This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grondin, B.
Right arrow Articles by Hoang, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grondin, B.
Right arrow Articles by Hoang, T.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, April 2007, p. 2919-2933, Vol. 27, No. 8
0270-7306/07/$08.00+0     doi:10.1128/MCB.00936-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.

c-Jun Homodimers Can Function as a Context-Specific Coactivator{triangledown}

Benoit Grondin,1 Martin Lefrancois,1 Mathieu Tremblay,1 Marianne Saint-Denis,1 André Haman,1 Kazuo Waga,3 André Bédard,4,{dagger} Daniel G. Tenen,5 and Trang Hoang1,2*

Institute of Research in Immunology and Cancer,1 Departments of Pharmacology, Biochemistry, and Molecular Biology, University of Montreal, Montréal, Québec, Canada H3C 3J7,2 Department of Hematology, Dokkyo University School of Medicine, Tochigi 321-0293, Japan,3 Department of Biology, York University, North York, Ontario, Canada M3J 1P3,4 Harvard Institutes of Medicine and Harvard Stem Cell institute, Harvard Medical School, Boston, Massachusetts 021155

Received 26 May 2006/ Returned for modification 25 July 2006/ Accepted 16 January 2007


arrow
ABSTRACT
 
Transcription factors can function as DNA-binding-specific activators or as coactivators. c-Jun drives gene expression via binding to AP-1 sequences or as a cofactor for PU.1 in macrophages. c-Jun heterodimers bind AP-1 sequences with higher affinity than homodimers, but how c-Jun works as a coactivator is unknown. Here, we provide in vitro and in vivo evidence that c-Jun homodimers are recruited to the interleukin-1ß (IL-1ß) promoter in the absence of direct DNA binding via protein-protein interactions with DNA-anchored PU.1 and CCAAT/enhancer-binding protein ß (C/EBPß). Unexpectedly, the interaction interface with PU.1 and C/EBPß involves four of the residues within the basic domain of c-Jun that contact DNA, indicating that the capacities of c-Jun to function as a coactivator or as a DNA-bound transcription factor are mutually exclusive. Our observations indicate that the IL-1ß locus is occupied by PU.1 and C/EBPß and poised for expression and that c-Jun enhances transcription by facilitating a rate-limiting step, the assembly of the RNA polymerase II preinitiation complex, with minimal effect on the local chromatin status. We propose that the basic domain of other transcription factors may also be redirected from a DNA interaction mode to a protein-protein interaction mode and that this switch represents a novel mechanism regulating gene expression profiles.


arrow
INTRODUCTION
 
Transcription is regulated at multiple steps and includes the binding of transcription factors to specific recognition sequences within the regulatory regions of target genes and most often requires the combinatorial interaction of several transcription factors. However, the molecular mechanisms linking cell-type-specific gene expression (71) to the recruitment of the basal transcriptional apparatus at core promoters and mRNA synthesis (39) remain to be ascertained. Furthermore, while specific activators have been extensively studied, it is not clear how they operate together to activate gene expression programs in response to environmental stimuli.

Macrophages are derived from bone marrow myeloid precursors and are activated by a large variety of stimuli including phorbol esters that evoke a stress-like response (57) and induce a repertoire of stress response genes that include interleukin-1ß (IL-1ß) (9, 70). Several transcription factors have been implicated in macrophage stress response. This includes c-Jun (4, 15, 35, 69), a basic leucine zipper transcription factor that can either homodimerize or heterodimerize with other members of the AP-1 family such as JunB, JunD, and c-Fos (reviewed in reference 18) and activate the expression of target genes through AP-1 binding sites (10). Although c-Jun homodimers are competent for transcription activation, it is not clear whether or not these homodimers have distinctive functions compared to heterodimers (10). The ETS transcription factor PU.1 drives the transcription of a large number of myelomonocytic genes (6, 32, 40, 42, 64) and plays essential roles in the development of myeloid and lymphoid cells (13, 28, 48, 52, 68). Finally, CCAAT/enhancer-binding protein ß (C/EBPß), a basic leucine zipper transcription factor of the C/EBP subfamily, is essential for macrophage activation and phagocytosis (75). c-Jun, PU.1, and C/EBPß have been shown to physically interact with each other (5, 27, 42) and enhance the transcription of monocyte-specific genes via binding to their respective sites on DNA (40, 50). Nonetheless, how PU.1, C/EBPß, and AP-1 govern macrophage activation and macrophage stress response remains to be documented.

The assembly of the preinitiation complex (PIC) on promoters is a rate-limiting step in transcription. Much effort has been dedicated to defining components of the PIC and their assembly on strong promoters containing multimerized high-affinity binding sites in vitro and in transfected cells. Furthermore, a large number of sequence-specific DNA binding activators have been identified, and their functional importance in gene expression and in specifying cell fate and/or homeostasis has been well documented. However, whether these activators influence the process of PIC assembly on endogenous promoters is largely unexplored in mammalian cells. Gene expression has also been linked with chromatin modification and remodeling, implicating, for example, histone H3 and H4 acetylation (46). In particular, histone tails acetylated at specific lysine residues can serve as docking sites for bromodomains and could facilitate the recruitment of bromodomain-containing proteins or complexes, e.g., the general transcription factor TFIID, to chromatin (1, 29). The formation of an enhanceosome at the interferon-ß promoter in response to viral infection provides one of the rare examples in which these mechanisms were addressed, and it was shown that the assembly of this particular multiprotein complex to the interferon-ß promoter leads to chromatin modifications, nucleosome remodeling, and PIC assembly (1, 2, 30, 44, 45). PU.1 has been shown to increase chromatin accessibility and transcription at target loci (56). However, facilitation of PIC assembly on promoters that are already poised for transcription has not been addressed. In the present study, we show that the interaction of DNA-bound PU.1 and C/EBPß recruits c-Jun as a coactivator and facilitates RNA polymerase II (Pol II) recruitment.


arrow
MATERIALS AND METHODS
 
Reagents. Antibodies for PU.1 (sc-352), C/EBPß (sc-150X), c-Jun (sc-044X or sc-1694X), and c-Fos (sc-52X) were from Santa Cruz Biotechnologies. Antibodies directed against the largest subunit of the RNA Pol II (antibody MMS-126R) or against the hemagglutinin (HA) epitope (antibody MMS-101R) in ascites fluids were obtained from Covance; anti-acetyl-histone H3 antibody was from Upstate; rabbit immunoglobulins G (IgGs) and tetradecanoyl phorbol acetate (TPA) were from Sigma. Recombinant c-Jun purified from Escherichia coli and in vitro transcription/translation reagents were obtained from Promega. Magnetic resins coupled with streptavidin were obtained from Dynal Biotech; biotinylated-conjugated nucleotides and DNase I (Amplification Grade) were from Invitrogen; poly(dI-dC)·poly(dI-dC) was from GE Healthcare. The Pwo DNA polymerase was from Roche. The Sequenase, version 2.0, DNA sequencing kit was from USB.

Tissue culture. The erythro-monocytic TF-1 cell line (31) was a kind gift from Kitamura (DNAX, Palo Alto, CA). The cells were maintained in Iscove's modified Dulbecco's medium (IMDM; Gibco/Invitrogen) supplemented with fetal calf serum (FCS; 10%) and granulocyte-macrophage colony-stimulating factor (200 pmol/liter) and were passaged every 48 h at a concentration of 1.5 x 105/ml in nonadherent culture dishes. The RAW 264.7 monocytic cell line was maintained in IMDM-10% inactivated FCS and passaged 1:4 to 1:5 to maintain 75 to 80% confluence in Falcon adherent tissue culture dishes. COS-7 cells and F9 embryonic carcinoma cells maintained in IMDM containing 10% FCS were passaged three times weekly (in gelatin-coated dishes for F9 cells).

TPA induction experiments. RAW or TF-1 cells were incubated for 4 h or 24 h, respectively, in the presence of TPA (22, 25). Granulocyte-macrophage colony-stimulating factor (200 pM) was also added to TF-1 cells. TF-1 cells were transferred to adherent tissue culture dishes during TPA treatment for selection of adherent differentiated TF-1 cells with macrophage-like phenotypes. After TPA treatment, TF-1 differentiated or RAW adherent cells were harvested and subjected to lysis according to the different experimental protocols.

Plasmid constructs. An IL-1ß promoter fragment linked to the chloramphenicol acetyltransferase gene and containing 4.4-kb upstream sequences of the human IL-1ß gene was generously provided by John Hiscott (Lady Davis Institute for Medical Research, Montreal, Canada) and was used as a template to generate luciferase reporter constructs. The IL-1ß131 construct contains sequences extending from –131 to +11 bp (–131/+11 fragment) of the IL-1ß promoter cloned in the promoterless luciferase reporter vector pXPII from a HindIII- and BglII-digested PCR fragment (sequence underlined) that was amplified with the oligonucleotides IL-1P-302 (5'-TGAAGCTTGGTACCTAACGTGGGAAAATCC-3') and IL-1P-+11 (5'-AAGCTTAGATCTAGAGGTTTGGTATCTG-3'). Mutagenesis of the PU.1 site at position –45 (relative to the underlined G in the core AGAA on the minus strand) and of the C/EBPß site at –90 (relative to the underlined T in TTGTGAAAT of the plus strand) of the –131/+11 promoter fragment created the m45 and m90 templates, respectively. These were generated by overlapping PCR mutagenesis using the following mutated oligonucleotides: for m45, 5'-TCAGCCTCCTACTTAGGCTTTTGAAAGCTA-3' and reverse; for m90, 5'-TAACTTGACCGTGAATTCAGGTATTCAACAG-3' and reverse. The underlined residues indicate the positions of the core ETS motif and C/EBP site at the –45 and –90 region, respectively, while residues in bold are mutations. The PU.1 –45 and C/EBP –90 double mutant (dm) form of IL-1ß131 was generated by overlapping PCR mutagenesis of IL-1ß131 mutated at the –45 PU.1 site with the mutated oligonucleotide for the –90 C/EBP site. All of the IL-1ß131 promoters cloned in pXPII were subcloned as BamHI/XbaI fragments (XbaI site in the 5' end of the luciferase reporter gene) into the BamHI and XbaI sites of pBluescript to generate biotinylated IL-1ß131 templates (see below). The murine PU.1 cDNA was PCR amplified with EcoRI-containing primers and subcloned as an EcoRI fragment in the murine stem cell virus (MSCV) expression vector (MSCV-PU.1). Murine PU.1 as an EcoRI fragment was subcloned into the EcoRI site of the pSG5-modified vector p513 (SV40-PU.1, where SV40 is simian virus 40). Human PU.1 cloned into the EcoRI/BamHI site of pGBT9 was transferred as a GAL4 DNA binding domain (DBD) fusion DNA fragment into the HindIII/BamHI sites of pcDNA3 (mammalian expression vector GAL4DBD-PU.1). The 5xGAL4UAS-tk109-luciferase reporter construct (five GAL4 binding sites upstream of 109 bp of the thymidine kinase promoter in pXP2-based luciferase reporter vector); the mammalian expression vector for ß-galactosidase (CMV-ßGal, where CMV is cytomegalovirus); and the mammalian SV40-driven expression vectors for murine c-Jun in its wild-type (wt) form, deleted from amino acids (aa) 251 to 276 (a deletion of the basic domain [{Delta}B]; aa 257 to 282 in human c-Jun according to reference 8), deleted from aa 6 to 194 (a deletion of the transactivation domain[{Delta}TD]), or the S63A/S73A double point mutation mutant (c-JunAA) were obtained from Mona Nemer (IRCM, Montreal, Quebec, Canada). The murine C/EBPß expression vector (murine sarcoma virus C/EBPß) obtained from Alan D. Friedman (Johns Hopkins University, Baltimore, MD) was used to subclone C/EBPß as an EcoRI/XhoI fragment into the mammalian expression vector pCI (CMV-C/EBPß). Expression vectors driven by the SV40 enhancer for wt human c-Jun, c-Fos, JunB, and JunD cDNAs were gifts of Michael Karin (University of California, San Diego, CA). cDNAs for human c-Jun containing point mutations in the basic or leucine zipper domains were obtained from Dirk Bohmann (University of Rochester, Rochester, NY). Human wt c-Jun or point mutation mutants (as described in references 8 and 59) were HA tagged at their C terminus as described previously (76) before transfer into a human ubiquitin C promoter-driven expression vector (79) (these were named c-JunHA or mutHA). The c-JunHA vector was used to generate the point mutation mutants R270I/N271D (M13) or C278D/R279I (M14b) by PCR with the oligonucleotides GAGGAAGCGCATGATCGACCGCATCGCTGCCTCC (and reverse; mutated nucleotides are in bold) or CGCATCGCTGCCTCCAAGGACATAAAAAGGAAGCTGGAGAGAA (and reverse; mutated nucleotides are in bold), respectively, using the Pwo DNA polymerase as described previously (76). The M13 vector was then used to generate the double mutant R270I/N271D-C278D/R279I (M13-14b) as described above. Amino acid positions are as described by Bohmann and Tjian (8). All mutants were verified by DNA sequencing. The c-JunHA or mutHA fragments were also transferred in the pSG5-modified vector p514 that allows in vitro translation from a T7 promoter. The glutathione S-transferase (GST)-C/EBPß (aa 22 to 306) fusion construct was obtained from Wen-Hwa Lee (University of California, Irvine, CA), and the GST-murine PU.1 (aa 1 to 282) fusion construct was obtained from Tony Kouzarides (Wellcome Trust/Cancer Research UK Gurdon Institute, Cambridge, United Kingdom).

Transfection protocols and luciferase assays. TF-1 cells were transfected by electroporation. Cells were passaged 24 h before electroporation at a concentration of 3 x 105 cells/ml. Exponentially growing cells were then concentrated at 2.5 x 107 cells/ml and electroporated at 350 mV using a Bio-Rad electroporator with 12 µg of reporter DNA and 250 ng of CMV-ßGal used as an internal control for the experiment. The total amount of transfected DNA was 30 µg, with the balance made up of pGEM4 as a carrier DNA. Cell lysates were prepared 12 h after transfection and assayed for luciferase activity, which is expressed as relative light units after normalization for ß-Gal activity as described previously (38). For TPA induction, cells were treated immediately after electroporation with TPA or dimethyl sulfoxide alone for the indicated times. F9 cells were subjected to calcium phosphate transfection, as described previously (38). F9 cells were passaged 24 h before transfection at a concentration of 1 x 104 cells/22-mm dish. The cells were transfected with 1 µg of reporter DNA, 250 ng of CMV-ßGal, and different molar ratios of the following expression vectors: MSCV-PU.1 (1 µg), CMV-C/EBPß (250 ng), SV40-c-Jun (10 to 400 ng), ubiquitin C/c-JunHA or mutHA (10, 50, or 150 ng), SV40-c-JunAA (10 ng), and SV40-Fos (10 ng). The total amount of DNA transfected was balanced with pGEM4. Cell lysates were prepared 24 h after transfection, assayed for luciferase activity, and normalized from ß-Gal activities. Rous sarcoma virus-Luc was used as an external control for all the transfections, and pXPII was also transfected as a negative control. For mammalian one-hybrid assays, F9 cells were cotransfected with combinations of expression vectors for CMV-GAL4DBD-PU.1 (3 ng), SV40-c-Jun (300 ng), SV40-c-Jun {Delta}B (300 ng), SV40-c-Jun {Delta}TD (300 ng), SV40-JunB (300 ng), and SV40-JunD (300 ng). The reporter gene used was 5xGAL4UAS-tk109-luciferase (1 µg), and transfection efficiency was normalized with the ß-Gal expression vector (250 ng). The total amount of DNA transfected was balanced with pGEM4. All transfections were performed through calcium phosphate precipitation, and cells were lysed 24 h posttransfection for luciferase and ß-Gal assays. Data shown are the averages ± standard deviations of triplicate determinations and are typical of at least three independent experiments.

Electrophoretic mobility shift assay (EMSA). A 1-µl portion of in vitro translation reaction mixtures was incubated with 20 to 50 fmol of 32P-labeled IL-1ß promoter DNA fragments (–131 to +11 from a HindIII/BglII digestion of the IL-1ß131 vector) or double-stranded oligonucleotides containing on the plus strand the sequence TTCCGGCTGACTCATCAAGC (AP-1 site is underlined) in the presence of 0.1 µg/µl double-stranded poly(dI-dC) as described previously (38). The samples were then resolved through electrophoresis on a 4% polyacrylamide gel (bisacrylamide:acrylamide at a 1:19 ratio) in 0.25x TBE (45 mM Tris-borate, 1 mM EDTA) buffer at 150 V at 4°C. The retarded protein complexes were then exposed to a PhosphorImager screen for visualization.

Retroviral-mediated gene transfer. TF-1 cells were engineered to stably express a c-Jun antisense construct using the MSCV (23), as described previously (36). Briefly, the entire coding region of c-Jun was cloned in the antisense orientation in the MSCV retroviral vector. Amphotropic viruses were produced by transient transfection into a packaging cell line (36). For retroviral infection, 1 x 106 exponentially growing TF-1 cells were presensitized with polybrene at 2 µg/ml for 24 h and cocultured with virus-producing cells for another 24 h. Nonadherent TF-1 cells were separated from the infected fibroblasts. A polyclonal population was analyzed 7 days after selection in G418 at 1 mg/ml.

Immobilization of biotinylated DNA promoter templates on magnetic resin. DNA promoter templates were biotinylated and immobilized on magnetic resin for the DNA pull-down assays (see below). The wt and mutant IL-1ß131 promoter fragments subcloned in pBluescript were cut at their 5' ends with BamHI or Xho, filled in with Klenow polymerase in the presence of biotin-14-dATP or biotin-14-dCTP, respectively, and complementing deoxynucleoside triphosphates (dNTPs). After biotinylation at the 5' end, the IL-1ß promoter templates were cut at their 3' ends with BglII or Xba and separated from vector fragments by agarose gel electrophoresis. The approximately 150-bp BamHI/BglII biotinylated IL-1ß fragment (IL-1ß131 short) or 300-bp Xho/Xba fragment (IL-1ß131 long) was cut from the agarose gel and purified with QN+-butanol (37). The resulting biotinylated IL-1ß131 fragments are designated IL-1ß131 wt, m45 (mutated fragment in the PU.1 –45 site), m90 (mutated fragment in the C/EBP –90 site), and dm (doubly mutated at both the –45 and –90 sites). Generation of a biotinylated TPA response element (TRE) was obtained by Klenow fill-in of the 5' overhang created after annealing of the sense AATTCTTCCGGCTGACTCATCAAGC (AP-1 site is underlined) and antisense GCTTGATGAGTCAGCCGGAAG oligonucleotides as described previously (16). Equal molar quantities of biotinylated DNA templates were than immobilized on magnetic resins conjugated with streptavidin according to the manufacturer's instructions (IL-1ß131 short and TRE; final concentration, 0.06 pmol/µl). IL-1ß131 long fragments were immobilized at 0.1x the concentration used for the short version and 32P-labeled at their 3' ends with [{alpha}-32P]dCTP with Klenow polymerase and complementing dNTPs. After labeling, the resin was washed twice with 10 mM Tris-HCl, pH 7.4, 2 M NaCl, and 20 mM EDTA and twice with 5 mM Tris-HCl, pH 7.4. Immobilized promoter templates were kept in 5 mM Tris-HCl buffer, pH 7.4, at 4°C for up to 3 months (IL-1ß131 or TRE) or 1 month (32P-labeled IL-1ß long).

DNA pull-down assay. The DNA pull-down assay was optimized from and is described in reference 20 as a DNA binding assay to immobilized promoters. Nuclear extracts (NE) from RAW cells treated with TPA or from COS-7 transfected cells were prepared as described previously (38). NE from COS cells overexpressing PU.1 (from SV40-PU.1), C/EBPß (from CMV-C/EBPß), c-Jun (from SV40-c-Jun), c-JunHA (from ubiquitin-c-JunHA or mutHA), or recombinant human c-Jun purified from E. coli were incubated with 0.3 pmol (IL-1ß131 short and TRE) or 0.015 pmol (32P-labeled IL-1ß131 long) of immobilized DNA templates in binding buffer (20 mM Tris [pH 8.0], 10% glycerol, 6.25 mM MgCl2, 5 mM dithiothreitol, 0.1 mM EDTA, 0.01% NP-40) in a final concentration of 100 mM NaCl and in the presence of 0.2 µg/µl of poly(dI-dC). Quantities of NE overexpressing C/EBPß, PU.1, c-Jun, or of purified recombinant c-Jun (150 ng) used in the assay were maintained below saturation of the DNA binding sites and optimized to allow for reproducible detection of PU.1, C/EBPß, and c-Jun assembled on immobilized IL-1ß templates by Western blotting. The concentration of COS NE was maintained constant at 0.3 µg/µl with NE obtained from untransfected COS cells in a minimum volume of 100 µl. After a mixing step, the samples were incubated by rotation for 60 to 90 min at 30°C. The resin coated with immobilized templates was then washed twice with 0.3 ml of binding buffer. The proteins bound to the immobilized templates were eluted from the templates by boiling of the beads for 5 min in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer (IL-1ß short and TRE) or subjected to DNase I treatment (32P-labeled IL-1ß131 long) as described below. Proteins in SDS-PAGE sample buffer were resolved on polyacrylamide gels and transferred to polyvinylidene difluoride membranes for Western blot analysis. Typically, 25% of each sample was used for the detection of C/EBPß and PU.1 while 50% was used for the detection of c-Jun.

ChIP. Chromatin immunoprecipitation (ChIP) assays were performed as described previously (38) with the use of 1 x 106 to 2 x 106 cross-linked TPA-treated RAW or TF-1 cells and 5 µg of anti-PU.1, anti-C/EBPß, anti-c-Jun, anti-c-Fos, anti-AcH3, or anti-RNA Pol II antibodies. Rabbit IgGs were used as a control for PU.1, C/EBPß, c-Jun, c-Fos, and acetylated-H3 antibodies while anti-HA antibodies in ascites fluid was used as a control for anti-RNA Pol II antibodies. SyberGreen real-time PCR was performed on an Mx3000 apparatus (Stratagene, La Jolla, CA) using a SYBR Green Stratagene PCR kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. The following oligonucleotides were used for amplification: for the mouse IL-1ß promoter, 5'-CCACCCTTCAGTTTTGTTGT and 5'-CCCAGATGAGCCTATTAGGCCT; for the human IL-1ß promoter, 5'-AGGTCTATAGGTGGCTGCTTAACT and 5'-TGGCTTGTTTGAAAATGTGTTAGCA; for the mouse Mmp12 promoter, 5'-CTAATGGAGTTCTG and 5'-GCAGCTCATCAACCTGTTCC; for a region of inactive chromatin in the mouse c-Kit locus at position –4191, 5'-TGTGGGGGCTCCTGGTCTTA and 5'-TAGCGGCGCGCGACAG; and for a region in the human c-Kit locus at position +13532, 5'-AGGTCTATAGGTGGCTGCTTAACT and 5'-TGGCTTGTTTGAAAATGTGTTAGCA. Forty cycles of amplification were performed, followed by cycles of denaturation and annealing steps. Amplification plots and dissociation curves were analyzed with the Mx3000p (Stratagene, La Jolla, CA) and Excel (Microsoft, Redmond, CA) software programs.

Reverse transcription-PCR. Total RNA was prepared according to Chomczynski and Sacchi's protocol (11), using tRNA as carrier for ethanol precipitation. First-strand DNA synthesis was performed as described previously (24). A total of 2 µl of cDNA sample was added to the PCR mixture containing a 1 µM concentration of each specific 5' and 3' primer, a 1 mM concentration of each dNTP, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Gibco). Primers corresponding to murine sequences are the following: S16 sense, 5'-AGGAGCGATTTGCTGGTGTGA-3'; S16 antisense, 5'-GCTACCAGGGCCTTTGAGATG-3'; S16 internal, 5' AAATTTATGCCATCCGACAGTC-3'; IL-1ß sense, 5'-CAAAATACCTGTGGCCTTGGG-3'; IL-1ß antisense, 5'-AAAACACAGGCTCTCTTTGAACAGA-3'; and IL-1ß internal, 5'-AGAAGTCAAGAGCAAAGTGG-3'. Thirty cycles of amplification were performed at a melting temperature of 55°C for S16 and 58°C for IL-1ß; 15 µl of each reaction mixture was loaded on 1% agarose gel, transferred on nylon membrane, and hybridized with the corresponding internal oligonucleotide probes. The hybridization signals were analyzed with an FLA-5000 apparatus (Fuji).

DNase I footprinting. The DNase I footprinting procedure was adapted from Sandaltzopoulos and Becker (66), using immobilized DNA templates as described above. However, the concentration of 32P-labeled IL-1ß131 templates was 20-fold less in order to allow for near maximal occupancy of the DNA binding sites. In addition, maximal amounts of poly(dI-dC) were used (0.8 µg/µl) to minimize nonspecific interactions with immobilized IL-1ß templates. After incubation of C/EBPß (COS NE), PU.1 (COS NE), and c-Jun (purified recombinant; 300 ng) with immobilized 32P-labeled IL-1ß131 templates for 90 min at 30°C, beads were washed twice in binding buffer and kept in 25 µl of binding buffer. An equal volume of DNase I diluted in binding buffer supplemented with 0.1 mg/ml bovine serum albumin, 5 mM CaCl2, 10 mM MgCl2 was added to the beads for 1 min at 22°C. The optimal quantity of DNase I used was determined empirically on naked immobilized templates (4 x 10–4 U). The reaction was stopped, and the beads were washed as described previously (66) with stop and wash buffers supplemented with 0.01% NP-40, and the beads were kept in loading buffer. A Sequenase (USB) DNA sequencing ladder was obtained with the reverse oligonucleotide CTA GAG GAT AGA ATG GCG and [{alpha}-32P]dCTP. DNase I-nicked fragments attached to the beads were eluted, denatured along with the sequencing ladder, and separated on a sequencing gel as described previously (66). The resolved 32P-labeled DNA fragments were then detected by exposure to a phosphor imager screen (FLA-5000; Fuji).

Pull-down assay. Pull-down assays were performed essentially as described previously (38). Briefly, [35S]methionine-labeled wt or mutant Jun proteins (1 to 2 µl) were incubated with 1 µg of GST, GST-PU.1, or GST-C/EBPß purified from E. coli in 250 µl of binding buffer (40 mM HEPES, pH 7.8, 50 mM KCl, 0.2 mM EDTA, 5 mM MgCl2, 0.1% Triton X-100, 10% glycerol, 1.5 mM dithiothreitol). The GST beads were preincubated with bovine serum albumin at 0.5 mg/ml for 1 h at 4°C. Bound proteins were resolved by SDS-PAGE and transferred to polyvinylidene difluoride membranes before detection and quantification by exposure to a phosphor imager screen (FLA-5000; Fuji).

Northern blot analysis. RNA extracted from cells using the acid guanidinium-phenol method and resolved by electrophoresis in 1% formaldehyde-containing agarose was transferred and blotted with a 32P-labeled IL-1ß cDNA fragment as previously described (25).


arrow
RESULTS
 
c-Jun is required to upregulate gene expression in activated macrophages. To address the mechanism through which the PU.1, C/EBPß, and AP-1 transcription factors regulate macrophage gene expression upon activation, we studied the transcription of a known target gene, IL-1ß (9, 35, 42). As illustrated here, IL-1ß mRNA production is upregulated by TPA in TF-1 cells, a precursor cell line that undergoes TPA-dependent switching to the monocytic pathway (25), and in the macrophage cell line RAW (Fig. 1A). During the time frame at which the IL-1ß mRNA is induced, PU.1 and C/EBPß protein levels remained invariant (Fig. 1B). In contrast, a TPA response gene, c-Jun, is strongly induced at both the mRNA (not shown) and protein levels (Fig. 1B). The importance of c-Jun for TPA induction of the IL-1ß gene was, therefore, directly addressed in TF-1 cells through retrovirus-mediated delivery of a c-Jun antisense construct using MSCV. As shown in Fig. 1C, this construct abrogated the induction of c-Jun protein by TPA, without affecting induction of JunD. Control cells expressing the vector alone responded to TPA, as assessed by a significant increase in c-Jun and JunD proteins and in IL-1ß mRNA levels (Fig. 1C and D). In contrast, failure to upregulate c-Jun in cells expressing the c-Jun antisense construct resulted in a significant reduction in IL-1ß mRNA at early time points (4 and 6 h) and a complete abrogation of IL-1ß mRNA levels after 18 and 48 h of TPA treatment (Fig. 1D). Conversely, ectopic c-Jun expression in TF-1 cells results in an increase of 1.85-fold ± 0.07-fold in IL-1ß gene expression by quantitative PCR (not shown). Together, these results indicate the critical role of c-Jun in driving IL-1ß expression in stress response.


Figure 1
View larger version (44K):
[in this window]
[in a new window]

 
FIG. 1. c-Jun is required for upregulated expression of the IL-1ß gene in activated macrophages. (A) TPA induces IL-1ß mRNA in TF-1 progenitor cells (Northern blotting) or RAW macrophages (reverse transcription-PCR), without affecting control mRNAs (GAPDH [glyceraldehyde-3-phosphate dehydrogenase] or S16). The cDNA template is omitted in the negative control. (B) TPA upregulates c-Jun protein, as detected by Western blot analysis of TF-1 and RAW cells, without affecting PU.1 or C/EBPß. Note that the C/EBPß isoform detected in hematopoietic cells corresponds to the protein initiated at Met22. (C) A c-Jun antisense RNA disrupts the induction of c-Jun but not JunD proteins in TF-1 cells, as assessed by Western blotting. TF-1 cells expressing the empty vector (MSCV alone) serve as controls. (D) A c-Jun antisense (AS) RNA decreases the induction of IL-1ß mRNA by TPA. Northern blots of RNA harvested at the indicated times were quantified by phosphor imaging, and the IL-1ß mRNA signal (lower panel) was normalized to that of GAPDH (not shown). MW, molecular weight; {alpha}, anti.

Synergistic collaboration between PU.1, C/EBPß, and c-Jun in driving IL-1ß promoter activity. Through transient transfection of various IL-1ß promoter-luciferase reporter constructs in TF-1 cells (Fig. 2A), we observed that the minimal region of the IL-1ß promoter required for TPA induction was located to the first 131 bp upstream of the transcription start site, despite the absence of a consensus AP-1 site. This region contains two DNA binding sites essential for IL-1ß promoter activity in monocytes, an ETS site at –45 and a C/EBP site at –90 that recruit PU.1 and C/EBPß, respectively (33, 51). Both sites are conserved between mouse and human whereas sequences outside exhibit significant variations (not shown), consistent with their functional importance. The requirement in PU.1 and C/EBPß for IL-1ß promoter activity and in c-Jun for a TPA response (Fig. 1D) led us to test the hypothesis that c-Jun modulates the transcriptional output mediated by these two factors. We therefore performed cotransfection with IL-1ß131-luciferase reporter constructs and expression vectors for each factor, using the teratocarcinoma cell line F9 that is devoid of PU.1 and AP-1 DNA binding activity and that has low C/EBP-like activity as determined by gel shift assays (data not shown). In these cells, PU.1 on its own induced a five- to eightfold increase in luciferase activity (Fig. 2B) while c-Jun on its own was inactive (not shown). When c-Jun was cotransfected with PU.1, it induced a dose-dependent synergistic increase in PU.1 transcriptional activity, reaching a maximum of 100-fold induction in output from the IL-1ß131-luciferase reporter (Fig. 2B). Furthermore, the synergy with c-Jun was still observed under conditions whereby PU.1 activity was increased 10-fold by C/EBPß (Fig. 2B), reaching a maximum of 750-fold over the activity of the reporter alone. Western blotting confirmed that PU.1, c-Jun, and C/EBPß reach similar levels when individually expressed (Fig. 2B, right panel, lane 1) or coexpressed (lane 2), indicating that transcriptional synergy is not due to cross-regulation. Finally, this tripartite synergy in F9 cells was dependent on the integrity of the PU.1 binding site at –45 as well as the C/EBPß binding site at –90 (Fig. 2C, left panel). Our cotransfection studies indicate that PU.1, C/EBPß, and c-Jun transactivate the IL-1ß proximal promoter in a synergistic manner via functionally linked cis-acting elements located at –45 and –90. These two DNA binding sites are also essential for TPA induction of the IL-1ß131 reporter in TF-1 cells (Fig. 2C, right). The dramatic effect of individual mutations suggests that these two sites that recruit PU.1 and C/EBPß, respectively (as confirmed by gel shift assays) (data not shown), collaborate to mediate the induction by TPA. Systematic scanning by EMSA of the 131 bp of the proximal promoter using a set of overlapping double-stranded oligonucleotide probes and TPA-treated TF-1 NE did not reveal additional binding sites.


Figure 2
View larger version (33K):
[in this window]
[in a new window]

 
FIG. 2. Synergistic collaboration between PU.1, C/EBPß, and c-Jun in driving IL-1ß promoter activity. (A) TPA induces an increase in IL-1ß promoter activity in hematopoietic cells. The IL-1ß promoter from –4400 to +11 or –131 to +11 in luciferase reporter constructs was delivered to TF-1 cells. At the indicated times, cells were harvested to determine luciferase activity, shown here as the ratio of enzyme activity observed in TPA-treated cells versus that observed in control cells which were maintained in standard culture medium. In parallel, cells were also electroporated with a control Rous sarcoma virus-luciferase reporter. (B) Dose-dependent activation of the IL-1ß131-luciferase reporter by c-Jun in collaboration with C/EBPß and/or PU.1 in transfected F9 cells. Transcriptional outputs (graph) are expressed as the increase in activation over the output obtained with the reporter vector alone. Western blot analysis of transfected F9 cells (not shown) and COS expressing PU.1, c-Jun, or C/EBPß individually (lane 1) or together (lane 2) was performed. Note that both C/EBPß isoforms are detected in transfected cells. (C) The PU.1 and C/EBP DNA sites of IL-1ß131 are required for transactivation in F9 cells by PU.1, C/EBPß, and c-Jun, or for TPA induction in TF-1 cells. Transcriptional outputs are expressed as the increase in induction by TPA for TF-1 cells or the increase in activation over the reporter alone in F9 cells. (D) PU.1 but not c-Jun can bind IL-1ß promoter sequences as revealed by EMSA. EMSAs were performed with undirected reticulocyte (ret) lysates (lanes 2 and 6), in vitro translated PU.1 (lane 3), or in vitro translated c-Jun (lanes 4 and 7). 32P-labeled DNA probes were the human IL-1ß 131 (–131 to +11) (lanes 1 to 4) or a TRE-containing an AP-1 binding site (lanes 5 to 7). (E) PU.1, C/EBPß, and c-Jun occupy the IL-1ß promoter in vivo. ChIP assays with the indicated antibodies or control IgGs were performed from RAW cells or from TF-1 cells with or without TPA treatment. IL-1ß promoter sequence was amplified by real-time PCR. Data were expressed as the enrichment over control IgGs and a control genomic sequence. Data shown are the average of three different experiments.

Gel shift assays also confirm that c-Jun does not directly associate with IL-1ß promoter sequences (Fig. 2D) while capable of association with a TRE (Fig. 2D). Together with the lack of an obvious AP-1 binding site, these observations suggest the possibility that c-Jun may act as a coactivator in this context. To assess for the presence of PU.1, C/EBPß, and c-Jun on the IL-1ß promoter in vivo, we performed ChIP assays in TPA-treated RAW (Fig. 2E) and TF-1 cells (Fig. 2E). As illustrated, IL-1ß promoter fragments, revealed by quantitative PCR, were reproducibly enriched by antibodies against PU.1, C/EBPß, or c-Jun, compared to control IgGs or to a control genomic sequence. These ChIP assays thus show the presence of PU.1, C/EBPß, and c-Jun on the IL-1ß promoter during TPA induction and, together with gel shift assays, suggest that c-Jun can be targeted in vivo to the IL-1ß promoter in the absence of a DNA binding site. Additionally, TPA induction did not change the occupancy of the IL-1ß promoter by C/EBPß and PU.1 in RAW macrophages but results in a twofold increased occupancy in the TF-1 progenitor cells. This increased occupancy occurs in the absence of an overall increase in PU.1 and C/EBPß protein levels (Fig. 1B), suggesting an additional level of posttranslational regulation of PU.1 and C/EBPß recruitment to DNA. Furthermore, the difference between the two cell lines may reflect the state of differentiation of the cells, as TF-1 progenitors require both differentiation and activation by TPA while RAW macrophages require activation only.

PU.1, C/EBPß, and c-Jun from macrophages interact with immobilized IL-1ß promoter templates. To further address the recruitment of PU.1, C/EBPß, and c-Jun to the IL-1ß promoter and the mechanism through which these proteins assemble on DNA, we optimized the immobilized DNA template assay described previously (20). In this assay (DNA pull-down), DNA-interacting proteins are retained on immobilized DNA templates (Fig. 3A), eluted after elimination of unbound proteins, and revealed by Western blot analysis, thereby avoiding the potentially disruptive force of the electric field used in EMSA. The immobilized templates used for this assay (Fig. 3B) are the IL-1ß proximal promoter in its wt, m45, m90, or dm form and double-stranded oligonucleotides containing a consensus AP-1/TRE binding site. Binding assays were performed with NE from TPA-activated mouse RAW cells. As shown in Fig. 3C, Western blot analysis of proteins bound on IL-1ß templates indicates that C/EBPß, PU.1, and c-Jun interact with the IL-1ß promoter and that these interactions are disrupted when both the –45 and –90 sites are mutated. These observations indicate that c-Jun associates with the IL-1ß promoter in the absence of an AP-1 binding site.


Figure 3
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 3. Detection of PU.1, C/EBPß, and c-Jun from macrophages on IL-1ß promoter templates by DNA pull-down assay. (A) Schematic representation of the DNA pull-down assay. (B) Diagram of the immobilized templates used in DNA pull-down assays. Mutations of DNA binding sites for PU.1 and/or C/EBPß are indicated by X. The black box represents the AP-1/TRE binding site. (C) NE from TPA-treated RAW cells were incubated with immobilized DNA templates. After the beads were washed, bound proteins were eluted in SDS-PAGE sample buffer for Western blotting. MW, molecular weight; {alpha}, anti.

PU.1 and C/EBPß tether c-Jun to the IL-1ß promoter. To understand the molecular mechanisms underlying the assembly of C/EBPß, PU.1, and c-Jun on the IL-1ß promoter and cooperative transcription activation, various amounts of C/EBPß, PU.1, and c-Jun proteins were added to the binding assays. To this end, we used NE of COS cells that transiently overexpress C/EBPß, PU.1, or c-Jun individually (Fig. 4A). The two C/EBPß isoforms present in COS NE are probably derived from alternative usage of start codons (34).


Figure 4
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 4. c-Jun is recruited to the IL-1ß promoter via DNA-bound PU.1 and C/EBPß as shown by DNA pull-down assays. (A) Western blot analysis of NE derived from COS cells overexpressing individually C/EBPß, PU.1, or c-Jun. (B) PU.1 or C/EBPß binding to the IL-1ß promoter requires the integrity of their binding sites at –45 or –90, respectively. DNA pull-down assays and detection of bound proteins are as described in the legend of Fig. 3C. (C) PU.1 and/or C/EBPß recruit c-Jun to IL-1ß promoter templates. PU.1, C/EBPß, or c-Jun COS NE were incubated with the IL-1ß promoter templates as described in the legend of Fig. 3C, either individually or in combination. Bound proteins (upper blots) and unbound c-Jun (bottom blot) were revealed by Western blotting. (D) The experiment is the same as in panel C but with the use of recombinant c-Jun purified from E. coli with the IL-1ß template (lanes 1 and 2) or the TRE template in the absence (lane 3) or the presence (lane 4) of a 300-fold molar excess of free double-stranded TRE competitor. (E) c-Jun recruitment to the IL-1ß promoter template depends on PU.1 concentration (left) and the integrity of the PU.1 and C/EBP binding sites (right). DNA binding was performed as in panel C with wt (lanes 1 to 3 and 7) or mutant (lanes 4 to 6) DNA templates, a sixfold lower PU.1 concentration (lane 1) or a 300-fold molar excess of free double-stranded oligonucleotide containing the TRE binding site (lane 7). Cß, C/EBPß; P, PU.1; J, c-Jun; MW, molecular weight; {alpha}, anti.

For the DNA pull-down assays, beads coated with immobilized IL-1ß promoters were incubated with the different COS NE alone or in combination, and the total amounts of NE per sample were kept constant by complementation with NE from untransfected COS cells. Both PU.1 and C/EBPß were able to bind to the IL-1ß promoter independently of each other, and this binding required the integrity of the –45 and –90 DNA binding sites, respectively (Fig. 4B). In contrast, c-Jun binding required the presence of PU.1 (Fig. 4C, compare lanes 1 and 2) and was increased by C/EBPß (Fig. 4C, lane 3). To rule out the possibility that PU.1 and C/EBPß protected c-Jun from proteolysis in our assay, we show that the amount of c-Jun in the supernatant after binding was the same in the absence or presence of these proteins (Fig. 4C, lanes 1 to 3). This binding pattern was confirmed using recombinant c-Jun purified from E. coli that efficiently binds immobilized TRE templates (Fig. 4D, lane 3) but fails to associate with immobilized IL-1ß templates by itself (Fig. 4D, lane 1). However, in the presence of NE from COS overexpressing C/EBPß and PU.1 separately, this recombinant c-Jun protein is efficiently recruited to the promoter (Fig. 4D, lane 2). These observations indicate that the lack of binding of c-Jun to the IL-1ß promoter in the presence of COS NE (Fig. 4C, lane 1) is not due to an inhibitory activity in these extracts and indicates that the IL-1ß promoter is devoid of an AP-1 binding site.

The levels of PU.1 bound to DNA determined the extent of recruitment of c-Jun (Fig. 4E, compare lanes 1 and 2) without affecting that of C/EBPß. This suggests a role for PU.1 in tethering c-Jun to the IL-1ß promoter, which was further confirmed through the importance of the integrity of the –45 PU.1 binding site (Fig. 4E, compare lanes 3 and 4). Mutation of the C/EBPß binding site at –90 disrupted most of C/EBPß binding and reproducibly decreased PU.1 binding twofold (Fig. 4E, lane 5). Furthermore, c-Jun binding was decreased fourfold (lane 5) while mutation of both sites completely abrogated PU.1, C/EBPß, and c-Jun binding altogether (Fig. 4E, lane 6). Our binding assay therefore reveals that the presence of PU.1 and C/EBPß on their respective DNA sites allows for the recruitment of c-Jun to the IL-1ß promoter in the absence of an AP-1 site. Furthermore, both PU.1 and C/EBPß binding to the IL-1ß promoter appears to be reinforced by the presence of the other partner on DNA. This was most likely due to protein-protein interaction(s), as assessed by the residual binding of PU.1 or C/EBPß to promoter templates that harbor individual mutations, which was not observed when both sites were mutated (Fig. 4E, compare lane 4 or 5 with lane 6).

The importance of the PU.1 and C/EBP binding sites in recruiting the complex was further confirmed by the capacity of double-stranded oligonucleotides covering these sites to specifically displace DNA binding in our assay (data not shown). Surprisingly, a large excess of free double-stranded oligonucleotides containing an AP-1/TRE binding site that specifically displaces c-Jun binding to an immobilized TRE (Fig. 4D, lane 4) also prevented c-Jun recruitment to the IL-1ß promoter without affecting C/EBPß and PU.1 binding (Fig. 4E, lane 7).

Together, our observations suggest that the recruitment of c-Jun to DNA may be mediated by protein-protein interactions with DNA-bound PU.1 and C/EBPß and that the DNA-binding domain of c-Jun may be involved in these interactions, possibilities that will be further tested.

To test the possibility of cooperative DNA binding between C/EBPß and PU.1, we assessed the impact of C/EBPß on PU.1 binding at a lower concentration (fourfold less COS NE containing PU.1). Under these conditions, PU.1 binding was increased by C/EBPß, and this increase depended on the integrity of the –45 and –90 DNA sites (Fig. 5A, lanes 1 to 4) and on the concentration of C/EBPß (data not shown). To further assess the mechanism of C/EBPß and PU.1 DNA binding, we used a 3' extended and 32P-labeled version of IL-1ß131 templates immobilized on magnetic beads (Fig. 5B) for DNase I footprinting. In this assay, C/EBPß alone specifically protects a region encompassing the core –90 C/EBPß binding site (Fig. 5B, lane 3). In contrast, no significant protection of the –45 PU.1 binding site is observed in the presence of PU.1 alone (Fig. 5B, lane 4). This site, together with immediate upstream sequences, was nonetheless protected when both proteins were used together (Fig. 5B, lane 5), indicating that C/EBPß can help PU.1 bind to the IL-1ß promoter when the concentration of PU.1 is limiting, as observed in Fig. 5A. Together, our DNA binding assays suggest that DNA-bound C/EBPß can facilitate the binding of PU.1 to its DNA binding site by a mechanism that potentially involves protein-protein interaction(s).


Figure 5
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 5. C/EBPß enhances PU.1 binding to the IL-1ß template at limiting concentrations as shown by DNA pull-down and DNase I footprinting. (A) C/EBPß enhances PU.1 binding to the IL-1ß promoter by DNA pull-down assay (as described in the legend of Fig. 4) when the concentration of PU.1 is limiting, corresponding to fourfold less PU.1-containing COS NE (lanes 1 and 2) in a –45 and –90 site-dependent manner (lanes 3 and 4). (B) Schematic representation of the DNase I footprint assay adapted from the DNA pull-down assay. Incubation of COS NE with immobilized 32P-labeled IL-1ß promoter templates, DNase I treatment, and detection of the 32P-nicked fragments are described in Materials and Methods. (C) Footprints with C/EBPß, PU.1, and c-Jun alone or in combination. Untransfected (untransf) COS cells showed no protection (compare lanes 1 and 2), whereas the –90 site was protected by C/EBPß COS-extracts. Protection of the –45 PU.1 DNA binding site by a low concentration of PU.1 (as in panel A) is detectable only in the presence of C/EBPß (compare lane 5 with lane 3 or 4). No additional protection is observed when Jun is present in the assay with C/EBPß and a low concentration of PU.1 (compare lane 6 with lane 5) or a higher concentration of PU.1 that allows nearly maximal protection of the –90 and –45 sites (compare lane 8 with lane 7). Cß, C/EBPß; P, PU.1; J, c-Jun; P(low), low concentration of PU.1; {alpha}, anti.

In order to address the possibility that C/EBPß and PU.1 may recruit c-Jun to the IL-1ß promoter via stabilization of c-Jun on a low-affinity DNA binding site, we have added c-Jun in the DNase I footprint assay. No additional protection was observed in the presence of c-Jun at low (Fig. 5B, lane 6) or high PU.1 concentrations (Fig. 5B, lane 8), ruling out the possibility of a low-affinity binding site for c-Jun on this promoter.

Together, our DNA binding data indicate that C/EBPß, PU.1, and c-Jun form a complex that can assemble cooperatively on the IL-1ß promoter via C/EBPß and PU.1, directly tethered to their respective DNA binding sites. We suggest that this anchoring then allows recruitment of c-Jun to the IL-1ß promoter via protein-protein interactions. Our observations also suggest that the assembly of a competent multiprotein complex on specific regulatory sequences is a limiting step in c-Jun-dependent transcriptional synergy.

PU.1, c-Jun, and C/EBPß interact in vitro and in vivo. The association of proteins with DNA is often strengthened by direct protein-protein interactions. c-Jun associates with PU.1 or C/EBPß in vitro (5, 27), suggesting that c-Jun can be recruited to DNA by PU.1 and C/EBPß in the absence of a canonical AP-1 binding site. Pull-down assays with GST-PU.1 and GST-C/EBPß confirm that both proteins interact with c-Jun in vitro (Fig. 6A), as expected (5, 27). Moreover, the interaction was also observed with JunB and JunD, two family members that share 86% and 95% homology with c-Jun basic leucine zipper domains, as illustrated in Fig. 6B. Deletion of the basic domain of c-Jun disrupted its interaction with C/EBPß and PU.1 (Fig. 6A). Together, our results indicate that c-Jun interacts through its basic domain with PU.1, as reported previously (5), and with C/EBPß. The involvement of the basic domain in protein-protein interaction is consistent with the observation that a TRE compromised the recruitment of c-Jun to immobilized IL-1ß promoter templates by DNA bound PU.1 and C/EBPß (Fig. 4E). Finally, we observed that PU.1 interacts through its ETS-containing C-terminal domain with C/EBPß (data not shown), consistent with the effect of C/EBPß on PU.1 binding to the IL-1ß promoter (Fig. 5A and C).


Figure 6
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 6. PU.1, c-Jun, and C/EBPß interact in vitro and in vivo. (A) Pull-down assays using GST, GST-PU.1, or GST-C/EBPß and 35S-labeled in vitro translated c-Jun, c-Jun {Delta}B, JunB, or JunD. (B) Schematic representation of Jun proteins and the percentage homology between their TDs or basic leucine zipper domains, c-Jun {Delta}B, and c-Jun {Delta}TD. (C) Specificity of c-Jun in transcription activation. The GAL4 reporter (5xGAL4UAS-tk109-luciferase) was cotransfected in F9 cells with expression vectors for the GAL4DBD-PU.1 chimera and wt or mutant c-Jun ({Delta}B and {Delta}TD), JunB, or JunD. Transcriptional outputs are expressed as synergy (n-fold) (the ratio of the output obtained with both proteins over the sum of their individual outputs). (D) The experiment is the same as that in panel C but with the IL-1ß131-luciferase reporter and expression vector for wt PU.1. (E) Transcription activation by c-Jun is decreased by c-Fos. The experiment is the same as that in panel D with the additional use of expression vectors for C/EBPß and c-Fos, as indicated. (F) c-Jun phosphorylation sites at positions 63 and 73 are dispensable for transcriptional synergy with PU.1. The IL-1ß131-luciferase reporter construct was cotransfected in F9 cells with the PU.1 expression vector alone or with expression vectors for wt and c-JunAA mutant (described in the legend of Fig. 7). Outputs are represented as the increase in activation (n-fold) over the reporter alone. Basic/LZ, basic leucine zipper domain.

To define the role of the TD of c-Jun in transcriptional synergy and to assess the possibility that c-Jun interacts with PU.1 in vivo, we performed mammalian one-hybrid assays (Fig. 6C). The full-length PU.1 cDNA was cloned in frame with the yeast GAL4DBD (GAL4DBD-PU.1) and transfected in F9 cells, together with a 5xGAL4UAS-tk109-luciferase reporter construct and expression vectors for full-length Jun proteins. Transactivation in this assay depends on protein interaction that brings an active TD onto the GAL4 reporter construct. Consistent with pull-down assays, c-Jun and full-length PU.1 interacted, generating a sixfold synergy over the sum of PU.1-GAL4 and c-Jun that were transfected individually (Fig. 6C), and deletion of the basic domain of c-Jun prevented this interaction. In contrast to c-Jun, JunB or JunD failed to activate transcription in this assay, despite the fact that they both associate with PU.1 in vitro. Residues extending from the basic domains to the leucine zipper domains of the different Jun proteins are highly conserved, while their N terminal domains are divergent. We therefore conclude that the observed difference in cooperativity with PU.1 in this assay is due to the unique transactivation function of the N terminal domain of c-Jun. The importance of the TD of c-Jun was further confirmed through the inability of a c-Jun mutant lacking its entire TD to potentiate PU.1 (Fig. 6C).

These same observations were made using the IL-1ß 131-luciferase reporter (compare Fig. 6C and D). Together, our results indicate that the N terminal TD of c-Jun confers functional specificity in transcriptional cooperativity with PU.1, while the basic domain is important for its interaction with both C/EBPß and PU.1.

Because c-Jun can form homodimers or heterodimers with c-Fos, we addressed the role of c-Fos in the context of the IL-1ß promoter (Fig. 6E). Our results show that c-Fos was functionally inactive in potentiating PU.1 and C/EBPß. Furthermore, the activity of c-Jun is not enhanced by c-Fos and is even reduced, suggesting that heterodimerization with c-Fos is not required (Fig. 6E). We also addressed the role of the Ser63 and Ser73 Jun N-terminal protein kinase (JNK) phosphoacceptor sites (14) in synergy with PU.1. For that purpose we used a c-Jun mutant that harbors an Ala instead of a Ser at these positions (Fig. 7, c -JunAA). These mutations did not affect synergy with PU.1 (Fig. 6F), indicating that this activity is independent of phosphorylation by JNK. Together, these observations indicate that c-Jun interacts with PU.1 and C/EBPß to increase transcriptional output through a mechanism which is c-Fos and JNK independent.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 7. Essential role of c-Jun homodimeric state and of its DBD in physical interactions with PU.1 and C/EBPß. (A) Schematic representation of HA-tagged c-Jun mutants (left) harboring the indicated point mutations in the DBD (M13, M14, M14b, and M13-14b; + indicates phosphate contacting amino acid residues and a box indicates DNA contacting amino acid residues), in the leucine zipper domain (M17 and M22-23), or in Ser63/Ser73 phospho-acceptor sites (JunAA) and their consequences on DNA binding, dimerization, or phosphorylation state (amino acid positions are according to references 8 and 59). Outputs from pull-down assays between GST-PU.1 (open bars) or GST-C/EBPß (filled bars) and 35S-labeled in vitro translated wt or mutant c-JunHA proteins are shown as percentages of bound protein compared to wt c-JunHA considered as 100%.

Essential role of c-Jun homodimeric state and of its DBD in functional and physical interactions with PU.1 and C/EBPß. The dispensability of c-Fos suggests that c-Jun may associate with PU.1 and C/EBPß as a homodimer (Fig. 6E). Furthermore, the deletion of the c-Jun basic domain and the displacement of c-Jun recruitment to DNA-bound PU.1 and C/EBPß by oligonucleotides containing a TRE suggest that this interaction occurs via a region encompassing the DNA binding interface in the basic domain of c-Jun (Fig. 4E and 6A and C). To directly address the functional importance of these observations, we tested c-Jun mutants that harbor amino acid changes at positions shown to be important for DNA binding (M13, M14, M14b, and M13-14b), a c-Jun mutant that shows higher stability as homodimers and lower stability as heterodimers with c-Fos (M17), or a c-Jun mutant that exhibits a disrupted dimerization interface (M22-23) (Fig. 7) (8, 19, 55, 59, 74). The wt and c-Jun mutants were tagged at their C termini with an HA epitope to normalize detection with an antibody that should recognize all proteins equally well. Mutations of residues in the DBD of c-Jun reduced its capacity to interact with C/EBPß and PU.1 in pull-down assays, compared to wt c-Jun (Fig. 7). These results are in agreement with the observed capacity of TRE oligonucleotides to out-compete the recruitment of c-Jun on the IL-1ß promoter by DNA-bound C/EBPß and PU.1 (Fig. 4E, lane 7). Single mutations of two adjacent residues mildly reduced the interaction of c-Jun with PU.1 or C/EBPß while double mutations (M13-14b) disrupted both interactions. These observations indicate that binding to DNA or to C/EBPß and PU.1 requires the same four residues and suggest that these two binding activities are likely to be mutually exclusive. Our data suggest that the interface that is sufficient for interaction with C/EBPß and PU.1 is probably not limited to the c-Jun DBD since the mutations in M13, M14, and M14b abolish DNA binding of c-Jun while affecting only partially the interactions with C/EBPß and PU.1. Comparison of the M17 and M22-23 mutants revealed the difference between PU.1 and C/EBPß. The integrity of the leucine zipper domain is essential for interaction with C/EBPß since the M22-23 mutation but not the M17 mutation abrogated this interaction. In contrast, the structural integrity of this domain is dispensable for interaction with PU.1. In summary, these observations indicate the importance of the basic domain of c-Jun in protein-protein interactions.

We next tested the activity of these mutants in transcriptional synergy with PU.1 and C/EBPß (Fig. 8A). At low levels, the mutant with a reduced capacity to interact with PU.1 only (M14) exhibits decreased synergy with PU.1 alone (not shown) or in combination with C/EBPß (Fig. 8A, left panel), correlating with its decreased capacity to be recruited to immobilized IL-1ß templates (Fig. 8B, lane 2). However, at high levels, when wt c-Jun followed a bell curve shape, the M14 mutant did not follow this trend and remained active. In contrast, the mutants that show reduced (M13 and M14b) or no (M22-23) capacity to interact with C/EBPß are almost inactive (Fig. 8, middle panel) or totally inactive (Fig. 8A, right panel) in synergy with C/EBPß and PU.1. This correlated with a severe incapacity for these mutants (M13, M14b, and M22-23) to be recruited to immobilized IL-1ß templates (Fig. 8B, lanes 3, 7 and 8; most if not all of the signal observed in lanes 7 to 9 corresponds to nonspecific interaction as observed in lane 10 and described in the figure legend). The mutant incapable of interaction with both C/EBPß and PU.1 (M13-14b) shows both an absence of synergy (Fig. 8A, middle panel) and a severe incapacity to be recruited to immobilized templates (Fig. 8B, lane 9). Differences in binding to immobilized templates were not due to differing protein levels, as revealed by comparable input levels in each binding samples (Fig. 8B, input panels). Together, these results indicate that residues R270/N271 and K277/C278/R279 in the basic domain of c-Jun are essential for interactions and transcriptional synergy with PU.1 and C/EBPß. Furthermore, the structural integrity of the leucine zipper domain is essential in transcriptional synergy, despite the fact that it is dispensable for interaction with PU.1. We therefore tested the mutant that exhibits increased homodimer stability and impaired heterodimer stability with Fos (M17). This mutant mediated a twofold more robust synergy with C/EBPß and PU.1 compared to the wt protein (Fig. 8A, right panel), consistent with the functional importance of c-Jun homodimers. Furthermore, increased transcriptional activity does not correlate with increased recruitment to immobilized IL-1ß promoter (Fig. 8B, lane 5), suggesting that this higher activity was determined by a step that occurs after complex assembly.


Figure 8
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 8. Essential role of the c-Jun homodimeric state and of its DBD in recruitment to the IL-1ß promoter by PU.1 and C/EBPß and transcriptional synergy. (A) Essential role of c-Jun homodimeric state and of its DBD in functional interactions with PU.1 and C/EBPß. F9 cells were cotransfected with the IL-1ß131-luciferase reporter and expression vectors for PU.1, C/EBPß, and wt or mutant HA-tagged c-Jun as described in Materials and Methods. Luciferase outputs are represented as the increase in activation over the output obtained from the reporter alone. c-Jun mutants (as described in the legend of Fig. 7) defective in DNA binding (left and middle graphs) or harboring altered dimerization properties (right graph) were compared to the wt protein in functional interaction with PU.1 and C/EBPß. (B) c-JunHA mutants (as described in the legend of Fig. 7) defective in DNA binding (lanes 2, 7, 8, and 9) or harboring altered dimerization properties (lanes 3 and 5) were compared to the wt protein (lanes 1, 4, and 6) in their capacity to be recruited to the IL-1ß promoter by PU.1 and C/EBPß in DNA pull-down assays as described in the legend of Fig. 4. The asterisk (lane 10) corresponds to nonspecific interactions of c-JunHA to magnetic beads immobilized with the –45 and –90 mutated IL-1ß template (as described in the legend of Fig. 3B) that are occasionally observed, depending on the batch of poly(dI-dC). Equal amounts of wt and mutant c-JunHA proteins were used in the assay (input panels, 5% of total).

Recruitment of the RNA Pol II machinery to the IL-1ß promoter. Transcription of protein-coding genes is dependent on the recruitment of the RNA Pol II machinery to promoters (21). We therefore verified whether Pol II recruitment by the DNA-bound PU.1-C/EBPß-c-Jun complex can be detected with the DNA pull-down assay. The assay was scaled up to increase the efficiency of RNA Pol II detection. As shown in Fig. 9A, Pol II recruitment is detectable when C/EBPß, PU.1, and c-Jun are present and undetectable in their absence (Fig. 9A, compare lane 2 with lane 1). We observe that this recruitment depends on the integrity of the –45 PU.1 and/or –90 C/EBPß binding sites (Fig. 9A, lanes 3 to 5). Since the magnitude of transcriptional output depends on the presence of all three proteins, we verified the capacity of different combinations of these factors to recruit the RNA Pol II to the IL-1ß promoter. When the assay was performed with C/EBPß NE (lane 6) or PU.1 NE (lane 8) alone, Pol II recruitment was at the limit of detection of the assay. Any two-factor combination (lanes 7, 9, and 10) was above that of either factor alone. Finally, when all three transcription factors were present in the binding reaction, Pol II recruitment was highest (lane 11). The RNA Pol II content in the supernatants after binding is equivalent in all samples (Fig. 9A, lower panel), indicating that the inability to detect Pol II on the IL-1ß promoter was not due to degradation of the polymerase during the incubation period.


Figure 9
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 9. Recruitment of RNA Pol II to the IL-1ß promoter in vitro and in vivo. (A) Additive effects of PU.1 (P) and/or C/EBPß (Cß) and recombinant c-Jun (J) on RNA Pol II recruitment. The respective COS NE were incubated alone (lanes 6 and 8), in paired combinations (lanes 7, 9, and 10), or all together (lanes 2 to 5 and 11) with wt (lanes 1, 2, and 6 to 11) or mutant (lanes 3 to 5) immobilized IL-1ß templates. Untransfected COS NE served as negative controls (lane 1). Binding volumes and reagents were scaled up fivefold to allow for the detection of RNA Pol II. After the binding reaction, DNA-bound (top blot) and free (bottom blot) RNA Pol II was revealed by Western blotting. (B) Occupancy of the IL-1ß or Mmp12 promoters by c-Jun, c-Fos, acetylated histone H3 (AcH3), and RNA Pol II in RAW cells prior to (open bars) and after (filled bars) TPA treatment. The IL-1ß and the Mmp12 promoters were amplified by quantitative PCR from chromatin extracts immunoprecipitated with antibodies as shown. Data are expressed as enrichment over control IgGs and control genomic sequences as described in Materials and Methods. {alpha}, anti.

To address the question whether TPA induction also increases the occupancy of the IL-1ß promoter by Pol II in vivo, we performed ChIP assays prior to and following TPA exposure. As shown in Fig. 9B, Pol II was found at the IL-1ß promoter prior to TPA induction, correlating with high levels of histone H3 acetylation at this locus. In contrast, no Pol II was detected by this method at the Mmp12 promoter, another TPA-inducible gene in RAW cells (57), correlating with low levels of histone H3 acetylation (Fig. 9B). TPA induction resulted in a sixfold increased c-Jun and threefold increased Pol II occupancy of the IL-1ß promoter region while c-Fos occupancy was not affected, consistent with a c-Fos-independent mechanism in transcriptional synergy (Fig. 6E). The induction of Pol II was also observed on the Mmp12 promoter, a known AP-1 target gene (57). Unlike the IL-1ß promoter, however, this induction correlates with increased c-Fos occupancy of the Mmp12 promoter (as shown in reference 57). Finally, while histone H3 acetylation increased at both loci, this induction was much higher at the Mmp12 promoter. These observations suggest that Pol II recruitment at these promoters occurs through different mechanisms, a DNA binding-dependent mechanism that requires Jun-Fos recruitment to an AP-1 site on the Mmp12 promoter, as reported previously (57), and a DNA-binding-independent mechanism in which c-Jun homodimers act as coactivators on the IL-1ß promoter.

Combined, our in vitro and in vivo results suggest that the complex formed on the IL-1ß promoter between PU.1, C/EBPß, and c-Jun directly facilitates the assembly of the RNA Pol II machinery, thereby enhancing transcriptional output.


arrow
DISCUSSION
 
In the present study, we define the functional cooperation between a tissue-specific transcription factor PU.1 and C/EBPß as well as c-Jun homodimers that act as coactivators to enhance the expression of an endogenous target gene in hematopoietic cells. Furthermore, we provide molecular evidence for a cooperative assembly of these proteins on target DNA, resulting in more efficient recruitment of RNA Pol II and synergistic transcription activation.

Consequences of the assembly of c-Jun and DNA-bound PU.1 and C/EBPß in a complex on Pol II recruitment. Transcription activation by PU.1 or C/EBPß is enhanced through association with multiple protein partners (26, 53, 60, 61). However, subsequent events that follow their binding to cis-regulatory sequences remain to be ascertained. In the present study, we show that PU.1 and C/EBPß mutually facilitate their association with DNA via specific binding to cis-acting sequences. This allows for c-Jun recruitment despite the absence of an AP-1 site and increased RNA Pol II occupation of a target promoter.

The assembly of the RNA Pol II machinery into transcriptional PICs is a very limiting step in transcription activation that can be facilitated by physical interactions with promoter-bound activators (12, 39, 62, 63). One consequence of the assembly of PU.1, C/EBPß, and c-Jun on the IL-1ß promoter observed here is to allow for maximal recruitment of the RNA Pol II to this promoter. PU.1, C/EBPß, or c-Jun have all been reported separately to interact with basal Pol II transcription factors, suggesting that these factors may together facilitate PIC assembly. Indeed, PU.1 was shown to interact with CBP (80), C/EBPß with the CRSP130/Sur2 protein present in Mediator complexes or p300 (49, 67), and c-Jun with TFIIE, TFIIF, or TAF1 (43, 47). Together with our observations of a more efficient recruitment of RNA Pol II, we propose that maximal assembly of PIC on the IL-1ß promoter is achieved by multiple interactions and recruitment of TFIID and RNA Pol II holoenzymes containing Mediator complexes, CBP/p300, and some general transcription factors by the PU.1-C/EBPß-c-Jun complex.

The presence of this complex could also facilitate other limiting steps in mRNA production following initial PIC assembly such as transcription reinitiation or promoter clearance (17, 63, 78, 81). The mechanism described here is, nonetheless, distinct from the cooperation between the long form of C/EBPß and Myb at the mim-1 promoter that probably necessitates a derepression step involving the recruitment of the SWI/SNF complex and chromatin remodeling before activation per se (34). Indeed, the IL-1ß gene is already transcriptionally active in macrophages and macrophage progenitors. Furthermore, the C/EBPß isoform detected in the two progenitor/macrophage cell lines studied here does not appear to contain the extra N-terminal 22 amino acids that characterize the long form of C/EBPß. Our data are consistent with an important role for the PU.1/C/EBPß/c-Jun complex in RNA Pol II recruitment and transcription activation.

c-Jun homodimer as a coactivator. AP-1 transcriptional activity is determined by the nature of the dimerization partner. Hence, c-Jun-c-Fos heterodimers bound to DNA via AP-1 sites exhibit the highest transcriptional activity (reviewed in reference 10). In contrast, we show here that when c-Jun is in a complex with PU.1 and C/EBPß, c-Jun activity is highest as homodimers, whereas heterodimerization with c-Fos decreases transcriptional synergy. Furthermore, a c-Jun mutant with increased homodimer stability has a twofold-impaired capacity to interact with PU.1 and C/EBPß yet exhibits increased transcriptional synergy with PU.1 and C/EBPß. These observations suggest that a postrecruitment step which is limiting for transcriptional output may be facilitated by c-Jun homodimers, possibly via additional protein-protein interaction(s) with the PIC, as discussed below. Our observations also suggest that in this context, c-Jun does not function as a heterodimer with C/EBPß, consistent with published results (54, 73, 77). Indeed, a potential c-Jun/C/EBPß heterodimer is unlikely to bind an AP-1 site, while we show here that a TRE oligonucleotide displaces all of c-Jun recruitment to the IL-1ß promoter without affecting C/EBPß binding.

Basic residues are often involved in specific electrostatic bonds between two proteins. Here, we show that the basic domain of c-Jun serves as a protein interaction interface with PU.1 and C/EBPß, specifically, residues R270/N271 and K277/C278/R279 (amino acid positions are according to reference 8) that are otherwise involved in DNA binding. These observations suggest that c-Jun DNA binding and protein-protein interactions are mutually exclusive, a hypothesis which is further supported by additional lines of evidence. Initially, we observed that c-Jun recruitment to DNA-bound PU.1 and C/EBPß is out-competed by an excess of the TRE double-stranded oligonucleotide. However, c-Jun does not directly bind IL-1ß proximal promoter sequences either by gel shift assays, an optimized DNA pull-down assay, or by footprinting. Furthermore, the dispensability of direct DNA binding by c-Jun is further supported by the M14 mutation that disrupts TRE binding but does not abrogate functional and physical interaction with PU.1 and C/EBPß. Finally, these five residues within the basic domain of c-Jun are conserved in evolution, suggesting that the duality of DNA and protein-protein interactions is also conserved. Structural studies of basic leucine zipper proteins in solution or in crystals suggest that the basic domain of these proteins is disorganized when they are free in solution while it adopts an {alpha}-helical structure when bound to DNA, probably via an induced fit (19, 58, 72). We hypothesize that the c-Jun basic domain, including the DNA binding interface, can adopt in the context of homodimers a non-{alpha}-helical conformation which is stabilized upon binding to C/EBPß and PU.1, thereby simultaneously preventing specific interactions with DNA.

c-Jun can mediate transcriptional stress response via two different mechanisms. c-Jun has been implicated in macrophage differentiation (74) and stress response (4, 15, 35, 69). Our study unravels two different mechanisms through which c-Jun can mediate transcriptional activation of stress-responsive genes. c-Jun commonly drives gene expression via binding to an AP-1 site, and, in this context, heterodimers are favored over homodimers. This is exemplified from studies with the Mmp12 promoter (57) where TPA induction allows (i) recruitment of c-Jun/c-Fos heterodimers to an AP-1 site, (ii) displacement of the NcoR corepressor through a mechanism that requires c-Jun phosphorylation at Ser63/Ser73, and (iii) as shown here, a sharp increase in histone H3 acetylation. In contrast to the Mmp12 promoter, induction from the IL-1ß promoter (i) occurs in the absence of an AP-1 site, (ii) is mediated by c-Jun homodimers acting as coactivators that interact with promoter-bound PU.1 and C/EBPß, (iii) is independent of c-Fos and c-Jun Ser63/Ser73 phosphorylation, and (iv) is associated with a modest increase in histone H3 acetylation. It is therefore possible that the promoter architecture and transcriptional ground state of c-Jun target genes will select between c-Jun/c-Fos and c-Jun/c-Jun dimer usage. A repressed state prior to activation, as exemplified with the Mmp12 promoter, requiring derepression would implicate heterodimer binding to an AP-1 site, allowing for displacement of a corepressor, possibly triggered by the phosphorylation of Ser63/Ser73 (57). In contrast, an active basal state as exemplified by the IL-1ß promoter would implicate homodimers in the absence of DNA binding (Fig. 10) and does not require Ser63/Ser73 phosphorylation. In summary, our observations are consistent with the view that c-Jun heterodimers shown elsewhere (3, 65) to bind AP-1 sites with highest affinity may function as classical transcription factors whereas c-Jun homodimers may preferentially act as coactivators. Our data indicate that these two activities are mutually exclusive. Although we have not addressed what governs this switch, we propose that these two activities are determined by the architecture of the promoter or the ratio of heterodimers to homodimers and that this duality could represent a novel mechanism of fine-tuning gene expression profiles.


Figure 10
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 10. c-Jun can mediate transcriptional stress response in macrophages via two different mechanisms. Differences in the promoter context of stress-responsive genes appear to be a major mechanistic determinant of c-Jun versatility. One determinant, exemplified by the IL-1ß promoter (mechanism 1; our study), is the presence of DNA-bound C/EBPß and PU.1 that specifically tether c-Jun homodimers via protein-protein interactions. C/EBPß and PU.1 cooperatively drive basal transcription via their respective DNA binding sites, corresponding to basal histone H3 acetylation (indicated as Ac) and the presence of RNA Pol II (indicated by the square box over the transcriptional start site). Upon stress induction, c-Jun homodimers are recruited to this complex, allowing for a better recruitment of RNA Pol II (Activated; bold right arrow and square box) and an increase in histone H3 acetylation. These conditions further activate the IL-1ß gene over its transcriptional ground state (Basal; small right arrow). Alternatively, another determinant (mechanism 2) is the presence of an AP-1 site (indicated by the rectangular box), exemplified by the Mmp12 promoter, as shown in Ogawa et al. (57). c-Jun in this context acts as a heterodimer with c-Fos via binding to the AP-1 site and allows stress-dependent activation of a constitutively repressed promoter (57). In this context, derepression requires Ser63/Ser73 phosphorylation of c-Jun (57), which is dispensable in the context of an already active promoter, as shown here for the IL-1ß promoter. Finally, we show that Pol II is undetectable on the Mmp12 promoter in the absence of stress (indicated by an absence of square box over the start site) and that the presence of c-Jun and c-Fos correlates with a sharp increase in both Pol II recruitment and histone H3 acetylation.

The specific need of c-Jun homodimers in transcriptional activation from the IL-1ß promoter might reflect the capacity of c-Jun homodimers to mediate specific protein-protein interactions with coactivators and/or the RNA Pol II machinery after its recruitment by PU.1 and C/EBPß. Interestingly, the two loci at which c-Jun has been implicated as a coactivator (reference 6 and this study) appear to be transcriptionally active prior to environmental stimulation. Indeed, c-fms is expressed in hematopoietic progenitors (7) and is upregulated by RasV12 (6). Similarly, IL-1ß is also expressed and the IL-1ß promoter is already transcriptionally active in TF-1 and RAW cells prior to TPA induction.

Despite the differences in the promoter context between the Mmp12 and IL-1ß genes, transcriptional activation in response to stress is dependent on increased RNA Pol II recruitment, as observed from our in vitro and in vivo assays, the only difference being the degree of increase: a sharp increase for the Mmp12 promoter and a smaller increase for the IL-1ß promoter. Interestingly, we observe that the degree of Pol II recruitment on the Mmp12 and IL-1ß promoters after TPA treatment correlates with the degree of histone H3 acetylation. We therefore speculate that the observed increases of acetylated H3 in the context of these promoters could facilitate the recruitment and/or the assembly of the RNA Pol II machinery.

In summary, our results are consistent with the view that in vivo, PU.1-C/EBPß interaction induces a poised state competent for initiation, as suggested from chromatin accessibility studies (41), and that the recruitment of c-Jun as a coactivator in the complex enhances RNA Pol II recruitment and the efficiency of transcription, allowing for a rapid stress response in macrophages.


arrow
ACKNOWLEDGMENTS
 
The work was funded by a research grant from the Canadian Institutes for Health Research (T.H.), NIH grants HL56745 and CA41456 (D.T.), the Canadian Research Chair program (T.H.), studentships from the Fonds de Recherche en Santé du Québec (M.S.D.) and CIHR (M.T.), and a fellowship from Dokkyo University (K.W.).

We thank Daniel Durocher (Centre for Systems Biology, Toronto) and Marc Therrien (IRIC, Montreal) for critical reading of the manuscript and Gerhard Behre, Mona Nemer, and Luc Villeneuve for their help in establishing the gel shift and transient transfection assays. We thank Nathalie Nguyen as well as Pierre Forest for their technical assistance and Viviane Jodoin for secretarial help.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Institute of Research in Immunology and Cancer, University of Montreal, P.O. Box 6128, Downtown station, Montréal, Québec H3C 2J7. Phone: (514) 343-6970. Fax: (514) 343-5839. E-mail: trang.hoang{at}umontreal.ca Back

{triangledown} Published ahead of print on 5 February 2007. Back

{dagger} Present address: Department of Biology, McMaster University, 1280 Main St., West Hamilton, Ontario L8S 4K1, Canada. Back


arrow
REFERENCES
 
    1
  1. Agalioti, T., G. Chen, and D. Thanos. 2002. Deciphering the transcriptional histone acetylation code for a human gene. Cell 111:381-392.[CrossRef][Medline]
  2. 2
  3. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos. 2000. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-beta promoter. Cell 103:667-678.[CrossRef][Medline]
  4. 3
  5. Allegretto, E. A., T. Smeal, P. Angel, B. M. Spiegelman, and M. Karin. 1990. DNA-binding activity of Jun is increased through its interaction with Fos. J. Cell Biochem. 42:193-206.[CrossRef][Medline]
  6. 4
  7. Angel, P., M. Imagawa, R. Chiu, B. Stein, R. J. Imbra, H. J. Rahmsdorf, C. Jonat, P. Herrlich, and M. Karin. 1987. Phorbol ester-inducible genes contain a common cis element recognized by a TPA-modulated trans-acting factor. Cell 49:729-739.[CrossRef][Medline]
  8. 5
  9. Bassuk, A. G., and J. M. Leiden. 1995. A direct physical association between ETS and AP-1 transcription factors in normal human T cells. Immunity 3:223-237.[CrossRef][Medline]
  10. 6
  11. Behre, G., A. J. Whitmarsh, M. P. Coghlan, T. Hoang, C. L. Carpenter, D. E. Zhang, R. J. Davis, and D. G. Tenen. 1999. c-Jun is a JNK-independent coactivator of the PU.1 transcription factor 15. J. Biol. Chem. 274:4939-4946.[Abstract/Free Full Text]
  12. 7
  13. Billia, F., M. Barbara, J. McEwen, M. Trevisan, and N. N. Iscove. 2001. Resolution of pluripotential intermediates in murine hematopoietic differentiation by global complementary DNA amplification from single cells: confirmation of assignments by expression profiling of cytokine receptor transcripts. Blood 97:2257-2268.[Abstract/Free Full Text]
  14. 8
  15. Bohmann, D., and R. Tjian. 1989. Biochemical analysis of transcriptional activation by Jun: differential activity of c- and v-Jun. Cell 59:709-717.[CrossRef][Medline]
  16. 9
  17. Buras, J. A., B. G. Monks, and M. J. Fenton. 1994. The NF-beta A-binding element, not an overlapping NF-IL-6-binding element, is required for maximal IL-1 beta gene expression 1. J. Immunol. 152:4444-4454.[Abstract]
  18. 10
  19. Chinenov, Y., and T. K. Kerppola. 2001. Close encounters of many kinds: Fos-Jun interactions that mediate transcription regulatory specificity. Oncogene 20:2438-2452.[CrossRef][Medline]
  20. 11
  21. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159.[Medline]
  22. 12
  23. Choy, B., and M. R. Green. 1993. Eukaryotic activators function during multiple steps of preinitiation complex assembly. Nature 366:531-536.[CrossRef][Medline]
  24. 13
  25. DeKoter, R. P., and H. Singh. 2000. Regulation of B lymphocyte and macrophage development by graded expression of PU.1 5. Science 288:1439-1441.[Abstract/Free Full Text]
  26. 14
  27. Derijard, B., M. Hibi, I. H. Wu, T. Barrett, B. Su, T. Deng, M. Karin, and R. J. Davis. 1994. JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell 76:1025-1037.[CrossRef][Medline]
  28. 15
  29. Devary, Y., R. A. Gottlieb, L. F. Lau, and M. Karin. 1991. Rapid and preferential activation of the c-jun gene during the mammalian UV response. Mol. Cell. Biol. 11:2804-2811.[Abstract/Free Full Text]
  30. 16
  31. Drewett, V., H. Molina, A. Millar, S. Muller, F. von Hesler, and P. E. Shaw. 2001. DNA-bound transcription factor complexes analysed by mass-spectrometry: binding of novel proteins to the human c-fos SRE and related sequences. Nucleic Acids Res. 29:479-487.[Abstract/Free Full Text]
  32. 17
  33. Eberhardy, S. R., and P. J. Farnham. 2001. c-Myc mediates activation of the cad promoter via a post-RNA polymerase II recruitment mechanism. J. Biol. Chem. 276:48562-48571.[Abstract/Free Full Text]
  34. 18
  35. Eferl, R., and E. F. Wagner. 2003. AP-1: a double-edged sword in tumorigenesis. Nat. Rev. Cancer 3:859-868.[CrossRef][Medline]
  36. 19
  37. Glover, J. N., and S. C. Harrison. 1995. Crystal structure of the heterodimeric bZIP transcription factor c-Fos-c-Jun bound to DNA. Nature 373:257-261.[CrossRef][Medline]
  38. 20
  39. Grondin, B., and N. DeLuca. 2000. Herpes simplex virus type 1 ICP4 promotes transcription preinitiation complex formation by enhancing the binding of TFIID to DNA. J. Virol. 74:11504-11510.[Abstract/Free Full Text]
  40. 21
  41. Hahn, S. 2004. Structure and mechanism of the RNA polymerase II transcription machinery. Nat. Struct. Mol. Biol. 11:394-403.[CrossRef][Medline]
  42. 22
  43. Hambleton, J., S. L. Weinstein, L. Lem, and A. L. DeFranco. 1996. Activation of c-Jun N-terminal kinase in bacterial lipopolysaccharide-stimulated macrophages. Proc. Natl. Acad. Sci. USA 93:2774-2778.[Abstract/Free Full Text]
  44. 23
  45. Hawley, R. G., A. Z. Fong, M. Lu, and T. S. Hawley. 1994. The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors. Oncogene 9:1-12.[Medline]
  46. 24
  47. Herblot, S., A. M. Steff, P. Hugo, P. D. Aplan, and T. Hoang. 2000. SCL and LMO1 alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain expression. Nat. Immunol. 1:138-144.[CrossRef][Medline]
  48. 25
  49. Hoang, T., E. Paradis, G. Brady, F. Billia, K. Nakahara, N. N. Iscove, and I. R. Kirsch. 1996. Opposing effects of the basic helix-loop-helix transcription factor SCL on erythroid and monocytic differentiation. Blood 87:102-111.[Abstract/Free Full Text]
  50. 26
  51. Hohaus, S., M. S. Petrovick, M. T. Voso, Z. Sun, D. E. Zhang, and D. G. Tenen. 1995. PU.1 (Spi-1) and C/EBP alpha regulate expression of the granulocyte-macrophage colony-stimulating factor receptor alpha gene. Mol. Cell. Biol. 15:5830-5845.[Abstract]
  52. 27
  53. Hsu, W., T. K. Kerppola, P. L. Chen, T. Curran, and S. Chen-Kiang. 1994. Fos and Jun repress transcription activation by NF-IL6 through association at the basic zipper region. Mol. Cell. Biol. 14:268-276.[Abstract/Free Full Text]
  54. 28
  55. Iwasaki, H., C. Somoza, H. Shigematsu, E. A. Duprez, J. Iwasaki-Arai, S. Mizuno, Y. Arinobu, K. Geary, P. Zhang, T. Dayaram, M. L. Fenyus, S. Elf, S. Chan, P. Kastner, C. S. Huettner, R. Murray, D. G. Tenen, and K. Akashi. 2005. Distinctive and indispensable roles of PU.1 in maintenance of hematopoietic stem cells and their differentiation. Blood 106:1590-1600.[Abstract/Free Full Text]
  56. 29
  57. Jacobson, R. H., A. G. Ladurner, D. S. King, and R. Tjian. 2000. Structure and function of a human TAFII250 double bromodomain module. Science 288:1422-1425.[Abstract/Free Full Text]
  58. 30
  59. Kim, T. K., and T. Maniatis. 1997. The mechanism of transcriptional synergy of an in vitro assembled interferon-beta enhanceosome. Mol. Cell 1:119-129.[CrossRef][Medline]
  60. 31
  61. Kitamura, T., T. Tange, T. Terasawa, S. Chiba, T. Kuwaki, K. Miyagawa, Y. F. Piao, K. Miyazono, A. Urabe, and F. Takaku. 1989. Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or erythropoietin. J. Cell Physiol. 140:323-334.[CrossRef][Medline]
  62. 32
  63. Klemsz, M. J., S. R. McKercher, A. Celada, C. Van Beveren, and R. A. Maki. 1990. The macrophage and B cell-specific transcription factor PU.1 is related to the ETS oncogene. Cell 61:113-124.[CrossRef][Medline]
  64. 33
  65. Kominato, Y., D. Galson, W. R. Waterman, A. C. Webb, and P. E. Auron. 1995. Monocyte expression of the human prointerleukin 1 beta gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1. Mol. Cell. Biol. 15:58-68.
  66. 34
  67. Kowenz-Leutz, E., and A. Leutz. 1999. A C/EBP beta isoform recruits the SWI/SNF complex to activate myeloid genes. Mol. Cell 4:735-743.[CrossRef][Medline]
  68. 35
  69. Koyama, Y., Y. Tanaka, K. Saito, M. Abe, K. Nakatsuka, I. Morimoto, P. E. Auron, and S. Eto. 1996. Cross-linking of intercellular adhesion molecule 1 (CD54) induces AP-1 activation and IL-1beta transcription. J. Immunol. 157:5097-5103.[Abstract]
  70. 36
  71. Krosl, G., G. He, M. Lefrancois, F. Charron, P. H. Romeo, P. Jolicoeur, I. R. Kirsch, M. Nemer, and T. Hoang. 1998. Transcription factor SCL is required for c-Kit expression and c-Kit function in hemopoietic cells. J. Exp. Med. 188:439-450.[Abstract/Free Full Text]
  72. 37
  73. Langridge, J., P. Langridge, and P. L. Bergquist. 1980. Extraction of nucleic acids from agarose gels. Anal. Biochem. 103:264-271.[CrossRef][Medline]
  74. 38
  75. Lecuyer, E., S. Herblot, M. Saint-Denis, R. Martin, C. G. Begley, C. Porcher, S. H. Orkin, and T. Hoang. 2002. The SCL complex regulates c-Kit expression in hematopoietic cells through functional interaction with Sp1. Blood 100:2430-2440.[Abstract/Free Full Text]
  76. 39
  77. Lemon, B., and R. Tjian. 2000. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 14:2551-2569.[Free Full Text]
  78. 40
  79. Li, A. C., F. R. Guidez, J. G. Collier, and C. K. Glass. 1998. The macrosialin promoter directs high levels of transcriptional activity in macrophages dependent on combinatorial interactions between PU.1 and c-Jun. J. Biol. Chem. 273:5389-5399.[Abstract/Free Full Text]
  80. 41
  81. Liang, M. D., Y. Zhang, D. McDevit, S. Marecki, and B. S. Nikolajczyk. 2006. The interleukin-1ß gene is transcribed from a poised promoter architecture in monocytes. J. Biol. Chem. 281:9227-9237.[Abstract/Free Full Text]
  82. 42
  83. Listman, J. A., N. Wara-aswapati, J. E. Race, L. W. Blystone, N. Walker-Kopp, Z. Yang, and P. E. Auron. 2005. Conserved ETS domain arginines mediate DNA binding, nuclear localization, and a novel mode of bZIP interaction. J. Biol. Chem. 280:41421-41428.[Abstract/Free Full Text]
  84. 43
  85. Lively, T. N., T. N. Nguyen, S. K. Galasinski, and J. A. Goodrich. 2004. The basic leucine zipper domain of c-Jun functions in transcriptional activation through interaction with the N terminus of human TATA-binding protein-associated factor-1 (human TAF(II)250). J. Biol. Chem. 279:26257-26265.[Abstract/Free Full Text]
  86. 44
  87. Lomvardas, S., and D. Thanos. 2001. Nucleosome sliding via TBP DNA binding in vivo. Cell 106:685-696.[CrossRef][Medline]
  88. 45
  89. Lomvardas, S., and D. Thanos. 2002. Modifying gene expression programs by altering core promoter chromatin architecture. Cell 110:261-271.[CrossRef][Medline]
  90. 46
  91. Margueron, R., P. Trojer, and D. Reinberg. 2005. The key to development: interpreting the histone code? Curr. Opin. Genet. Dev. 15:163-176.[CrossRef][Medline]
  92. 47
  93. Martin, M. L., P. M. Lieberman, and T. Curran. 1996. Fos-Jun dimerization promotes interaction of the basic region with TFIIE-34 and TFIIF. Mol. Cell. Biol. 16:2110-2118.[Abstract]
  94. 48
  95. McKercher, S. R., B. E. Torbett, K. L. Anderson, G. W. Henkel, D. J. Vestal, H. Baribault, M. Klemsz, A. J. Feeney, G. E. Wu, C. J. Paige, and R. A. Maki. 1996. Targeted disruption of the PU.1 gene results in multiple hematopoietic abnormalities. EMBO J. 15:5647-5658.[Medline]
  96. 49
  97. Mo, X., E. Kowenz-Leutz, H. Xu, and A. Leutz. 2004. Ras induces mediator complex exchange on C/EBP beta. Mol. Cell 13:241-250.[CrossRef][Medline]
  98. 50
  99. Moulton, K. S., K. Semple, H. Wu, and C. K. Glass. 1994. Cell-specific expression of the macrophage scavenger receptor gene is dependent on PU.1 and a composite AP-1/ets motif. Mol. Cell. Biol. 14:4408-4418.[Abstract/Free Full Text]
  100. 51
  101. Natsuka, S., S. Akira, Y. Nishio, S. Hashimoto, T. Sugita, H. Isshiki, and T. Kishimoto. 1992. Macrophage differentiation-specific expression of NF-IL6, a transcription factor for interleukin-6. Blood 79:460-466.[Abstract/Free Full Text]
  102. 52
  103. Nerlov, C., and T. Graf. 1998. PU.1 induces myeloid lineage commitment in multipotent hematopoietic progenitors. Genes Dev. 12:2403-2412.[Abstract/Free Full Text]
  104. 53
  105. Ness, S. A., E. Kowenz-Leutz, T. Casini, T. Graf, and A. Leutz. 1993. Myb and NF-M: combinatorial activators of myeloid genes in heterologous cell types. Genes Dev. 7:749-759.[Abstract/Free Full Text]
  106. 54
  107. Newman, J. R., and A. E. Keating. 2003. Comprehensive identification of human bZIP interactions with coiled-coil arrays. Science 300:2097-2101.[Abstract/Free Full Text]
  108. 55
  109. Ng, L., D. Forrest, and T. Curran. 1993. Differential roles for Fos and Jun in DNA-binding: redox-dependent and independent functions. Nucleic Acids Res. 21:5831-5837.[Abstract/Free Full Text]
  110. 56
  111. Nikolajczyk, B. S., J. A. Sanchez, and R. Sen. 1999. ETS protein-dependent accessibility changes at the immunoglobulin mu heavy chain enhancer. Immunity 11:11-20.[Medline]
  112. 57
  113. Ogawa, S., J. Lozach, K. Jepsen, D. Sawka-Verhelle, V. Perissi, R. Sasik, D. W. Rose, R. S. Johnson, M. G. Rosenfeld, and C. K. Glass. 2004. A nuclear receptor corepressor transcriptional checkpoint controlling activator protein 1-dependent gene networks required for macrophage activation. Proc. Natl. Acad. Sci. USA 101:14461-14466.[Abstract/Free Full Text]
  114. 58
  115. O'Neil, K. T., R. H. Hoess, and W. F. DeGrado. 1990. Design of DNA-binding peptides based on the leucine zipper motif. Science 249:774-778.[Abstract/Free Full Text]
  116. 59
  117. Papavassiliou, A. G., M. Treier, C. Chavrier, and D. Bohmann. 1992. Targeted degradation of c-Fos, but not v-Fos, by a phosphorylation-dependent signal on c-Jun. Science 258:1941-1944.[Abstract/Free Full Text]
  118. 60
  119. Petrovick, M. S., S. W. Hiebert, A. D. Friedman, C. J. Hetherington, D. G. Tenen, and D. E. Zhang. 1998. Multiple functional domains of AML1: PU.1 and C/EBP{alpha} synergize with different regions of AML1. Mol. Cell. Biol. 18:3915-3925.[Abstract/Free Full Text]
  120. 61
  121. Pongubala, J. M., and M. L. Atchison. 1997. PU.1 can participate in an active enhancer complex without its transcriptional activation domain. Proc. Natl. Acad. Sci. USA 94:127-132.[Abstract/Free Full Text]
  122. 62
  123. Ptashne, M., and A. Gann. 1997. Transcriptional activation by recruitment. Nature 386:569-577.[CrossRef][Medline]
  124. 63
  125. Ranish, J. A., N. Yudkovsky, and S. Hahn. 1999. Intermediates in formation and activity of the RNA polymerase II preinitiation complex: holoenzyme recruitment and a postrecruitment role for the TATA box and TFIIB. Genes Dev. 13:49-63.[Abstract/Free Full Text]
  126. 64
  127. Rosmarin, A. G., D. Caprio, R. Levy, and C. Simkevich. 1995. CD18 (beta 2 leukocyte integrin) promoter requires PU.1 transcription factor for myeloid activity. Proc. Natl. Acad. Sci. USA. 92:801-805.[Abstract/Free Full Text]
  128. 65
  129. Ryseck, R. P., and R. Bravo. 1991. c-JUN, JUN B, and JUN D differ in their binding affinities to AP-1 and CRE consensus sequences: effect of FOS proteins. Oncogene 6:533-542.[Medline]
  130. 66
  131. Sandaltzopoulos, R., and P. B. Becker. 1994. Solid phase DNase I footprinting: quick and versatile. Nucleic Acids Res. 22:1511-1512.[Free Full Text]
  132. 67
  133. Schwartz, C., K. Beck, S. Mink, M. Schmolke, B. Budde, D. Wenning, and K. H. Klempnauer. 2003. Recruitment of p300 by C/EBPbeta triggers phosphorylation of p300 and modulates coactivator activity. EMBO J. 22:882-892.[CrossRef][Medline]
  134. 68
  135. Scott, E. W., M. C. Simon, J. Anastasi, and H. Singh. 1994. Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science 265:1573-1577.[Abstract/Free Full Text]
  136. 69
  137. Sherman, M. L., R. Datta, D. E. Hallahan, R. R. Weichselbaum, and D. W. Kufe. 1990. Ionizing radiation regulates expression of the c-jun protooncogene. Proc. Natl. Acad. Sci. USA. 87:5663-5666.[Abstract/Free Full Text]
  138. 70
  139. Shirakawa, F., K. Saito, C. A. Bonagura, D. L. Galson, M. J. Fenton, A. C. Webb, and P. E. Auron. 1993. The human prointerleukin 1 beta gene requires DNA sequences both proximal and distal to the transcription start site for tissue-specific induction. Mol. Cell. Biol. 13:1332-1344.[Abstract/Free Full Text]
  140. 71
  141. Shivdasani, R. A., and S. H. Orkin. 1996. The transcriptional control of hematopoiesis. Blood 87:4025-4039.[Free Full Text]
  142. 72
  143. Shuman, J. D., C. R. Vinson, and S. L. McKnight. 1990. Evidence of changes in protease sensitivity and subunit exchange rate on DNA binding by C/EBP. Science 249:771-774.[Abstract/Free Full Text]
  144. 73
  145. Smith, S. E., and D. Bohmann. 1992. Functional dissection of AP-1 transcription factors using the Gal4 adaptor assay. Cell Growth Differ. 3:523-529.[Abstract]
  146. 74
  147. Steidl, U., et al. 2006. Essential role of Jun family transcription factors in PU.1 knockdown-induced leukemic stem cells. Nat. Genet. 38:1269-1277.[CrossRef][Medline]
  148. 75
  149. Tanaka, T., S. Akira, K. Yoshida, M. Umemoto, Y. Yoneda, N. Shirafuji, H. Fujiwara, S. Suematsu, N. Yoshida, and T. Kishimoto. 1995. Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 80:353-361.[CrossRef][Medline]
  150. 76
  151. Treier, M., L. M. Staszewski, and D. Bohmann. 1994. Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell 78:787-798.[CrossRef][Medline]
  152. 77
  153. Vinson, C., M. Myakishev, A. Acharya, A. A. Mir, J. R. Moll, and M. Bonovich. 2002. Classification of human B-ZIP proteins based on dimerization properties. Mol. Cell. Biol. 22:6321-6335.[Free Full Text]
  154. 78
  155. Wang, G., M. A. Balamotis, J. L. Stevens, Y. Yamaguchi, H. Handa, and A. J. Berk. 2005. Mediator requirement for both recruitment and postrecruitment steps in transcription initiation. Mol. Cell 17:683-694.[CrossRef][Medline]
  156. 79
  157. Weiss, C., S. Schneider, E. F. Wagner, X. Zhang, E. Seto, and D. Bohmann. 2003. JNK phosphorylation relieves HDAC3-dependent suppression of the transcriptional activity of c-Jun. EMBO J. 22:3686-3695.[CrossRef][Medline]
  158. 80
  159. Yamamoto, H., F. Kihara-Negishi, T. Yamada, Y. Hashimoto, and T. Oikawa. 1999. Physical and functional interactions between the transcription factor PU.1 and the coactivator CBP. Oncogene 18:1495-1501.[CrossRef][Medline]
  160. 81
  161. Yudkovsky, N., J. A. Ranish, and S. Hahn. 2000. A transcription reinitiation intermediate that is stabilized by activator. Nature 408:225-229.[CrossRef][Medline]


Molecular and Cellular Biology, April 2007, p. 2919-2933, Vol. 27, No. 8
0270-7306/07/$08.00+0     doi:10.1128/MCB.00936-06
Copyright © 2007, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Jagannathan, M., Hasturk, H., Liang, Y., Shin, H., Hetzel, J. T., Kantarci, A., Rubin, D., McDonnell, M. E., Van Dyke, T. E., Ganley-Leal, L. M., Nikolajczyk, B. S. (2009). TLR Cross-Talk Specifically Regulates Cytokine Production by B Cells from Chronic Inflammatory Disease Patients. J. Immunol. 183: 7461-7470 [Abstract] [Full Text]  
  • Yu, B., Miao, Z.-H., Jiang, Y., Li, M.-H., Yang, N., Li, T., Ding, J. (2009). c-Jun Protects Hypoxia-Inducible Factor-1{alpha} from Degradation via Its Oxygen-Dependent Degradation Domain in a Nontranscriptional Manner. Cancer Res. 69: 7704-7712 [Abstract] [Full Text]  
  • Tissieres, P., Araud, T., Ochoda, A., Drifte, G., Dunn-Siegrist, I., Pugin, J. (2009). Cooperation between PU.1 and CAAT/Enhancer-binding Protein {beta} Is Necessary to Induce the Expression of the MD-2 Gene. J. Biol. Chem. 284: 26261-26272 [Abstract] [Full Text]  
  • Yang, Z., Kondo, T., Voorhorst, C. S., Nabinger, S. C., Ndong, L., Yin, F., Chan, E. M., Yu, M., Wurstlin, O., Kratz, C. P., Niemeyer, C. M., Flotho, C., Hashino, E., Chan, R. J. (2009). Increased c-Jun Expression and Reduced GATA2 Expression Promote Aberrant Monocytic Differentiation Induced by Activating PTPN11 Mutants. Mol. Cell. Biol. 29: 4376-4393 [Abstract] [Full Text]  
  • Shin, H., Zhang, Y., Jagannathan, M., Hasturk, H., Kantarci, A., Liu, H., Van Dyke, T. E., Ganley-Leal, L. M., Nikolajczyk, B. S. (2009). B cells from periodontal disease patients express surface Toll-like receptor 4. J. Leukoc. Biol. 85: 648-655 [Abstract] [Full Text]  
  • Zhang, Y., Saccani, S., Shin, H., Nikolajczyk, B. S. (2008). Dynamic Protein Associations Define Two Phases of IL-1{beta} Transcriptional Activation. J. Immunol. 181: 503-512 [Abstract] [Full Text]  
  • Schuler, A., Schwieger, M., Engelmann, A., Weber, K., Horn, S., Muller, U., Arnold, M. A., Olson, E. N., Stocking, C. (2008). The MADS transcription factor Mef2c is a pivotal modulator of myeloid cell fate. Blood 111: 4532-4541 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Grondin, B.
Right arrow Articles by Hoang, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Grondin, B.
Right arrow Articles by Hoang, T.