 in the PQR cluster are phosphorylated in vivo in response to DNA damage (5, 7, 40). Phosphorylation at the ABCDE and PQR sites appears to reciprocally regulate both DNA end processing and DNA repair pathway choice (8). However, although phosphorylation at the ABCDE cluster has a modest effect on dissociation of the DNA-PK complex in vitro (11, 30), autophosphorylation within the two major clusters does not mediate kinase inactivation (8, 11, 30). This suggests that additional autophosphorylation sites might regulate DNA-PK activity and/or be functionally important.

In vitro DNA-PK phosphorylates many substrates on serines or threonines that are followed by glutamine, so-called SQ/TQ motifs (22) (reviewed in reference 21). Analysis of the cDNA sequence of DNA-PKcs from various species reveals a number of highly conserved SQ/TQ motifs, including one, threonine 3950 (T3950) in the human sequence (accession numbers NP_008835 and P78527), that is conserved from humans to the slime mold Dictyostelium discoideum (2) (Fig. 1). Interestingly, T3950 is located in the protein kinase domain of DNA-PKcs, suggesting that phosphorylation of this site could be important for regulating the protein kinase activity of DNA-PKcs.


Figure 1
View larger version (62K):
[in this window]
[in a new window]

 
FIG. 1. DNA-PKcs activation segment sequences. A. Diagrammatic representation of DNA-PKcs. Functionally critical motifs include a leucine-rich region (LRR), the caspase cleavage site, the ABCDE autophosphorylation site cluster (six sites) (11), the PQR autophosphorylation site cluster (five sites) (8), autophosphorylation site S3205 (M), putative activation loop autophosphorylation site threonine 3950 (T), the PI3K homology domain (PI3K), and FAT and FATC domains. B. The p110{gamma} structural assignment was from the crystal structure (37), while the DNA-PKcs secondary structure prediction was performed using the Jpred program (http://www.compbio.Dundee.ac.uk/~www-jpred/). E denotes an extended ß-sheet-like secondary structure. H denotes helical secondary structure. The conserved DXXXXN and DXG motifs as well as threonine 3950 (human DNA-PKcs) are shown in boldface. Various databases were searched using the displayed region of human DNA-PKcs as described previously (2).

All eukaryotic serine/threonine protein kinases for which a structure has been solved contain a highly conserved region within the protein kinase domain that begins at the conserved aspartic acid of the metal ion-binding site (DFG in most protein kinases) and ends at a conserved tripeptide motif, APE. This conserved region is called the activation loop or t-loop (reviewed in reference 28). The enzymatic activity of many protein kinases is regulated by phosphorylation of amino acid sequences within the activation loop. In the "typical" eukaryotic protein kinases (24), phosphorylation of the activation segment promotes an interaction between the t-loop and a nearby basic pocket that results in repositioning of the t-loop, thereby promoting (or in some cases inhibiting) binding of the substrate and/or phosphoryl transfer. A variety of protein kinases can phosphorylate their own activation loops as a means of regulating kinase activity, whereas others require the activity of a second kinase for activation loop phosphorylation (reviewed in reference 28).

DNA-PKcs, along with ATM, ATR, and mTOR, is a member of a subgroup of the "atypical" eukaryotic protein kinase family, called the phosphatidylinositol 3-kinase-like protein kinases (PIKKs) (24). Although the PIKKs are serine/threonine protein kinases, their active sites bear significant amino acid similarity to the catalytic subunit of phosphoinositide 3-kinase, PI3K. The class I PI3Ks are composed of a catalytic subunit, p110, and a regulatory subunit, either p85 or p101. Although PI3K is a lipid kinase (i.e., it phosphorylates phosphatidylinositides), all members of the class I family of PI3Ks have serine/threonine protein kinase activity and undergo autophosphorylation on serine residues in vitro (9, 10, 36). Interestingly, autophosphorylation of PI3K results in loss of lipid kinase activity as well as loss of protein kinase activity, and thus, in this respect, PI3K is similar to DNA-PKcs (10, 36). In the case of the PI3K catalytic subunit, autophosphorylation occurs at C-terminal serines that are outside of the catalytic domain (9, 36). The autophosphorylation sites in DNA-PKcs that are responsible for loss of protein kinase activity are not known.

By comparing the amino acid sequence of DNA-PKcs with that of the p110 subunit of PI3K, we observed that a highly conserved potential phosphorylation site, T3950, lies downstream of the DXXXXN and DXG motifs that are conserved in the kinase domain of the p110 subunit of PI3K and most eukaryotic protein kinases (Fig. 1B). This prompted us to ask whether this site could be important for regulation of the protein kinase activity of DNA-PK. Here, we show that T3950 is an in vitro autophosphorylation site and that T3950 as well as multiple sites within the previously identified ABCDE cluster is phosphorylated in vivo in response to ionizing radiation (IR). Moreover, we show that replacement of T3950 with aspartic acid abrogates V(D)J recombination and results in radiation sensitivity. Our data suggest that T3950 plays an important role in the function of DNA-PK.


arrow
MATERIALS AND METHODS
 
Oligonucleotides. For simplicity, threonine 3950 mutants have been termed T>ala or T>asp mutants (for t-loop). Oligonucleotides and their complements (not shown) used to introduce threonine 3950 substitutions into the complete human DNA-PKcs cDNA are as follows: T>ala, 5'-GACTTTGGGCACGCGTTTGGATCCGCTGCACAGTTTCTGC; T>asp, 5'-GACTTTGGGCACGCGTTTGGATCCGCTGATCAGTTTCTGC. Oligonucleotides utilized to generate the {Delta}N mutant are {Delta}N top (GGCCGCATGGTTCCTGAGGTGTATAC) and {Delta}N bottom (CGTACCAAGGACTCCACAT).

Construction and transfection of expression plasmids. Construction of the wild-type human DNA-PKcs expression vector (32) and expression vectors encoding mutant ABCDE>ala, mutant PQR>ala, and the combined ABCDE+PQR>ala mutant (for brevity termed AP>ala) has been described previously (8, 11). The expression plasmids encoding the T>ala and T>asp phosphorylation site mutants were generated by overlap extension using PCR as described previously for generating an ATP binding site DNA-PKcs mutant (19). To construct the combined mutant ABCDE+PQR+T (for brevity termed APT>ala), a fragment spanning nucleotides 11145 to 12384 from the T>ala expression plasmid (unique Eco721 site and Xma site in the cloning cassette) was subcloned into the ABCDE+PQR>ala expression plasmids.

To construct the {Delta}N expression construct, 1,289 nucleotides from the 5' end of the DNA-PKcs cDNA were deleted via digestion with SnaI (unique site at position 1289, just prior to the start of exon 13) and NotI (cloning cassette) and replaced with annealed oligonucleotides {Delta}N top and {Delta}N bottom. These oligonucleotides introduce a methionine just N-terminal to the valine and proline residues encoded at the start of exon 13. Thus, the {Delta}N construct encodes human DNA-PKcs with a 426-amino-acid, N-terminal deletion.

Generation of a threonine 3950 phosphospecific antibody. A phosphospecific antibody recognizing DNA-PKcs phosphorylated on T3950 was raised in rabbits against the peptide FGSA(pT)QFLPVK. The residue in parentheses corresponds to the phosphorylated threonine. The peptide was conjugated to bovine serum albumin and keyhole limpet hemocyanin, and phosphospecific antibodies were raised and purified as described previously (14).

Cell lines, survival assays, and V(D)J recombination assays. Culture conditions for the human lymphoblastoid cell line BT (also called C3ABR) have been described previously (12). Derivation of V3 DNA-PKcs transfectants, culturing of V3 cells, immunoblot screening, clonogenic survival assays, and extrachromosomal V(D)J recombination assays were performed as described previously (11).

DNA-PK microfractionation, measurement of protein kinase activity, and autophosphorylation assays. DNA-PK microfractionation and assessment of enzymatic activity in V3 cell extracts by "pull-down" assays have been described previously (11). To assess in vivo phosphorylation of T3950, a human lymphoblastoid cell line (BT) was incubated for 2 h in medium containing okadaic acid (OA; 1 µM), camptothecin (10 µM), or etoposide (10 µM) or exposed to IR (10 Gy) and harvested after 2 h of recovery. Whole-cell extracts were enriched for DNA-PK using single-stranded DNA (ssDNA) cellulose resin as described previously (14) and then immunoblotted with either a polyclonal antibody to DNA-PKcs or the DNA-PKcs T3950 phosphospecific antibody.

Purification of recombinant human DNA-PKcs from V3 cells. Recombinant human DNA-PKcs was purified from 6 to 12 liters of V3 cells expressing ABCDE>ala, AP>ala, or APT>ala mutant DNA-PKcs as described in reference 3, except that the DNA-PKcs-containing fractions from the DEAE column were fractionated on a heparin Hi-Trap column instead of ssDNA cellulose. Wild-type DNA-PKcs was purified from HeLa cells as described previously (17).

Partial purification of DNA-PK from unirradiated and irradiated human cells. Human HEK293 cells were grown in suspension in Pro293 medium (Cambrex Bioscience) supplemented with 5% fetal calf serum, 100 units/ml penicillin, and 100 units/ml streptomycin until they reached a density of approximately 1 x 107 cells/ml. For partial purification of DNA-PKcs, approximately 6 liters of cells was either untreated or irradiated with 10 Gy of IR and then harvested and lysed in the presence of protease inhibitors (Complete protease inhibitor; Roche) and the protein phosphatase inhibitor (1 µM microcystin-LR). S10 and P10 extracts were prepared as described previously (17) and then combined to make a whole-cell extract. The total amount of protein in the combined extract was, in both cases, approximately 2 g. The whole-cell extract was dialyzed against TB buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 5% [vol/vol] glycerol) containing 75 mM KCl (TB 75), 0.1 mM dithiothreitol, and protease and phosphatase inhibitors as above, plus 0.2 mM phenylmethylsulfonyl fluoride. The sample was loaded onto a 50-ml DEAE Sepharose column (GE Healthcare) preequilibrated in TB 75, and the column was washed in TB 75 buffer until the A280 was less than 0.03. Proteins were then eluted using TB containing 175 mM salt (TB 175). DNA-PKcs-containing fractions were dialyzed into TB 100, and 0.02% (vol/vol) Tween 20 was added to the sample before it was loaded onto a 5-ml Hi-Trap heparin column (GE Healthcare) preequilibrated in TB 100 buffer containing 0.02% Tween 20. Proteins were eluted with a linear gradient of TB containing 100 mM salt to TB containing 750 mM salt (both containing 0.02% Tween 20) over 75 ml, 2-ml fractions were collected, and DNA-PKcs-containing fractions were identified by Western blotting. The identity of DNA-PKcs was also confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MS) fingerprinting (data not shown). Approximately 0.5 µg of total protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blot analysis using the phosphospecific antibody to T3950 as well as the phosphospecific antibodies described in reference 14. Phosphospecific antibodies were incubated with blots in the presence of dephospho- or phosphopeptide (10 µg/ml) as indicated. Identical blots were run for total DNA-PKcs. Phosphorylation at serine 2056 was detected using a commercially available phosphospecific antibody (Abcam, ab18192) at 1:200 dilution overnight.

To quantitate in vivo phosphorylation, known amounts of DNA-PKcs purified from irradiated cells were analyzed by Western blotting with known amounts of in vitro-phosphorylated DNA-PKcs. Blots were probed with each phosphospecific antibody or an antibody (DPK1) to total DNA-PKcs. Western blots were scanned and the signal quantitated using Quantity One software (Bio-Rad).

Immunoprecipitation assays for kinase dissociation and inactivation. DNA-PKcs and Ku were purified from HeLa cells as described previously (17). Purified wild-type, ABCDE>ala, AP>ala, or APT>ala mutant DNA-PKcs (2.5 µg) was incubated with purified Ku (1.25 µg); 10 mM MgCl2; and either no ATP, 0.25 mM ATP, or 0.25 mM AMP-PNP at 30°C for 1 h. Immunoprecipitation reactions were carried out at 4°C for 2 h, using 5 µl of a mouse polyclonal antibody to Ku80 that had been preincubated with protein G Sepharose (GE Healthcare) in phosphate-buffered saline buffer containing 0.5% (vol/vol) NP-40. Immunoprecipitates were gently washed five times each with 200 µl of phosphate-buffered saline containing 0.5% NP-40 and immunoblotted for DNA-PKcs as previously described.

Mass spectrometry. Phosphorylation site analysis of DNA-PKcs was performed on a 4000 Q-Trap mass spectrometer using multiple reaction monitoring as described by Unwin et al. (35). Multiple reaction monitors were constructed for the phosphopeptides described previously (14) using the MIDAS software program (Applied Biosystems, Foster City CA) by selecting the doubly and triply charged ions for each phosphopeptide precursor with the neutral loss of phosphoric acid as the reporter. Tryptic digests of DNA-PKcs were analyzed by liquid chromatography (LC)-MS on a Dionex Ultimate nano-high-pressure LC system fitted with a PepMap C18 (0.075- x 150-mm) column coupled to the 4000 Q-Trap mass spectrometer as described previously (38). All tandem MS (MS/MS) spectra were searched against a database using an in-house Mascot (Matrixscience, United Kingdom) server, and the sequence of phosphopeptides was validated by manual inspection of the MS/MS spectra using the Analyst software package (MDS-Sciex, Toronto, Canada).


arrow
RESULTS
 
DNA-PKcs contains a highly conserved potential phosphorylation site within its putative activation loop. We previously observed that DNA-PKcs phosphorylation sites corresponding to threonines 2609, 2638, and 2647 in the human sequence are conserved in the slime mold Dictyostelium discoideum (2). We also observed that putative DNA-PKcs homologues in mammals, fish, and sea squirts (Ciona intestinalis) as well as Dictyostelium discoideum each contain a highly conserved threonine (corresponding to T3950 in the human sequence) in the putative catalytic site of DNA-PKcs (2) (Fig. 1B). Moreover, in all species examined, with the exception of the mosquito, this threonine is followed by a glutamine (Fig. 1B) and therefore conforms to the typical phosphorylation consensus site for DNA-PKcs and other PIKKs (22, 29). T3950 lies just downstream of the highly conserved DXXXXN and DXG residues found in the typical eukaryotic protein kinases (24, 28). In the typical protein kinase family, this region contains a flexible loop called the activation or t-loop. The t-loop is defined as the region between and including two conserved tripeptide motifs: the DFG of the metal binding motif and a conserved APE sequence about 20 to 35 amino acids downstream (28). Since there is presently no high-resolution structure for the catalytic domain of DNA-PKcs or any of the other PIKK family members, we compared the amino acid sequence of DNA-PKcs to that of the {gamma} isoform of the p110 subunit of porcine PI3K, for which a high-resolution structure is available (37). The activation segment of porcine p110{gamma} begins after the DFG sequence proximal to alpha-helix k-ß-5 and extends to a TPD motif that occurs at the start of the alpha-helix k-{alpha}-7 (37). The TPD motif loosely matches the canonical APE motif in the eukaryotic protein kinase family, as glutamate (E) and aspartate (D) are both acidic amino acids, while alanine (A) and threonine (T) both have small uncharged amino acid side chains. Thus, T3950 resides in a region of the catalytic domain of DNA-PKcs that is similar to the activation loop of members of the typical protein kinase family. The high degree of conservation of this putative phosphorylation site across diverse species suggests that phosphorylation of T3950 could be important for the function of DNA-PKcs.

Threonine 3950 is autophosphorylated in vitro. In order to determine whether T3950 is a target of DNA-PK phosphorylation, a phosphospecific antibody was generated to a phosphopeptide containing the region of DNA-PKcs encompassing T3950. To characterize the antibody, increasing amounts of the antigenic (phosphorylated) peptide or the corresponding nonphosphorylated peptide were spotted onto nitrocellulose and probed with the threonine 3950 phosphospecific antibody (pThr3950). Whereas the antibody detected the antigenic peptide, it did not recognize the nonphosphorylated peptide (Fig. 2A). Furthermore, addition of the antigenic peptide to the phosphospecific antibody during immunoblotting prevented the recognition of the antigenic peptide, whereas the unphosphorylated peptide did not prevent antibody recognition of the antigenic peptide (Fig. 2A). Thus, the antibody recognizes phosphorylated but not nonphosphorylated T3950.


Figure 2
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 2. In vitro characterization of a DNA-PKcs threonine 3950 phosphospecific antibody. A. For each panel, the phosphorylated/antigenic (phos.) or corresponding unphosphorylated (unphos.) peptides were spotted onto nitrocellulose in increasing amounts as indicated. Blots were probed with the DNA-PKcs threonine 3950 phosphospecific antibody. Where indicated, the phosphospecific antibodies were used in the presence of either the phosphorylated/antigenic peptide (phos.) or the unphosphorylated peptide (unphos.) as indicated. B. DNA-PKcs was incubated under standard autophosphorylation conditions in the presence or absence of ATP and Western blotted using the DNA-PKcs T3950 phosphospecific antibody (pThr3950) or the DNA-PKcs antibody DPK1. Where indicated, the threonine 3950 phosphospecific antibody was used in the presence of the antigenic phosphorylated peptide or other unrelated phosphorylated peptides or the threonine 3950 unphosphorylated blocking peptide.

To determine whether threonine 3950 is an in vitro DNA-PKcs phosphorylation site, purified DNA-PK was incubated in the presence or absence of ATP and then immunoblotted with the T3950 phosphospecific antibody. Only autophosphorylated DNA-PKcs was recognized by the T3950 phosphospecific antibody, indicating that the antibody was phosphospecific in the context of the full-length protein (Fig. 2B). The phospho signal was ablated when blots were incubated in the presence of the antigenic peptide but not when they were incubated with phosphopeptides containing TQ motifs corresponding to other DNA-PK phosphorylation sites (Fig. 2B). Thus, T3950 is an in vitro autophosphorylation site and the antibody is specific for phosphorylated T3950.

Threonine 3950 is phosphorylated in vivo in response to DNA damage. To determine whether threonine 3950 is phosphorylated in vivo, human lymphoblastoid cells (BT) were either untreated or treated with OA, IR, camptothecin, or etoposide. Whole-cell extracts were enriched for DNA-PK using ssDNA cellulose resin and then immunoblotted with either the DNA-PKcs T3950 phosphospecific antibody (Fig. 3A, upper panels) or a polyclonal antibody to DNA-PKcs (Fig. 3A, lower panel). Whereas OA induced the phosphorylation of DNA-PKcs at T3950, phosphorylation at T3950 was not detected in this assay when cells were treated with various DNA-damaging agents (Fig. 3A). These results are therefore similar to those reported by our group previously for in vivo phosphorylation at the ABCDE cluster (14). We have speculated that this may be due to the small fraction of the total DNA-PKcs that is phosphorylated at DSBs in response to DNA damage (14). In contrast, others have observed that DNA damage induced phosphorylation of DNA-PKcs at threonines 2609, 2638, and 2647 (5, 7, 40). In order to reconcile these differences, we partially purified DNA-PKcs from HEK293 cells that had either been irradiated or not and analyzed the purified protein using mass spectrometry and/or Western blot assays using phosphospecific antibodies. We show that T3950 as well as threonines 2609, 2620, 2638, and 2647 and serines 2612 and 2624 are all phosphorylated in vivo in response to IR (Fig. 3B). Using LC-MS/MS we confirmed that threonine 2638 and serine 3205 are phosphorylated in vivo in irradiated cells (see Fig. S1A and S1B in the supplemental material). By comparing the signal in Western blot assays with known amounts of in vitro-phosphorylated DNA-PKcs, the stoichiometry of phosphorylation at each site was estimated to be approximately 0.2 ng phosphate per ng protein (see Fig. S2 in the supplemental material).


Figure 3
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 3. In vivo phosphorylation of DNA-PKcs on threonine 3950. A. DNA-PKcs-proficient lymphoblastoid (BT) cells were either untreated (U, lane 1), or treated with OA, IR, camptothecin (Cpt), or etoposide (Etop) as described in Materials and Methods (lanes 2 to 5, respectively). Whole-cell extracts containing 2 mg of total protein were enriched for DNA-PKcs using ssDNA cellulose pull-down assays and were probed using either the DNA-PKcs threonine 3950 phosphospecific antibody (pThr3950) or a monoclonal antibody to DNA-PKcs (monoclonal antibody 42-27). The threonine 3950 phosphospecific antibody was used in the presence of either the antigenic peptide (phos pep) or an unphosphorylated mock peptide (unphos pep). Lane 6 (C) contained in vitro-autophosphorylated DNA-PKcs as a positive control. B. HEK293 cells were either unirradiated or irradiated at 10 Gy and harvested immediately thereafter. DNA-PKcs was partially purified (see Materials and Methods for details). Approximately 0.5 µg of DNA-PKcs was run on a sodium dodecyl sulfate-polyacrylamide gel and analyzed for phosphorylation at threonines 2609, 2620, 2638, 2647, and 3950 and serines 2612 and 2624 using the phosphospecific antibodies as indicated. The blot was stripped and reprobed for total DNA-PKcs using the monoclonal antibody 42-27.

We also examined in vivo phosphorylation of DNA-PKcs at serine 2056 using a commercially available antibody. Serine 2056 has previously been shown to be phosphorylated in vivo in response to DNA damage and likely represents an in vivo autophosphorylation site (7). Our results also indicate that DNA-PKcs undergoes autophosphorylation at serine 2056 since in vivo phosphorylation is inhibited by pretreatment of human cells with the DNA-PK inhibitor NU7441 (42) (see Fig. S3 in the supplemental material). Thus, in conclusion, we have shown that serines 2056, 2612, 2624, and 3205 and threonines 2609, 2620, 2638, 2647, and 3950 are phosphorylated in vivo in irradiated cells.

Phosphorylation of threonine 3950 is functionally critical in living cells. We next generated expression constructs encoding DNA-PKcs with alanine or aspartic acid substitutions for T3950 (termed T>ala and T>asp, respectively) and expressed them in the DNA-PKcs-deficient cell line V3. Both the alanine- and aspartic acid-substituted DNA-PKcs mutants are stably expressed at similar levels in V3 cells (Fig. 4A). We next assayed for DNA-PK kinase activity in extracts from V3 cells expressing wild-type DNA-PKcs, T>ala, or T>asp. Whereas extracts from V3 cells expressing the T>ala substitution contain robust DNA-PK protein kinase activity, DNA-PK activity is minimal in extracts from cells expressing the T>asp substitution (Fig. 4B). Thus, although T3950 is not critical for DNA-PK activity, mutation of T3950 to an acidic amino acid ablates kinase activity. Since aspartic acid is negatively charged and thus can be considered a phosphomimic, these data suggest that dephosphorylation of T3950 could be important for DNA-PK activity.


Figure 4
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 4. Phosphorylation of T3950, a conserved phosphorylation site in the activation loop of DNA-PKcs, regulates its protein kinase activity. A. Immunoblot assays of whole-cell extracts (50 µg, lanes 1 to 4) or DNA cellulose fractions (lanes 5 to 8) from V3 transfectants using an antibody to DNA-PKcs. B. Whole-cell extracts prepared from V3 transfectants as indicated were assayed for DNA-PK activity using the DNA cellulose pull-down assay. Each cell extract was tested in duplicate, and three independent extracts were tested. Error bars depict standard deviations. wt, wild type. C. Radioresistance of V3 transfectants expressing wild-type DNA-PKcs, vector alone, and mutants T>A and T>D was assessed. Error bars indicate standard errors of the means of three independent experiments.

To determine whether T3950 phosphorylation is functionally relevant, clonogenic survival assays were performed on cells expressing the DNA-PKcs mutants. These assays reveal modest radiosensitivity in cells expressing the T>ala mutant, whereas cells expressing the T>asp mutant DNA-PKcs are markedly radiosensitive (Fig. 4C). Similarly, V(D)J coding is only slightly reduced (Table 1 ) and is structurally normal (see Table S1 in the supplemental material) in cells expressing the T>ala mutant but is severely reduced in cells expressing the T>asp mutant (Table 1). Signal end joining is variably depressed in different DNA-PKcs-deficient cell lines and in different animal models of DNA-PKcs deficiency (16, 26, 32, 41). Using complementation strategies, we (and others) have shown that V3 cells have a significant defect in signal end joining (11, 20). Thus, wild-type DNA-PKcs increased the level of signal joints retrieved in transient assays by approximately 40-fold (pJH201 transfections, Table 1) consistent with previous experiments (8, 11, 18, 39). Whereas the T>ala mutant supports substantial signal end joining, the T>asp mutant does not. Thus, cells expressing the T>asp mutant have severe NHEJ deficits, indicating that a negative charge at T3950, which possibly mimics constitutive phosphorylation at this site, adversely affects DNA-PK function.


View this table:
[in this window]
[in a new window]

 
TABLE 1. T>ala mutants support reduced levels of V(D)J recombination but T>asp mutants do not support V(D)J recombinationa

Mutation of threonine 3950 does not affect the interaction of DNA-PKcs with Ku or with DNA in vivo. We have previously shown that, in vitro, autophosphorylation of DNA-PKcs results in loss of DNA-PK activity and dissociation of DNA-PKcs from the DNA-PKcs-Ku-DNA complex (6, 13, 27). As shown in Fig. 4A, DNA-PKcs containing the T3950-to-D mutation lacks protein kinase activity but still binds to DNA cellulose resin. Since DNA-PKcs and Ku interact only in the presence of DNA (reviewed in reference 21), these data suggest that mutation of T3950 to D results in loss of protein kinase activity without disrupting the interaction of DNA-PKcs with Ku and that autophosphorylation-induced inactivation of DNA-PKcs and dissociation of phosphorylated DNA-PKcs from Ku could be separate steps. However, an alternative explanation for the results shown in Fig. 4A could be that the ability of the T>asp mutant to bind to DNA cellulose is a result of nonspecific binding of DNA-PKcs to the resin. In order to rule out this possibility, we generated another DNA-PKcs mutant in which the N-terminal 426 residues had been deleted (termed {Delta}N). Two recent reports suggest that the N terminus is critical for the ability of DNA-PKcs to interact with DNA. First, Llorca and colleagues have provided informative low-resolution structures of DNA-PKcs revealing that most DNA-protein contacts involve the N-terminal "palm" domain of DNA-PKcs (4, 31, 34). Additionally, recent data from one of our laboratories are consistent with these structural data in that mutation of the leucine-rich repeat region of DNA-PKcs (in the palm domain) partially disrupts its affinity for DNA (18). We therefore reasoned that the {Delta}N deletion might prevent DNA-PK from stably interacting with DNA, thus proving that specific DNA binding activity lies outside the PI3K domain of DNA-PKcs and suggesting that the DNA cellulose binding of the T>asp mutant is a specific DNA binding event. Although the {Delta}N mutant is stably expressed in V3 cells, it has no detectable affinity for DNA cellulose (Fig. 5A) and does not complement the radiosensitive phenotype of V3 cells (Fig. 5B). These data provide additional support for the conclusion that the N-terminal palm domain interacts with DNA. Further, since the {Delta}N mutant contains roughly 90% of DNA-PKcs's coding sequence but clearly does not fractionate with DNA-cellulose, we conclude that it is unlikely that the affinity of the T>asp mutant for DNA cellulose is an artifact of its ability to interact with DNA in the absence of Ku.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 5. T>ala and T>asp mutants mobilize to the nuclear matrix in response to DSBs, similarly to wild-type DNA-PKcs. A. Immunoblot assays of whole-cell extracts (50 µg, lanes 1 to 4) or DNA cellulose fractions (lanes 5 to 8) from V3 cell transfectants using an antibody to DNA-PKcs as indicated. wt, wild type. B. Radioresistance of V3 transfectants expressing wild-type DNA-PKcs, vector alone, or {Delta}N mutants was assessed. Error bars indicate standard errors of the means of three independent experiments. C. V3 transfectants were treated (or not) with 140 µM bleomycin for 1 h and then harvested. Triton-extractable and Triton-insoluble nuclear fractions were isolated as described previously (15) and analyzed by immunoblotting as indicated.

Although the experiments described above suggest that the T>asp mutant can interact with Ku-bound DNA in vitro, we considered it possible that phosphorylation of T3950 could directly induce the release of DNA-PKcs from DNA in vivo. There is growing evidence that DNA repair occurs in specific nuclear compartments. It has been shown that various DNA repair factors relocalize to distinct nuclear regions in response to DNA damage (15). These distinct regions have been characterized as detergent-insoluble fractions of cell lysates. This strategy has recently been utilized to assess nuclear compartmentalization of NHEJ factors (8, 15). Drouet and colleagues demonstrated that in response to drugs that induce DSBs, NHEJ components mobilize to a detergent-insoluble nuclear fraction, from a largely soluble nuclear fraction (15). Thus, we next treated cells expressing wild type and T>ala and T>asp DNA-PKcs mutants with bleomycin and isolated the detergent-insoluble nuclear fraction (matrix fraction). This fraction also contains lamin B, a protein associated with the nuclear matrix. As can be seen, the T>ala and T>asp mutants mobilize to the detergent-insoluble fraction in response to DNA damage just as well as wild-type DNA-PKcs does (Fig. 5C). Together, these data suggest that inactivation of DNA-PKcs, due to phosphorylation of T3950 (mimicked here by introduction of aspartic acid), and dissociation are distinct steps.

Blocking phosphorylation of the ABCDE, PQR, and t-loop sites does not prevent kinase dissociation. We next constructed another DNA-PKcs mutant that includes alanine substitutions at all six ABCDE sites, the five PQR sites, and S3205 as well as T3950. For brevity, this mutant is termed APT>ala (ABCDE+PQR+T>ala). This construct was stably introduced into V3 cells, and high-level-expressing clones were isolated (Fig. 6A). We previously studied another mutant combining all of these sites except T3950>ala (8). For brevity, this mutant (previously called ABCDE+PQR>ala) is termed AP>ala. Functional analyses of cells expressing the APT>ala mutant revealed radiosensitivity similar to that of cells expressing the AP>ala combined mutant (Fig. 6B). Further, DNA cellulose "pull-down" assays reveal that the DNA-PK activity of AP>ala and APT>ala is similar to that of wild-type DNA-PKcs (Fig. 6C). Thus, the effect of mutation of T3950 to alanine in the context of the ABCDE and PQR mutations is similar to that of mutation of ABCDE and PQR alone. This is consistent with our previous finding that mutation of the PQR cluster partially alleviates the effects of mutation of the ABCDE cluster (8). Also, we note that DNA-PKcs in which 13 amino acids, including T3950, have been mutated to alanine still retains full protein kinase activity. These data suggest that incorporation of multiple mutations does not adversely affect the structure of DNA-PKcs.


Figure 6
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 6. Functional characterization of the combined ABCDE+PQR+T mutant. A. Immunoblot assays of whole-cell extracts (50 µg) of V3 transfectants using an antibody to DNA-PKcs, as indicated. B. Radioresistance of V3 transfectants expressing wild-type DNA-PKcs; vector alone; or mutants ABCDE>ala, AP>ala, and APT>ala was assessed. Error bars indicate standard errors of the means. C. Whole-cell extracts prepared from V3 transfectants as indicated were assayed for DNA-PK activity using the DNA cellulose pull-down assay. Error bars represent standard deviations of four separate experiments.

To further characterize the biochemical properties of these mutants, the APT>ala and AP>ala mutants as well as wild-type DNA-PKcs and ABCDE>ala were purified to homogeneity (see Fig. S4 in the supplemental material). The protein kinase activity of the APT>ala and the AP>ala mutants was DNA dependent and was enhanced 5- to 10-fold by the addition of purified Ku (data not shown). To address whether the APT>ala and AP>ala mutants undergo ATP-induced inactivation, the purified proteins were incubated in the presence of Ku and DNA with either Mg-ATP or the nonhydrolyzable ATP analogue Mg-AMP-PNP and at intervals assayed for residual DNA-PK activity. As can be seen, the mutant proteins undergo ATP hydrolysis-induced inactivation similar to that of wild-type DNA-PKcs, indicating that blocking T3950 phosphorylation, at least in the context of mutation of ABCDE and PQR clusters, does not prevent phosphorylation-induced inactivation of DNA-PKcs (Fig. 7A).


Figure 7
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 7. Biochemical characterization of DNA-PKcs phosphorylation site mutants. A. Wild-type, AP>ala, or APT>ala DNA-PKcs (0.04 µg/µl) and Ku (0.013 µg/µl) were preincubated (molar ratio, 1:1) in 25 mM HEPES-NaOH (pH 7.2), 70 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 0.1 mM EDTA, 10 µg/ml calf thymus DNA, and 0.25 mM ATP (closed squares) or 0.25 mM AMP-PNP (open squares) as indicated, in a total volume of 33 µl. After 0, 3, 6, 12, 22, 40, and 60 min, aliquots of 2 µl (equivalent to 0.1 µg of DNA-PK total protein) were removed and assayed under standard kinase assay conditions in the presence of synthetic peptide (PESQEAFADLWKK), calf thymus DNA, and radiolabeled ATP. Results of an identical experiment with the ABCDE>ala mutant have been published previously (3). B. Purified wild-type, ABCDE>ala, APT>ala, and AP>ala proteins (2.5 µg) were incubated under standard autophosphorylation conditions (see above) with either no ATP, 0.25 mM ATP, or 0.25 mM AMP-PNP as indicated at 30°C for 1 h. Proteins were immunoprecipitated with an antibody to Ku70/80. Immunocomplexes were analyzed by Western blotting using antibodies to DNA-PKcs (DPK1) or Ku80 as indicated.

We next examined the effect of mutation of ABCDE, PQR, and T3950 on autophosphorylation-induced dissociation of DNA-PKcs and Ku. Consistent with the enzymatic assays, wild-type DNA-PKcs and the APT>ala and AP>ala mutants coimmunoprecipitate with Ku in the absence of ATP and in the presence of the nonhydrolyzable ATP analogue AMP-PNP but not in the presence of ATP (Fig. 7B). Thus, mutation of T3950 (at least in the context of mutation at the ABCDE and PQR sites, i.e., APT>ala) does not affect kinase dissociation. In contrast, in this immunoprecipitation assay we find that the ABCDE>ala protein is partially defective in its ability to undergo ATP-induced dissociation from Ku. Thus, consistent with our previous findings (8), blocking PQR phosphorylation in the ABCDE mutant (by Ala substitution at both the ABCDE and PQR clusters, i.e., the AP>ala mutant) reverses the effect of blocking ABCDE phosphorylation, and the combined mutant behaves similarly to wild-type DNA-PKcs. In summary, mutation of up to 13 phosphorylation sites to alanine does not affect the protein kinase activity of DNA-PKcs and does not prevent ATP-induced inactivation of DNA-PK. Also, mutation of T3950 to A in the context of mutations at ABCDE and PQR does not prevent phosphorylation-induced dissociation of the complex.

Interestingly, DNA-PKcs in which all 13 sites had been mutated to alanine was still phosphorylated to approximately 40% of the wild-type level, suggesting that there are additional in vitro autophosphorylation sites yet to be identified and characterized (see Fig. S5 in the supplemental material).


arrow
DISCUSSION
 
Here, we have identified a new in vitro autophosphorylation site in human DNA-PKcs, T3950, and show that this site is phosphorylated in vivo in cells exposed to IR and to the protein phosphatase inhibitor OA. Due to an earlier entry in the database, this amino acid was previously referred to as T3949 (20). To be consistent with previous nomenclature for identified DNA-PKcs phosphorylation sites (8, 11, 14) and the current version of the amino acid sequence of DNA-PKcs (accession numbers NP_008835 and P78527), T3950 is used here. T3950 is located in the protein kinase domain of DNA-PKcs and is conserved in all vertebrate species for which the sequence of DNA-PKcs is known. Moreover, this site is conserved in invertebrates including the slime mold Dictyostelium discoideum and the sea squirt, Ciona intestinalis. Since there is presently no X-ray structure for DNA-PKcs or any other PIKK family member, we compared the protein kinase domain of DNA-PKcs to that of the p110 subunit of PI3K. From this analysis, we speculate that T3950 is located in the putative activation loop or t-loop of DNA-PKcs. Many members of the typical eukaryotic protein kinase family (24) such as the mitogen-activated protein kinases, the AGC kinases, and the cyclin-dependent protein kinases are regulated by t-loop phosphorylation, and in most cases, phosphorylation is required for activation of protein kinase activity (28). Interestingly, autophosphorylation of the p110 catalytic subunit of PI3K negatively regulates the lipid and protein kinase activity of PI3K (36); however, these autophosphorylation sites lie outside of the catalytic domain and t-loop phosphorylation has not been shown to regulate PI3K activity. In vitro, DNA-PKcs also undergoes autophosphorylation-induced inactivation, but the site(s) responsible for loss of protein kinase activity is not known.

The strong conservation of T3950 between DNA-PKcs sequences from humans to slime molds suggested to us that this amino acid could be important for the function of DNA-PKcs. Mutation of T3950 to alanine had no effect on the protein kinase activity of DNA-PKcs and had only modest effects on DNA-PK function in vivo, suggesting that phosphorylation of T3950 is not required for the activity or function of DNA-PK. However, replacement of T3950 with an acidic amino acid (aspartic acid) resulted in loss of protein kinase activity and severe defects in both NHEJ and V(D)J recombination. Since aspartic acid is commonly used as a phosphomimic, these results suggest that dephosphorylation of DNA-PKcs at T3950 could be required for DNA-PK activity and function. However, another interpretation of our results is that a nonacidic amino acid at position T3950 is essential for the function of DNA-PKcs. Whether autophosphorylation of T3950 plays a role in removal of the putative activation loop from the catalytic site as has been demonstrated for many serine/threonine protein kinases (28) awaits to be seen and will likely require a high-resolution structure of DNA-PKcs or a related PIKK. Neither ATM, ATR, mTOR, nor SMG1 contains a conserved SQ/TQ motif in the putative activation loop sequence (2); therefore, phosphorylation at this site appears to be unique to DNA-PKcs. Regardless of whether DNA-PKcs has a t-loop or not, our results clearly show that T3950 plays an important role in the function of DNA-PKcs.

We previously identified two clusters of phosphorylation sites in DNA-PKcs (ABCDE and PQR) that regulate DNA end processing and DNA repair pathway choice in a reciprocal manner (11). At a biochemical level, mutation of either the ABCDE cluster or the PQR cluster to alanine does not affect the protein kinase activity of DNA-PK or the ability of DNA-PK to undergo phosphorylation-induced inactivation. We have previously shown using electrophoretic mobility shift assays that the ABCDE>ala mutant has a slight defect in ATP-induced dissociation (11, 30). The dissociation defect was more apparent in the current study, possibly because here we used an immunoprecipitation assay which was carried out without the presence of protein cross-linker, whereas in previous studies, glutaraldehyde was used to stabilize protein-DNA complexes in electrophoretic mobility shift assays (11, 30). Thus, phosphorylation of the ABCDE cluster may play a greater role in the phosphorylation-induced dissociation of DNA-PKcs than was previously thought. Mutation of T3950 to alanine did not affect DNA-PK protein activity, and DNA-PKcs containing mutations at ABCDE, PQR, and T3950 phosphorylation sites still underwent ATP-induced inactivation and dissociation of the DNA-PKcs from Ku in vitro. In keeping with our previous results, mutation of PQR (with or without the T3950>ala mutation) relieved the effects of the ABCDE>ala mutant on dissociation. Finally, DNA-PKcs in which all 13 identified phosphorylation sites (including T3950) were mutated to alanine (APT>ala) was still phosphorylated in vitro to approximately 40% of the wild-type level, indicating that additional autophosphorylation sites may be required for inactivation and complete dissociation of DNA-PK in vitro. Indeed, Lieber and colleagues have identified three additional in vitro DNA-PK autophosphorylation sites, serines 3821 and 4026 and threonine 4102; however, their biological significance is not known (23).

Several residues in the ABCDE cluster (T2609, T2638, and 2647) have been shown to be phosphorylated in vivo in response to IR and/or UV radiation (5, 7, 40). Here we provide direct evidence that additional sites in the ABCDE cluster (S2612, T2620, and S2624) are also phosphorylated in vivo in irradiated cells (Fig. 3B). Our results also confirm a previous report that S3205 is phosphorylated in vivo (1). We previously showed that the ABCDE sites (S2612, T2609, T2638, and 2647) were phosphorylated in vivo in cells that had been treated with the protein phosphatase inhibitor OA, but we had been unable to detect DNA damage-induced phosphorylation at the ABCDE sites (14). We speculate that this could be due to one of two possibilities. One is that phosphorylation at these sites is transient and the phosphate is readily removed by the action of protein phosphatases. Alternatively, if only a fraction of the total DNA-PKcs were phosphorylated, as would be expected if DNA-PKcs were only phosphorylated when bound to a DSB, then the level of phosphorylation would be below the level of detection using our phosphospecific antibodies. In this study we purified DNA-PKcs protein from irradiated cells in the continuous presence of protein phosphatase inhibitors and loaded 0.5 µg (~1 pmol) of protein on the gel. We estimate that the stoichiometry of phosphorylation was 10 to 20% for most of the ABCDE sites. Therefore, we would expect only 0.1 to 0.2 pmol of DNA-PKcs to be phosphorylated. In our previous studies, the amount of protein isolated by immunoprecipitation or DNA cellulose pull-down was less than this, perhaps explaining why we had previously been unable to detect in vivo DNA damage-induced phosphorylation at the ABCDE cluster. As reported previously by Chen et al. (7), we also show that serine 2056 in the PQR cluster is phosphorylated in vivo in response to IR in a DNA-PK-dependent manner. Therefore, serine 2056 is likely to be a true autophosphorylation site. It has recently been reported that the related protein kinase ATR can phosphorylate DNA-PKcs at threonines 2609, 2638, and 2647 in response to UV radiation (40) and that ATM may regulate phosphorylation of DNA-PKcs at threonine 2609 in response to IR (7). Whether T3950 and the additional sites in the ABCDE and PQR clusters are autophosphorylated in vivo or phosphorylated by other PIKKs remains to be determined. Regardless, what has become clear from recent studies is that autophosphorylation of DNA-PKcs is complex and likely proceeds through a variety of stages that regulate end access and pathway choice. Recent studies suggesting that DNA-PKcs may be phosphorylated at these sites by other members of the PIKK family add another level of complexity that could allow further fine-tuning of the function of DNA-PK in the cellular response to DSBs.


arrow
ACKNOWLEDGMENTS
 
This work was supported by Public Health Service grant AI048758 (K.M.) and by grant 13639 from the Canadian Institutes of Health Research (S.P.L.-M.). S.P.L.-M. is supported by the Alberta Heritage Foundation for Medical Research and the Canadian Institutes of Health Research and holds the Engineered Air Chair in Cancer Research. W.D.B. was supported by scholarships from the Alberta Heritage Foundation for Medical Research and the Natural Sciences and Engineering Council of Canada.

We thank Graeme Smith (KuDOS Pharmaceuticals) for NU7441 and the MRC Protein Phosphorylation Unit, Dundee, for growing the HEK293 cells.

The laboratories at the Departments of Biochemistry and Molecular Biology and Oncology, University of Calgary, Calgary, Alberta, Canada, and the College of Veterinary Medicine and Department of Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, contributed equally to this work.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: 3330 Hospital Drive NW, University of Calgary, Calgary, Alberta, Canada T2N 4N1. Phone: (403) 220-7628. Fax: (403) 270-0737. E-mail: leesmill{at}ucalgary.ca. Back

{triangledown} Published ahead of print on 11 December 2006. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back


arrow
REFERENCES
 
    1
  1. Beausoleil, S. A., M. Jedrychowski, D. Schwartz, J. E. Elias, J. Villen, J. Li, M. A. Cohn, L. C. Cantley, and S. P. Gygi. 2004. Large-scale characterization of HeLa cell nuclear phosphoproteins. Proc. Natl. Acad. Sci. USA 101:12130-12135.[Abstract/Free Full Text]
  2. 2
  3. Block, W. D., and S. P. Lees-Miller. 2005. Putative homologues of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) and other components of the non-homologous end joining machinery in Dictyostelium discoideum. DNA Repair (Amsterdam) 4:1061-1065.[CrossRef]
  4. 3
  5. Block, W. D., Y. Yu, D. Merkle, J. L. Gifford, Q. Ding, K. Meek, and S. P. Lees-Miller. 2004. Autophosphorylation-dependent remodeling of the DNA-dependent protein kinase catalytic subunit regulates ligation of DNA ends. Nucleic Acids Res. 32:4351-4357.[Abstract/Free Full Text]
  6. 4
  7. Boskovic, J., A. Rivera-Calzada, J. D. Maman, P. Chacon, K. R. Willison, L. H. Pearl, and O. Llorca. 2003. Visualization of DNA-induced conformational changes in the DNA repair kinase DNA-PKcs. EMBO J. 22:5875-5882.[CrossRef][Medline]
  8. 5
  9. Chan, D. W., B. P. Chen, S. Prithivirajsingh, A. Kurimasa, M. D. Story, J. Qin, and D. J. Chen. 2002. Autophosphorylation of the DNA-dependent protein kinase catalytic subunit is required for rejoining of DNA double-strand breaks. Genes Dev. 16:2333-2338.[Abstract/Free Full Text]
  10. 6
  11. Chan, D. W., and S. P. Lees-Miller. 1996. The DNA-dependent protein kinase is inactivated by autophosphorylation of the catalytic subunit. J. Biol. Chem. 271:8936-8941.[Abstract/Free Full Text]
  12. 7
  13. Chen, B. P., D. W. Chan, J. Kobayashi, S. Burma, A. Asaithamby, K. Morotomi-Yano, E. Botvinick, J. Qin, and D. J. Chen. 2005. Cell cycle dependence of DNA-PK phosphorylation in response to DNA double strand breaks. J. Biol. Chem. 280:14709-14715.[Abstract/Free Full Text]
  14. 8
  15. Cui, X., Y. Yu, S. Gupta, Y. M. Cho, S. P. Lees-Miller, and K. Meek. 2005. Autophosphorylation of DNA-dependent protein kinase regulates DNA end processing and may also alter double-strand break repair pathway choice. Mol. Cell. Biol. 25:10842-10852.[Abstract/Free Full Text]
  16. 9
  17. Czupalla, C., M. Culo, E. C. Muller, C. Brock, H. P. Reusch, K. Spicher, E. Krause, and B. Nurnberg. 2003. Identification and characterization of the autophosphorylation sites of phosphoinositide 3-kinase isoforms beta and gamma. J. Biol. Chem. 278:11536-11545.[Abstract/Free Full Text]
  18. 10
  19. Dhand, R., I. Hiles, G. Panayotou, S. Roche, M. J. Fry, I. Gout, N. F. Totty, O. Truong, P. Vicendo, K. Yonezawa, et al. 1994. PI 3-kinase is a dual specificity enzyme: autoregulation by an intrinsic protein-serine kinase activity. EMBO J. 13:522-533.[Medline]
  20. 11
  21. Ding, Q., Y. V. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek. 2003. Autophosphorylation of the catalytic subunit of the DNA-dependent protein kinase is required for efficient end processing during DNA double-strand break repair. Mol. Cell. Biol. 23:5836-5848.[Abstract/Free Full Text]
  22. 12
  23. Douglas, P., S. Gupta, N. Morrice, K. Meek, and S. P. Lees-Miller. 2005. DNA-PK-dependent phosphorylation of Ku70/80 is not required for non-homologous end joining. DNA Repair (Amsterdam) 4:1006-1018.
  24. 13
  25. Douglas, P., G. B. Moorhead, R. Ye, and S. P. Lees-Miller. 2001. Protein phosphatases regulate DNA-dependent protein kinase activity. J. Biol. Chem. 276:18992-18998.[Abstract/Free Full Text]
  26. 14
  27. Douglas, P., G. P. Sapkota, N. Morrice, Y. Yu, A. A. Goodarzi, D. Merkle, K. Meek, D. R. Alessi, and S. P. Lees-Miller. 2002. Identification of in vitro and in vivo phosphorylation sites in the catalytic subunit of the DNA-dependent protein kinase. Biochem. J. 368:243-251.[CrossRef][Medline]
  28. 15
  29. Drouet, J., C. Delteil, J. Lefrancois, P. Concannon, B. Salles, and P. Calsou. 2005. DNA-dependent protein kinase and XRCC4-DNA ligase IV mobilization in the cell in response to DNA double strand breaks. J. Biol. Chem. 280:7060-7069.[Abstract/Free Full Text]
  30. 16
  31. Errami, A., D. M. He, A. A. Friedl, W. J. Overkamp, B. Morolli, E. A. Hendrickson, F. Eckardt-Schupp, M. Oshimura, P. H. Lohman, S. P. Jackson, and M. Z. Zdzienicka. 1998. XR-C1, a new CHO cell mutant which is defective in DNA-PKcs, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res. 26:3146-3153.[Abstract/Free Full Text]
  32. 17
  33. Goodarzi, A. A., and S. P. Lees-Miller. 2004. Biochemical characterization of the ataxia-telangiectasia mutated (ATM) protein from human cells. DNA Repair (Amsterdam) 3:753-767.[CrossRef]
  34. 18
  35. Gupta, S., and K. Meek. 2005. The leucine rich region of DNA-PKcs contributes to its innate DNA affinity. Nucleic Acids Res. 33:6972-6981.[Abstract/Free Full Text]
  36. 19
  37. Kienker, L. J., E. K. Shin, and K. Meek. 2000. Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination. Nucleic Acids Res. 28:2752-2761.[Abstract/Free Full Text]
  38. 20
  39. Kurimasa, A., S. Kumano, N. V. Boubnov, M. D. Story, C. S. Tung, S. R. Peterson, and D. J. Chen. 1999. Requirement for the kinase activity of human DNA-dependent protein kinase catalytic subunit in DNA strand break rejoining. Mol. Cell. Biol. 19:3877-3884.[Abstract/Free Full Text]
  40. 21
  41. Lees-Miller, S. P., and K. Meek. 2003. Repair of DNA double strand breaks by non-homologous end joining. Biochimie 85:1161-1173.[Medline]
  42. 22
  43. Lees-Miller, S. P., K. Sakaguchi, S. J. Ullrich, E. Appella, and C. W. Anderson. 1992. Human DNA-activated protein kinase phosphorylates serines 15 and 37 in the amino-terminal transactivation domain of human p53. Mol. Cell. Biol. 12:5041-5049.[Abstract/Free Full Text]
  44. 23
  45. Ma, Y., U. Pannicke, H. Lu, D. Niewolik, K. Schwarz, and M. R. Lieber. 2005. The DNA-dependent protein kinase catalytic subunit phosphorylation sites in human Artemis. J. Biol. Chem. 280:33839-33846.[Abstract/Free Full Text]
  46. 24
  47. Manning, G., D. B. Whyte, R. Martinez, T. Hunter, and S. Sudarsanam. 2002. The protein kinase complement of the human genome. Science 298:1912-1934.[Abstract/Free Full Text]
  48. 25
  49. Meek, K., S. Gupta, D. A. Ramsden, and S. P. Lees-Miller. 2004. The DNA-dependent protein kinase: the director at the end. Immunol. Rev. 200:132-141.[CrossRef][Medline]
  50. 26
  51. Meek, K., L. Kienker, C. Dallas, W. Wang, M. J. Dark, P. J. Venta, M. L. Huie, R. Hirschhorn, and T. Bell. 2001. SCID in Jack Russell terriers: a new animal model of DNA-PKcs deficiency. J. Immunol. 167:2142-2150.[Abstract/Free Full Text]
  52. 27
  53. Merkle, D., P. Douglas, G. B. Moorhead, Z. Leonenko, Y. Yu, D. Cramb, D. P. Bazett-Jones, and S. P. Lees-Miller. 2002. The DNA-dependent protein kinase interacts with DNA to form a protein-DNA complex that is disrupted by phosphorylation. Biochemistry 41:12706-12714.[CrossRef][Medline]
  54. 28
  55. Nolen, B., S. Taylor, and G. Ghosh. 2004. Regulation of protein kinases; controlling activity through activation segment conformation. Mol. Cell 15:661-675.[CrossRef][Medline]
  56. 29
  57. O'Neill, T., A. J. Dwyer, Y. Ziv, D. W. Chan, S. P. Lees-Miller, R. H. Abraham, J. H. Lai, D. Hill, Y. Shiloh, L. C. Cantley, and G. A. Rathbun. 2000. Utilization of oriented peptide libraries to identify substrate motifs selected by ATM. J. Biol. Chem. 275:22719-22727.[Abstract/Free Full Text]
  58. 30
  59. Reddy, Y. V., Q. Ding, S. P. Lees-Miller, K. Meek, and D. A. Ramsden. 2004. Non-homologous end joining requires that the DNA-PK complex undergo an autophosphorylation-dependent rearrangement at DNA ends. J. Biol. Chem. 279:39408-39413.[Abstract/Free Full Text]
  60. 31
  61. Rivera-Calzada, A., J. D. Maman, L. Spagnolo, L. H. Pearl, and O. Llorca. 2005. Three-dimensional structure and regulation of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). Structure 13:243-255.[Medline]
  62. 32
  63. Shin, E. K., T. Rijkers, A. Pastink, and K. Meek. 2000. Analyses of TCRB rearrangements substantiate a profound deficit in recombination signal sequence joining in SCID foals: implications for the role of DNA-dependent protein kinase in V(D)J recombination. J. Immunol. 164:1416-1424.[Abstract/Free Full Text]
  64. 33
  65. Soubeyrand, S., L. Pope, B. Pakuts, and R. J. Hache. 2003. Threonines 2638/2647 in DNA-PK are essential for cellular resistance to ionizing radiation. Cancer Res. 63:1198-1201.[Abstract/Free Full Text]
  66. 34
  67. Spagnolo, L., A. Rivera-Calzada, L. H. Pearl, and O. Llorca. 2006. Three-dimensional structure of the human DNA-PKcs/Ku70/Ku80 complex assembled on DNA and its implications for DNA DSB repair. Mol. Cell 22:511-519.[CrossRef][Medline]
  68. 35
  69. Unwin, R. D., J. R. Griffiths, M. K. Leverentz, A. Grallert, I. M. Hagan, and A. D. Whetton. 2005. Multiple reaction monitoring to identify sites of protein phosphorylation with high sensitivity. Mol. Cell. Proteomics 4:1134-1144.[Abstract/Free Full Text]
  70. 36
  71. Vanhaesebroeck, B., K. Higashi, C. Raven, M. Welham, S. Anderson, P. Brennan, S. G. Ward, and M. D. Waterfield. 1999. Autophosphorylation of p110-delta phosphoinositide 3-kinase: a new paradigm for the regulation of lipid kinases in vitro and in vivo. EMBO J. 18:1292-1302.[CrossRef][Medline]
  72. 37
  73. Walker, E. H., O. Perisic, C. Ried, L. Stephens, and R. L. Williams. 1999. Structural insights into phosphoinositide 3-kinase catalysis and signalling. Nature 402:313-320.[CrossRef][Medline]
  74. 38
  75. Williamson, B. L., J. Marchese, and N. A. Morrice. 2006. Automated identification and quantification of protein phosphorylation sites by LC/MS on a hybrid triple quadrupole linear ion trap mass spectrometer. Mol. Cell. Proteomics 5:337-346.[Abstract/Free Full Text]
  76. 39
  77. Woods, T., W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek. 2002. A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2. Nucleic Acids Res. 30:5120-5128.[Abstract/Free Full Text]
  78. 40
  79. Yajima, H., K. J. Lee, and B. P. Chen. 2006. ATR-dependent phosphorylation of DNA-dependent protein kinase catalytic subunit in response to UV-induced replication stress. Mol. Cell. Biol. 26:7520-7528.[Abstract/Free Full Text]
  80. 41
  81. Zdzienicka, M. Z. 1999. Mammalian X-ray-sensitive mutants which are defective in non-homologous (illegitimate) DNA double-strand break repair. Biochimie 81:107-116.[Medline]
  82. 42
  83. Zhao, Y., H. D. Thomas, M. A. Batey, I. G. Cowell, C. J. Richardson, R. J. Griffin, A. H. Calvert, D. R. Newell, G. C. Smith, and N. J. Curtin. 2006. Preclinical evaluation of a potent novel DNA-dependent protein kinase inhibitor NU7441. Cancer Res. 66:5354-5362.[Abstract/Free Full Text]


Molecular and Cellular Biology, March 2007, p. 1581-1591, Vol. 27, No. 5
0270-7306/07/$08.00+0     doi:10.1128/MCB.01962-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Bencokova, Z., Kaufmann, M. R., Pires, I. M., Lecane, P. S., Giaccia, A. J., Hammond, E. M. (2009). ATM Activation and Signaling under Hypoxic Conditions. Mol. Cell. Biol. 29: 526-537 [Abstract] [Full Text]  
  • Weterings, E., Chen, D. J. (2007). DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?. JCB 179: 183-186 [Abstract] [Full Text]  
  • Povirk, L. F., Zhou, R.-Z., Ramsden, D. A., Lees-Miller, S. P., Valerie, K. (2007). Phosphorylation in the serine/threonine 2609-2647 cluster promotes but is not essential for DNA-dependent protein kinase-mediated nonhomologous end joining in human whole-cell extracts. Nucleic Acids Res 35: 3869-3878 [Abstract] [Full Text]  
  • Meek, K., Douglas, P., Cui, X., Ding, Q., Lees-Miller, S. P. (2007). trans Autophosphorylation at DNA-Dependent Protein Kinase's Two Major Autophosphorylation Site Clusters Facilitates End Processing but Not End Joining. Mol. Cell. Biol. 27: 3881-3890 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Douglas, P.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Douglas, P.
Right arrow Articles by Meek, K.