| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,
Departments of Biochemistry and Molecular Biology and Oncology, University of Calgary, Calgary, Alberta, Canada T2N 4N1,1 College of Veterinary Medicine and Department of Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, Michigan 48824,2 MRC Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, Scotland, United Kingdom3
Received 18 October 2006/ Returned for modification 14 November 2006/ Accepted 1 December 2006
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Recently, significant effort from several laboratories, including our own, has focused on defining and characterizing autophosphorylation sites within DNA-PKcs (5, 8, 11, 14, 30, 33). We have previously identified two major clusters of in vitro autophosphorylation sites in DNA-PKcs. The ABCDE cluster contains phosphorylation sites at serines 2612 and 2624 and threonines 2609, 2620, 2638, and 2647 (14), and the PQR cluster contains phosphorylation sites at serines 2023, 2029, 2041, 2053, and 2056 (8). Threonines 2609, 2638, and 2647 in the ABCDE cluster and serine 2056 in the PQR cluster are phosphorylated in vivo in response to DNA damage (5, 7, 40). Phosphorylation at the ABCDE and PQR sites appears to reciprocally regulate both DNA end processing and DNA repair pathway choice (8). However, although phosphorylation at the ABCDE cluster has a modest effect on dissociation of the DNA-PK complex in vitro (11, 30), autophosphorylation within the two major clusters does not mediate kinase inactivation (8, 11, 30). This suggests that additional autophosphorylation sites might regulate DNA-PK activity and/or be functionally important.
In vitro DNA-PK phosphorylates many substrates on serines or threonines that are followed by glutamine, so-called SQ/TQ motifs (22) (reviewed in reference 21). Analysis of the cDNA sequence of DNA-PKcs from various species reveals a number of highly conserved SQ/TQ motifs, including one, threonine 3950 (T3950) in the human sequence (accession numbers NP_008835 and P78527), that is conserved from humans to the slime mold Dictyostelium discoideum (2) (Fig. 1). Interestingly, T3950 is located in the protein kinase domain of DNA-PKcs, suggesting that phosphorylation of this site could be important for regulating the protein kinase activity of DNA-PKcs.
|
DNA-PKcs, along with ATM, ATR, and mTOR, is a member of a subgroup of the "atypical" eukaryotic protein kinase family, called the phosphatidylinositol 3-kinase-like protein kinases (PIKKs) (24). Although the PIKKs are serine/threonine protein kinases, their active sites bear significant amino acid similarity to the catalytic subunit of phosphoinositide 3-kinase, PI3K. The class I PI3Ks are composed of a catalytic subunit, p110, and a regulatory subunit, either p85 or p101. Although PI3K is a lipid kinase (i.e., it phosphorylates phosphatidylinositides), all members of the class I family of PI3Ks have serine/threonine protein kinase activity and undergo autophosphorylation on serine residues in vitro (9, 10, 36). Interestingly, autophosphorylation of PI3K results in loss of lipid kinase activity as well as loss of protein kinase activity, and thus, in this respect, PI3K is similar to DNA-PKcs (10, 36). In the case of the PI3K catalytic subunit, autophosphorylation occurs at C-terminal serines that are outside of the catalytic domain (9, 36). The autophosphorylation sites in DNA-PKcs that are responsible for loss of protein kinase activity are not known.
By comparing the amino acid sequence of DNA-PKcs with that of the p110 subunit of PI3K, we observed that a highly conserved potential phosphorylation site, T3950, lies downstream of the DXXXXN and DXG motifs that are conserved in the kinase domain of the p110 subunit of PI3K and most eukaryotic protein kinases (Fig. 1B). This prompted us to ask whether this site could be important for regulation of the protein kinase activity of DNA-PK. Here, we show that T3950 is an in vitro autophosphorylation site and that T3950 as well as multiple sites within the previously identified ABCDE cluster is phosphorylated in vivo in response to ionizing radiation (IR). Moreover, we show that replacement of T3950 with aspartic acid abrogates V(D)J recombination and results in radiation sensitivity. Our data suggest that T3950 plays an important role in the function of DNA-PK.
| MATERIALS AND METHODS |
|---|
|
|
|---|
N mutant are
N top (GGCCGCATGGTTCCTGAGGTGTATAC) and
N bottom (CGTACCAAGGACTCCACAT). Construction and transfection of expression plasmids. Construction of the wild-type human DNA-PKcs expression vector (32) and expression vectors encoding mutant ABCDE>ala, mutant PQR>ala, and the combined ABCDE+PQR>ala mutant (for brevity termed AP>ala) has been described previously (8, 11). The expression plasmids encoding the T>ala and T>asp phosphorylation site mutants were generated by overlap extension using PCR as described previously for generating an ATP binding site DNA-PKcs mutant (19). To construct the combined mutant ABCDE+PQR+T (for brevity termed APT>ala), a fragment spanning nucleotides 11145 to 12384 from the T>ala expression plasmid (unique Eco721 site and Xma site in the cloning cassette) was subcloned into the ABCDE+PQR>ala expression plasmids.
To construct the
N expression construct, 1,289 nucleotides from the 5' end of the DNA-PKcs cDNA were deleted via digestion with SnaI (unique site at position 1289, just prior to the start of exon 13) and NotI (cloning cassette) and replaced with annealed oligonucleotides
N top and
N bottom. These oligonucleotides introduce a methionine just N-terminal to the valine and proline residues encoded at the start of exon 13. Thus, the
N construct encodes human DNA-PKcs with a 426-amino-acid, N-terminal deletion.
Generation of a threonine 3950 phosphospecific antibody. A phosphospecific antibody recognizing DNA-PKcs phosphorylated on T3950 was raised in rabbits against the peptide FGSA(pT)QFLPVK. The residue in parentheses corresponds to the phosphorylated threonine. The peptide was conjugated to bovine serum albumin and keyhole limpet hemocyanin, and phosphospecific antibodies were raised and purified as described previously (14).
Cell lines, survival assays, and V(D)J recombination assays. Culture conditions for the human lymphoblastoid cell line BT (also called C3ABR) have been described previously (12). Derivation of V3 DNA-PKcs transfectants, culturing of V3 cells, immunoblot screening, clonogenic survival assays, and extrachromosomal V(D)J recombination assays were performed as described previously (11).
DNA-PK microfractionation, measurement of protein kinase activity, and autophosphorylation assays. DNA-PK microfractionation and assessment of enzymatic activity in V3 cell extracts by "pull-down" assays have been described previously (11). To assess in vivo phosphorylation of T3950, a human lymphoblastoid cell line (BT) was incubated for 2 h in medium containing okadaic acid (OA; 1 µM), camptothecin (10 µM), or etoposide (10 µM) or exposed to IR (10 Gy) and harvested after 2 h of recovery. Whole-cell extracts were enriched for DNA-PK using single-stranded DNA (ssDNA) cellulose resin as described previously (14) and then immunoblotted with either a polyclonal antibody to DNA-PKcs or the DNA-PKcs T3950 phosphospecific antibody.
Purification of recombinant human DNA-PKcs from V3 cells. Recombinant human DNA-PKcs was purified from 6 to 12 liters of V3 cells expressing ABCDE>ala, AP>ala, or APT>ala mutant DNA-PKcs as described in reference 3, except that the DNA-PKcs-containing fractions from the DEAE column were fractionated on a heparin Hi-Trap column instead of ssDNA cellulose. Wild-type DNA-PKcs was purified from HeLa cells as described previously (17).
Partial purification of DNA-PK from unirradiated and irradiated human cells. Human HEK293 cells were grown in suspension in Pro293 medium (Cambrex Bioscience) supplemented with 5% fetal calf serum, 100 units/ml penicillin, and 100 units/ml streptomycin until they reached a density of approximately 1 x 107 cells/ml. For partial purification of DNA-PKcs, approximately 6 liters of cells was either untreated or irradiated with 10 Gy of IR and then harvested and lysed in the presence of protease inhibitors (Complete protease inhibitor; Roche) and the protein phosphatase inhibitor (1 µM microcystin-LR). S10 and P10 extracts were prepared as described previously (17) and then combined to make a whole-cell extract. The total amount of protein in the combined extract was, in both cases, approximately 2 g. The whole-cell extract was dialyzed against TB buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 5% [vol/vol] glycerol) containing 75 mM KCl (TB 75), 0.1 mM dithiothreitol, and protease and phosphatase inhibitors as above, plus 0.2 mM phenylmethylsulfonyl fluoride. The sample was loaded onto a 50-ml DEAE Sepharose column (GE Healthcare) preequilibrated in TB 75, and the column was washed in TB 75 buffer until the A280 was less than 0.03. Proteins were then eluted using TB containing 175 mM salt (TB 175). DNA-PKcs-containing fractions were dialyzed into TB 100, and 0.02% (vol/vol) Tween 20 was added to the sample before it was loaded onto a 5-ml Hi-Trap heparin column (GE Healthcare) preequilibrated in TB 100 buffer containing 0.02% Tween 20. Proteins were eluted with a linear gradient of TB containing 100 mM salt to TB containing 750 mM salt (both containing 0.02% Tween 20) over 75 ml, 2-ml fractions were collected, and DNA-PKcs-containing fractions were identified by Western blotting. The identity of DNA-PKcs was also confirmed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MS) fingerprinting (data not shown). Approximately 0.5 µg of total protein was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis followed by Western blot analysis using the phosphospecific antibody to T3950 as well as the phosphospecific antibodies described in reference 14. Phosphospecific antibodies were incubated with blots in the presence of dephospho- or phosphopeptide (10 µg/ml) as indicated. Identical blots were run for total DNA-PKcs. Phosphorylation at serine 2056 was detected using a commercially available phosphospecific antibody (Abcam, ab18192) at 1:200 dilution overnight.
To quantitate in vivo phosphorylation, known amounts of DNA-PKcs purified from irradiated cells were analyzed by Western blotting with known amounts of in vitro-phosphorylated DNA-PKcs. Blots were probed with each phosphospecific antibody or an antibody (DPK1) to total DNA-PKcs. Western blots were scanned and the signal quantitated using Quantity One software (Bio-Rad).
Immunoprecipitation assays for kinase dissociation and inactivation. DNA-PKcs and Ku were purified from HeLa cells as described previously (17). Purified wild-type, ABCDE>ala, AP>ala, or APT>ala mutant DNA-PKcs (2.5 µg) was incubated with purified Ku (1.25 µg); 10 mM MgCl2; and either no ATP, 0.25 mM ATP, or 0.25 mM AMP-PNP at 30°C for 1 h. Immunoprecipitation reactions were carried out at 4°C for 2 h, using 5 µl of a mouse polyclonal antibody to Ku80 that had been preincubated with protein G Sepharose (GE Healthcare) in phosphate-buffered saline buffer containing 0.5% (vol/vol) NP-40. Immunoprecipitates were gently washed five times each with 200 µl of phosphate-buffered saline containing 0.5% NP-40 and immunoblotted for DNA-PKcs as previously described.
Mass spectrometry. Phosphorylation site analysis of DNA-PKcs was performed on a 4000 Q-Trap mass spectrometer using multiple reaction monitoring as described by Unwin et al. (35). Multiple reaction monitors were constructed for the phosphopeptides described previously (14) using the MIDAS software program (Applied Biosystems, Foster City CA) by selecting the doubly and triply charged ions for each phosphopeptide precursor with the neutral loss of phosphoric acid as the reporter. Tryptic digests of DNA-PKcs were analyzed by liquid chromatography (LC)-MS on a Dionex Ultimate nano-high-pressure LC system fitted with a PepMap C18 (0.075- x 150-mm) column coupled to the 4000 Q-Trap mass spectrometer as described previously (38). All tandem MS (MS/MS) spectra were searched against a database using an in-house Mascot (Matrixscience, United Kingdom) server, and the sequence of phosphopeptides was validated by manual inspection of the MS/MS spectra using the Analyst software package (MDS-Sciex, Toronto, Canada).
| RESULTS |
|---|
|
|
|---|
isoform of the p110 subunit of porcine PI3K, for which a high-resolution structure is available (37). The activation segment of porcine p110
begins after the DFG sequence proximal to alpha-helix k-ß-5 and extends to a TPD motif that occurs at the start of the alpha-helix k-
-7 (37). The TPD motif loosely matches the canonical APE motif in the eukaryotic protein kinase family, as glutamate (E) and aspartate (D) are both acidic amino acids, while alanine (A) and threonine (T) both have small uncharged amino acid side chains. Thus, T3950 resides in a region of the catalytic domain of DNA-PKcs that is similar to the activation loop of members of the typical protein kinase family. The high degree of conservation of this putative phosphorylation site across diverse species suggests that phosphorylation of T3950 could be important for the function of DNA-PKcs. Threonine 3950 is autophosphorylated in vitro. In order to determine whether T3950 is a target of DNA-PK phosphorylation, a phosphospecific antibody was generated to a phosphopeptide containing the region of DNA-PKcs encompassing T3950. To characterize the antibody, increasing amounts of the antigenic (phosphorylated) peptide or the corresponding nonphosphorylated peptide were spotted onto nitrocellulose and probed with the threonine 3950 phosphospecific antibody (pThr3950). Whereas the antibody detected the antigenic peptide, it did not recognize the nonphosphorylated peptide (Fig. 2A). Furthermore, addition of the antigenic peptide to the phosphospecific antibody during immunoblotting prevented the recognition of the antigenic peptide, whereas the unphosphorylated peptide did not prevent antibody recognition of the antigenic peptide (Fig. 2A). Thus, the antibody recognizes phosphorylated but not nonphosphorylated T3950.
|
Threonine 3950 is phosphorylated in vivo in response to DNA damage. To determine whether threonine 3950 is phosphorylated in vivo, human lymphoblastoid cells (BT) were either untreated or treated with OA, IR, camptothecin, or etoposide. Whole-cell extracts were enriched for DNA-PK using ssDNA cellulose resin and then immunoblotted with either the DNA-PKcs T3950 phosphospecific antibody (Fig. 3A, upper panels) or a polyclonal antibody to DNA-PKcs (Fig. 3A, lower panel). Whereas OA induced the phosphorylation of DNA-PKcs at T3950, phosphorylation at T3950 was not detected in this assay when cells were treated with various DNA-damaging agents (Fig. 3A). These results are therefore similar to those reported by our group previously for in vivo phosphorylation at the ABCDE cluster (14). We have speculated that this may be due to the small fraction of the total DNA-PKcs that is phosphorylated at DSBs in response to DNA damage (14). In contrast, others have observed that DNA damage induced phosphorylation of DNA-PKcs at threonines 2609, 2638, and 2647 (5, 7, 40). In order to reconcile these differences, we partially purified DNA-PKcs from HEK293 cells that had either been irradiated or not and analyzed the purified protein using mass spectrometry and/or Western blot assays using phosphospecific antibodies. We show that T3950 as well as threonines 2609, 2620, 2638, and 2647 and serines 2612 and 2624 are all phosphorylated in vivo in response to IR (Fig. 3B). Using LC-MS/MS we confirmed that threonine 2638 and serine 3205 are phosphorylated in vivo in irradiated cells (see Fig. S1A and S1B in the supplemental material). By comparing the signal in Western blot assays with known amounts of in vitro-phosphorylated DNA-PKcs, the stoichiometry of phosphorylation at each site was estimated to be approximately 0.2 ng phosphate per ng protein (see Fig. S2 in the supplemental material).
|
Phosphorylation of threonine 3950 is functionally critical in living cells. We next generated expression constructs encoding DNA-PKcs with alanine or aspartic acid substitutions for T3950 (termed T>ala and T>asp, respectively) and expressed them in the DNA-PKcs-deficient cell line V3. Both the alanine- and aspartic acid-substituted DNA-PKcs mutants are stably expressed at similar levels in V3 cells (Fig. 4A). We next assayed for DNA-PK kinase activity in extracts from V3 cells expressing wild-type DNA-PKcs, T>ala, or T>asp. Whereas extracts from V3 cells expressing the T>ala substitution contain robust DNA-PK protein kinase activity, DNA-PK activity is minimal in extracts from cells expressing the T>asp substitution (Fig. 4B). Thus, although T3950 is not critical for DNA-PK activity, mutation of T3950 to an acidic amino acid ablates kinase activity. Since aspartic acid is negatively charged and thus can be considered a phosphomimic, these data suggest that dephosphorylation of T3950 could be important for DNA-PK activity.
|
|
N). Two recent reports suggest that the N terminus is critical for the ability of DNA-PKcs to interact with DNA. First, Llorca and colleagues have provided informative low-resolution structures of DNA-PKcs revealing that most DNA-protein contacts involve the N-terminal "palm" domain of DNA-PKcs (4, 31, 34). Additionally, recent data from one of our laboratories are consistent with these structural data in that mutation of the leucine-rich repeat region of DNA-PKcs (in the palm domain) partially disrupts its affinity for DNA (18). We therefore reasoned that the
N deletion might prevent DNA-PK from stably interacting with DNA, thus proving that specific DNA binding activity lies outside the PI3K domain of DNA-PKcs and suggesting that the DNA cellulose binding of the T>asp mutant is a specific DNA binding event. Although the
N mutant is stably expressed in V3 cells, it has no detectable affinity for DNA cellulose (Fig. 5A) and does not complement the radiosensitive phenotype of V3 cells (Fig. 5B). These data provide additional support for the conclusion that the N-terminal palm domain interacts with DNA. Further, since the
N mutant contains roughly 90% of DNA-PKcs's coding sequence but clearly does not fractionate with DNA-cellulose, we conclude that it is unlikely that the affinity of the T>asp mutant for DNA cellulose is an artifact of its ability to interact with DNA in the absence of Ku.
|
Blocking phosphorylation of the ABCDE, PQR, and t-loop sites does not prevent kinase dissociation. We next constructed another DNA-PKcs mutant that includes alanine substitutions at all six ABCDE sites, the five PQR sites, and S3205 as well as T3950. For brevity, this mutant is termed APT>ala (ABCDE+PQR+T>ala). This construct was stably introduced into V3 cells, and high-level-expressing clones were isolated (Fig. 6A). We previously studied another mutant combining all of these sites except T3950>ala (8). For brevity, this mutant (previously called ABCDE+PQR>ala) is termed AP>ala. Functional analyses of cells expressing the APT>ala mutant revealed radiosensitivity similar to that of cells expressing the AP>ala combined mutant (Fig. 6B). Further, DNA cellulose "pull-down" assays reveal that the DNA-PK activity of AP>ala and APT>ala is similar to that of wild-type DNA-PKcs (Fig. 6C). Thus, the effect of mutation of T3950 to alanine in the context of the ABCDE and PQR mutations is similar to that of mutation of ABCDE and PQR alone. This is consistent with our previous finding that mutation of the PQR cluster partially alleviates the effects of mutation of the ABCDE cluster (8). Also, we note that DNA-PKcs in which 13 amino acids, including T3950, have been mutated to alanine still retains full protein kinase activity. These data suggest that incorporation of multiple mutations does not adversely affect the structure of DNA-PKcs.
|
|
Interestingly, DNA-PKcs in which all 13 sites had been mutated to alanine was still phosphorylated to approximately 40% of the wild-type level, suggesting that there are additional in vitro autophosphorylation sites yet to be identified and characterized (see Fig. S5 in the supplemental material).
| DISCUSSION |
|---|
|
|
|---|
The strong conservation of T3950 between DNA-PKcs sequences from humans to slime molds suggested to us that this amino acid could be important for the function of DNA-PKcs. Mutation of T3950 to alanine had no effect on the protein kinase activity of DNA-PKcs and had only modest effects on DNA-PK function in vivo, suggesting that phosphorylation of T3950 is not required for the activity or function of DNA-PK. However, replacement of T3950 with an acidic amino acid (aspartic acid) resulted in loss of protein kinase activity and severe defects in both NHEJ and V(D)J recombination. Since aspartic acid is commonly used as a phosphomimic, these results suggest that dephosphorylation of DNA-PKcs at T3950 could be required for DNA-PK activity and function. However, another interpretation of our results is that a nonacidic amino acid at position T3950 is essential for the function of DNA-PKcs. Whether autophosphorylation of T3950 plays a role in removal of the putative activation loop from the catalytic site as has been demonstrated for many serine/threonine protein kinases (28) awaits to be seen and will likely require a high-resolution structure of DNA-PKcs or a related PIKK. Neither ATM, ATR, mTOR, nor SMG1 contains a conserved SQ/TQ motif in the putative activation loop sequence (2); therefore, phosphorylation at this site appears to be unique to DNA-PKcs. Regardless of whether DNA-PKcs has a t-loop or not, our results clearly show that T3950 plays an important role in the function of DNA-PKcs.
We previously identified two clusters of phosphorylation sites in DNA-PKcs (ABCDE and PQR) that regulate DNA end processing and DNA repair pathway choice in a reciprocal manner (11). At a biochemical level, mutation of either the ABCDE cluster or the PQR cluster to alanine does not affect the protein kinase activity of DNA-PK or the ability of DNA-PK to undergo phosphorylation-induced inactivation. We have previously shown using electrophoretic mobility shift assays that the ABCDE>ala mutant has a slight defect in ATP-induced dissociation (11, 30). The dissociation defect was more apparent in the current study, possibly because here we used an immunoprecipitation assay which was carried out without the presence of protein cross-linker, whereas in previous studies, glutaraldehyde was used to stabilize protein-DNA complexes in electrophoretic mobility shift assays (11, 30). Thus, phosphorylation of the ABCDE cluster may play a greater role in the phosphorylation-induced dissociation of DNA-PKcs than was previously thought. Mutation of T3950 to alanine did not affect DNA-PK protein activity, and DNA-PKcs containing mutations at ABCDE, PQR, and T3950 phosphorylation sites still underwent ATP-induced inactivation and dissociation of the DNA-PKcs from Ku in vitro. In keeping with our previous results, mutation of PQR (with or without the T3950>ala mutation) relieved the effects of the ABCDE>ala mutant on dissociation. Finally, DNA-PKcs in which all 13 identified phosphorylation sites (including T3950) were mutated to alanine (APT>ala) was still phosphorylated in vitro to approximately 40% of the wild-type level, indicating that additional autophosphorylation sites may be required for inactivation and complete dissociation of DNA-PK in vitro. Indeed, Lieber and colleagues have identified three additional in vitro DNA-PK autophosphorylation sites, serines 3821 and 4026 and threonine 4102; however, their biological significance is not known (23).
Several residues in the ABCDE cluster (T2609, T2638, and 2647) have been shown to be phosphorylated in vivo in response to IR and/or UV radiation (5, 7, 40). Here we provide direct evidence that additional sites in the ABCDE cluster (S2612, T2620, and S2624) are also phosphorylated in vivo in irradiated cells (Fig. 3B). Our results also confirm a previous report that S3205 is phosphorylated in vivo (1). We previously showed that the ABCDE sites (S2612, T2609, T2638, and 2647) were phosphorylated in vivo in cells that had been treated with the protein phosphatase inhibitor OA, but we had been unable to detect DNA damage-induced phosphorylation at the ABCDE sites (14). We speculate that this could be due to one of two possibilities. One is that phosphorylation at these sites is transient and the phosphate is readily removed by the action of protein phosphatases. Alternatively, if only a fraction of the total DNA-PKcs were phosphorylated, as would be expected if DNA-PKcs were only phosphorylated when bound to a DSB, then the level of phosphorylation would be below the level of detection using our phosphospecific antibodies. In this study we purified DNA-PKcs protein from irradiated cells in the continuous presence of protein phosphatase inhibitors and loaded 0.5 µg (
1 pmol) of protein on the gel. We estimate that the stoichiometry of phosphorylation was 10 to 20% for most of the ABCDE sites. Therefore, we would expect only 0.1 to 0.2 pmol of DNA-PKcs to be phosphorylated. In our previous studies, the amount of protein isolated by immunoprecipitation or DNA cellulose pull-down was less than this, perhaps explaining why we had previously been unable to detect in vivo DNA damage-induced phosphorylation at the ABCDE cluster. As reported previously by Chen et al. (7), we also show that serine 2056 in the PQR cluster is phosphorylated in vivo in response to IR in a DNA-PK-dependent manner. Therefore, serine 2056 is likely to be a true autophosphorylation site. It has recently been reported that the related protein kinase ATR can phosphorylate DNA-PKcs at threonines 2609, 2638, and 2647 in response to UV radiation (40) and that ATM may regulate phosphorylation of DNA-PKcs at threonine 2609 in response to IR (7). Whether T3950 and the additional sites in the ABCDE and PQR clusters are autophosphorylated in vivo or phosphorylated by other PIKKs remains to be determined. Regardless, what has become clear from recent studies is that autophosphorylation of DNA-PKcs is complex and likely proceeds through a variety of stages that regulate end access and pathway choice. Recent studies suggesting that DNA-PKcs may be phosphorylated at these sites by other members of the PIKK family add another level of complexity that could allow further fine-tuning of the function of DNA-PK in the cellular response to DSBs.
| ACKNOWLEDGMENTS |
|---|
We thank Graeme Smith (KuDOS Pharmaceuticals) for NU7441 and the MRC Protein Phosphorylation Unit, Dundee, for growing the HEK293 cells.
The laboratories at the Departments of Biochemistry and Molecular Biology and Oncology, University of Calgary, Calgary, Alberta, Canada, and the College of Veterinary Medicine and Department of Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, contributed equally to this work.
| FOOTNOTES |
|---|
Published ahead of print on 11 December 2006. ![]()
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Block, W. D., and S. P. Lees-Miller. 2005. Putative homologues of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) and other components of the non-homologous end joining machinery in Dictyostelium discoideum. DNA Repair (Amsterdam) 4:1061-1065.[CrossRef]
3. Block, W. D., Y. Yu, D. Merkle, J. L. Gifford, Q. Ding, K. Meek, and S. P. Lees-Miller. 2004. Autophosphorylation-dependent remodeling of the DNA-dependent protein kinase catalytic subunit regulates ligation of DNA ends. Nucleic Acids Res. 32:4351-4357.
4. Boskovic, J., A. Rivera-Calzada, J. D. Maman, P. Chacon, K. R. Willison, L. H. Pearl, and O. Llorca. 2003. Visualization of DNA-induced conformational changes in the DNA repair kinase DNA-PKcs. EMBO J. 22:5875-5882.[CrossRef][Medline]
5. Chan, D. W., B. P. Chen, S. Prithivirajsingh, A. Kurimasa, M. D. Story, J. Qin, and D. J. Chen. 2002. Autophosphorylation of the DNA-dependent protein kinase catalytic subunit is required for rejoining of DNA double-strand breaks. Genes Dev. 16:2333-2338.
6. Chan, D. W., and S. P. Lees-Miller. 1996. The DNA-dependent protein kinase is inactivated by autophosphorylation of the catalytic subunit. J. Biol. Chem. 271:8936-8941.
7. Chen, B. P., D. W. Chan, J. Kobayashi, S. Burma, A. Asaithamby, K. Morotomi-Yano, E. Botvinick, J. Qin, and D. J. Chen. 2005. Cell cycle dependence of DNA-PK phosphorylation in response to DNA double strand breaks. J. Biol. Chem. 280:14709-14715.
8. Cui, X., Y. Yu, S. Gupta, Y. M. Cho, S. P. Lees-Miller, and K. Meek. 2005. Autophosphorylation of DNA-dependent protein kinase regulates DNA end processing and may also alter double-strand break repair pathway choice. Mol. Cell. Biol. 25:10842-10852.
9. Czupalla, C., M. Culo, E. C. Muller, C. Brock, H. P. Reusch, K. Spicher, E. Krause, and B. Nurnberg. 2003. Identification and characterization of the autophosphorylation sites of phosphoinositide 3-kinase isoforms beta and gamma. J. Biol. Chem. 278:11536-11545.
10. Dhand, R., I. Hiles, G. Panayotou, S. Roche, M. J. Fry, I. Gout, N. F. Totty, O. Truong, P. Vicendo, K. Yonezawa, et al. 1994. PI 3-kinase is a dual specificity enzyme: autoregulation by an intrinsic protein-serine kinase activity. EMBO J. 13:522-533.[Medline]
11. Ding, Q., Y. V. Reddy, W. Wang, T. Woods, P. Douglas, D. A. Ramsden, S. P. Lees-Miller, and K. Meek. 2003. Autophosphorylation of the catalytic subunit of the DNA-dependent protein kinase is required for efficient end processing during DNA double-strand break repair. Mol. Cell. Biol. 23:5836-5848.
12. Douglas, P., S. Gupta, N. Morrice, K. Meek, and S. P. Lees-Miller. 2005. DNA-PK-dependent phosphorylation of Ku70/80 is not required for non-homologous end joining. DNA Repair (Amsterdam) 4:1006-1018.
13. Douglas, P., G. B. Moorhead, R. Ye, and S. P. Lees-Miller. 2001. Protein phosphatases regulate DNA-dependent protein kinase activity. J. Biol. Chem. 276:18992-18998.
14. Douglas, P., G. P. Sapkota, N. Morrice, Y. Yu, A. A. Goodarzi, D. Merkle, K. Meek, D. R. Alessi, and S. P. Lees-Miller. 2002. Identification of in vitro and in vivo phosphorylation sites in the catalytic subunit of the DNA-dependent protein kinase. Biochem. J. 368:243-251.[CrossRef][Medline]
15. Drouet, J., C. Delteil, J. Lefrancois, P. Concannon, B. Salles, and P. Calsou. 2005. DNA-dependent protein kinase and XRCC4-DNA ligase IV mobilization in the cell in response to DNA double strand breaks. J. Biol. Chem. 280:7060-7069.
16. Errami, A., D. M. He, A. A. Friedl, W. J. Overkamp, B. Morolli, E. A. Hendrickson, F. Eckardt-Schupp, M. Oshimura, P. H. Lohman, S. P. Jackson, and M. Z. Zdzienicka. 1998. XR-C1, a new CHO cell mutant which is defective in DNA-PKcs, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res. 26:3146-3153.
17. Goodarzi, A. A., and S. P. Lees-Miller. 2004. Biochemical characterization of the ataxia-telangiectasia mutated (ATM) protein from human cells. DNA Repair (Amsterdam) 3:753-767.[CrossRef]
18. Gupta, S., and K. Meek. 2005. The leucine rich region of DNA-PKcs contributes to its innate DNA affinity. Nucleic Acids Res. 33:6972-6981.
19. Kienker, L. J., E. K. Shin, and K. Meek. 2000. Both V(D)J recombination and radioresistance require DNA-PK kinase activity, though minimal levels suffice for V(D)J recombination. Nucleic Acids Res. 28:2752-2761.
20. Kurimasa, A., S. Kumano, N. V. Boubnov, M. D. Story, C. S. Tung, S. R. Peterson, and D. J. Chen. 1999. Requirement for the kinase activity of human DNA-dependent protein kinase catalytic subunit in DNA strand break rejoining. Mol. Cell. Biol. 19:3877-3884.
21. Lees-Miller, S. P., and K. Meek. 2003. Repair of DNA double strand breaks by non-homologous end joining. Biochimie 85:1161-1173.[Medline]
22. Lees-Miller, S. P., K. Sakaguchi, S. J. Ullrich, E. Appella, and C. W. Anderson. 1992. Human DNA-activated protein kinase phosphorylates serines 15 and 37 in the amino-terminal transactivation domain of human p53. Mol. Cell. Biol. 12:5041-5049.
23. Ma, Y., U. Pannicke, H. Lu, D. Niewolik, K. Schwarz, and M. R. Lieber. 2005. The DNA-dependent protein kinase catalytic subunit phosphorylation sites in human Artemis. J. Biol. Chem. 280:33839-33846.
24. Manning, G., D. B. Whyte, R. Martinez, T. Hunter, and S. Sudarsanam. 2002. The protein kinase complement of the human genome. Science 298:1912-1934.
25. Meek, K., S. Gupta, D. A. Ramsden, and S. P. Lees-Miller. 2004. The DNA-dependent protein kinase: the director at the end. Immunol. Rev. 200:132-141.[CrossRef][Medline]
26. Meek, K., L. Kienker, C. Dallas, W. Wang, M. J. Dark, P. J. Venta, M. L. Huie, R. Hirschhorn, and T. Bell. 2001. SCID in Jack Russell terriers: a new animal model of DNA-PKcs deficiency. J. Immunol. 167:2142-2150.
27. Merkle, D., P. Douglas, G. B. Moorhead, Z. Leonenko, Y. Yu, D. Cramb, D. P. Bazett-Jones, and S. P. Lees-Miller. 2002. The DNA-dependent protein kinase interacts with DNA to form a protein-DNA complex that is disrupted by phosphorylation. Biochemistry 41:12706-12714.[CrossRef][Medline]
28. Nolen, B., S. Taylor, and G. Ghosh. 2004. Regulation of protein kinases; controlling activity through activation segment conformation. Mol. Cell 15:661-675.[CrossRef][Medline]
29. O'Neill, T., A. J. Dwyer, Y. Ziv, D. W. Chan, S. P. Lees-Miller, R. H. Abraham, J. H. Lai, D. Hill, Y. Shiloh, L. C. Cantley, and G. A. Rathbun. 2000. Utilization of oriented peptide libraries to identify substrate motifs selected by ATM. J. Biol. Chem. 275:22719-22727.
30. Reddy, Y. V., Q. Ding, S. P. Lees-Miller, K. Meek, and D. A. Ramsden. 2004. Non-homologous end joining requires that the DNA-PK complex undergo an autophosphorylation-dependent rearrangement at DNA ends. J. Biol. Chem. 279:39408-39413.
31. Rivera-Calzada, A., J. D. Maman, L. Spagnolo, L. H. Pearl, and O. Llorca. 2005. Three-dimensional structure and regulation of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). Structure 13:243-255.[Medline]
32. Shin, E. K., T. Rijkers, A. Pastink, and K. Meek. 2000. Analyses of TCRB rearrangements substantiate a profound deficit in recombination signal sequence joining in SCID foals: implications for the role of DNA-dependent protein kinase in V(D)J recombination. J. Immunol. 164:1416-1424.
33. Soubeyrand, S., L. Pope, B. Pakuts, and R. J. Hache. 2003. Threonines 2638/2647 in DNA-PK are essential for cellular resistance to ionizing radiation. Cancer Res. 63:1198-1201.
34. Spagnolo, L., A. Rivera-Calzada, L. H. Pearl, and O. Llorca. 2006. Three-dimensional structure of the human DNA-PKcs/Ku70/Ku80 complex assembled on DNA and its implications for DNA DSB repair. Mol. Cell 22:511-519.[CrossRef][Medline]
35. Unwin, R. D., J. R. Griffiths, M. K. Leverentz, A. Grallert, I. M. Hagan, and A. D. Whetton. 2005. Multiple reaction monitoring to identify sites of protein phosphorylation with high sensitivity. Mol. Cell. Proteomics 4:1134-1144.
36. Vanhaesebroeck, B., K. Higashi, C. Raven, M. Welham, S. Anderson, P. Brennan, S. G. Ward, and M. D. Waterfield. 1999. Autophosphorylation of p110-delta phosphoinositide 3-kinase: a new paradigm for the regulation of lipid kinases in vitro and in vivo. EMBO J. 18:1292-1302.[CrossRef][Medline]
37. Walker, E. H., O. Perisic, C. Ried, L. Stephens, and R. L. Williams. 1999. Structural insights into phosphoinositide 3-kinase catalysis and signalling. Nature 402:313-320.[CrossRef][Medline]
38. Williamson, B. L., J. Marchese, and N. A. Morrice. 2006. Automated identification and quantification of protein phosphorylation sites by LC/MS on a hybrid triple quadrupole linear ion trap mass spectrometer. Mol. Cell. Proteomics 5:337-346.
39. Woods, T., W. Wang, E. Convery, A. Errami, M. Z. Zdzienicka, and K. Meek. 2002. A single amino acid substitution in DNA-PKcs explains the novel phenotype of the CHO mutant, XR-C2. Nucleic Acids Res. 30:5120-5128.
40. Yajima, H., K. J. Lee, and B. P. Chen. 2006. ATR-dependent phosphorylation of DNA-dependent protein kinase catalytic subunit in response to UV-induced replication stress. Mol. Cell. Biol. 26:7520-7528.
41. Zdzienicka, M. Z. 1999. Mammalian X-ray-sensitive mutants which are defective in non-homologous (illegitimate) DNA double-strand break repair. Biochimie 81:107-116.[Medline]
42. Zhao, Y., H. D. Thomas, M. A. Batey, I. G. Cowell, C. J. Richardson, R. J. Griffin, A. H. Calvert, D. R. Newell, G. C. Smith, and N. J. Curtin. 2006. Preclinical evaluation of a potent novel DNA-dependent protein kinase inhibitor NU7441. Cancer Res. 66:5354-5362.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||