| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

,
Frank O. Bartel,1,2,
Masahiro Masuya,3,
Takao Deguchi,3
Kelly W. Henderson,1,4
Runzhao Li,1,5
Robin C. Muise-Helmericks,1,6
Michael J. Kern,6
Dennis K. Watson,1,5 and
Demetri D. Spyropoulos1,5*
Hollings Cancer Center,1 College of Graduate Studies, Molecular and Cellular Biology and Pathobiology Program,2 Department of Medicine, Experimental Hematology,3 Hematology and Oncology,4 Department of Pathology and Laboratory Medicine,5 Department of Cell Biology and Anatomy, Medical University of South Carolina, 171 Ashley Avenue, Charleston, South Carolina 294256
Received 3 October 2006/ Returned for modification 18 December 2006/ Accepted 21 February 2007
| ABSTRACT |
|---|
|
|
|---|
VII (p42-Ets1). These isoforms bear key distinctions regarding protein-protein interactions, DNA binding kinetics, and transcriptional target specificity. Disruption of both Ets1 isoforms in mice results in the loss of detectable NK and NKT cell activity and defects in B and T lymphocytes. We generated mice that express only the Ets1
VII isoform. Ets1
VII homozygous mice express no p51-Ets1 and elevated levels of the p42-Ets1 protein relative to the wild type and display increased perinatal lethality, thymomegaly, and peripheral lymphopenia. Proliferation was increased in both the thymus and the spleen, while apoptosis was decreased in the thymus and increased in the spleen of homozygotes. Significant elevations of CD8+ and CD8+CD4+ thymocytes were observed. Lymphoid cell (CD19+, CD4+, and CD8+) reductions were predominantly responsible for diminished spleen cellularity, with fewer memory cells and a failure of homeostatic proliferation to maintain peripheral lymphocytes. Collectively, the Ets1
VII mutants demonstrate lymphocyte maturation defects associated with misregulation of p16Ink4a, p27Kip1, and CD44. Thus, a balance in the differential regulation of Ets1 isoforms represents a potential mechanism in the control of lymphoid maturation and homeostasis. | INTRODUCTION |
|---|
|
|
|---|
1 to 5%) lacking the pointed domain of Ets1 (7, 59). These Ets1-null mice present with a deficiency in CD8+ thymocyte development and an elevated proportion of single-positive effector memory (CD62L CD44+) cells in both CD4+ and CD8+ peripheral T-cell populations (7).
The mammalian Ets1 gene produces two major protein isoforms, full-length p51-Ets1 and p42-Ets1, which arise from alternative splicing of exon VII of Ets1 hnRNA with no disruption in the reading frame (5, 24, 29). The p51-Ets1 and p42-Ets1 isoforms have common and distinctive physical properties that allow for both functional redundancy and isoform-specific activities. Shared domains include the Pointed (PNT), transactivation, and ETS DNA binding domains. The domain encoded by exon VII has been identified as a negative regulator and modulator of DNA binding, a mediator of homo- and heterotypic protein-protein interactions, and a target of calcium-mediated phosphorylation (2, 8, 14, 28, 46). Collectively, these distinctions contribute to the Ets1 isoform-specific modulation of particular Ets1 target genes. Exon VII-mediated homotypic and AML1 (Runx1)-Ets1 heterotypic protein-protein interactions augment transcription of MMP-3 and granulocyte-macrophage colony-stimulating factor, respectively (2, 35, 36). Conversely, other target genes, such as the VE-cadherin gene, are transcriptionally activated more strongly by the p42-Ets1 variant in a cell context-specific manner (33). These distinctions are physiologically relevant; ectopic expression of the p42-Ets1 isoform but not the full-length p51-Ets1 isoform in DLD-1 colon cancer cells restores Fas-mediated apoptosis (32). A similar proapoptotic role for the p42-Ets1 isoform has been suggested for MDA-MB-231 invasive breast cancer cells (3). While much work characterizing the functions of Ets1 has been done, relatively little is known about the interplay between the two protein isoforms in mediating these functions in vivo. To extend the functional assessment of Ets1 protein isoforms in vivo, we have generated Ets1
VII gene-targeted mice, which express only the p42-Ets1 isoform (lacking the full-length p51-Ets1 isoform). Analyses of Ets1
VII mice have demonstrated a requirement for the full-length p51-Ets1 isoform in the regulation of lymphopoiesis and homeostasis. Genes important in these processes and misexpressed in Ets1
VII homozygotes include those for p16Ink4a, p27Kip1, and CD44 and provide possible mechanisms for the phenotypes observed.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
Flow cytometry and cell sorting. Thymocytes and splenocytes were prepared as described above. Briefly, 2 x 105 cells were blocked with anti-Fc receptor (553141; BD Biosciences) and stained with combinations of antibodies listed. The antibodies used in these experiments included CD94 (550773; Pharmingen), CD4 (557307; Pharmingen), CD8 (553032, 553034; Pharmingen), CD19 (557398; Pharmingen), CD44 (553134; Pharmingen), Gr-1 (553128; Pharmingen), and Mac-1 (557395; Pharmingen). For annexin V staining, cells were stained according to the manufacturer's instructions (556547; BD Biosciences). Two- and three-color flow cytometric analyses were performed by using a FACScalibur (Becton Dickinson). Each dot plot or histogram represents an analysis of 104 events using WinMDI software version 2.8.
BrdU labeling, histology, and IHC. For detection of 5-bromodeoxyuridine (BrdU) incorporation in vivo by splenocytes and thymocytes, 1.5 mg BrdU (B5002; Sigma) in 150 µl of sterile phosphate-buffered saline was injected intraperitoneally 4 h before organ isolation. Organs were fixed in Amsterdam's fixative, paraffin embedded, and serially sectioned in 7-µm sections. For histological evaluation, the sections were stained with hematoxylin and eosin. For immunohistochemical (IHC) detection of BrdU incorporation into the DNA of dividing cells, sections were deparaffinized and hydrated. Endogenous peroxidase was inhibited by incubation with freshly prepared 3% H2O2 with 0.1% sodium azide. DNA was denatured by acid (4 N HCl) treatment, and nonspecific binding was blocked with 2% bovine serum albumin in phosphate-buffered saline. Sections were incubated with monoclonal anti-BrdU antibody (347580; BD Pharmingen) at a 1:150 dilution overnight at 4°C followed by anti-mouse antibody-HRP (K1015; Dako). After incubation with primary antibody, tissue sections were sequentially incubated with goat anti-mouse antibody-HRP (K1016; Dako) at a dilution of 1:100. Staining was developed with diaminobenzidine (SK-4100; Vector) substrate, and sections were counterstained with hematoxylin.
RT-PCR.
Total RNA was isolated from flow-sorted thymocyte subpopulations using RNA Stat 60 reagent (Cs-111; Tel-Test) according to the manufacturer's protocol. Isolated RNA was DNase I treated to remove genomic DNA. The RNA was reverse transcribed using an Advantage RT-for-PCR kit (639505; Clontech) with oligo(dT) primers. Real-time quantitative PCR (qPCR) reactions were performed in triplicate using Platinum SYBR Green qPCR SuperMix-UDG (11733-038; Invitrogen) and an ABI Prism 5700 real-time PCR machine (Applera). Relative transcript expression was determined by the 
CT method: relative expression is equal to 2(
CTsample
CTßActin), in which CT is the threshold cycle and 40 cycles is the limit of detectable product. Primers were designed to span intron sequences, when possible, and were tested by nonquantitative reverse transcription (RT)-PCR to verify that only one amplicon was produced. The full-length Ets1-specific primer set includes one primer that binds to exon VII sequences. The alternate spliced Ets1
VII-specific primer set includes one primer that spans the exon VI-exon VIII junction. Primers used were as follows: ß-Actin CCGGGACCTGACAGACTACC (forward) and TGCCACAGGATTCCATACCC (reverse); p42Ets1, AGAGCCAGTCGTGGAAGTGG and CGCACGGCTCAGTTTCTCAT; p51Ets1, TAGTTGTGACCGCCTCACCC and TCGGCCCACTTCCTGTGTAG; Cdkn2a, CAGGTGATGATGATGGGCAAC and CAGCGTGTCCAGGAAGCCT; Cdkn1b, CAGGCAAACTCTGAGGACCG and CCTTTTGTTTTGCGAAGAAGAATC; and CD44, CCGCACTGTGACTCATGGAT and CTTCTGCCCACACCTTCTCC.
Statistics. Data are reported as means ± standard errors of the means. Differences in means were analyzed by unpaired t test or analysis of variance (ANOVA), as appropriate, depending upon the number of groups in the analysis. Unpaired t tests were used for post hoc testing. Calculated cell mass was determined as the product of the relative frequency of cells (number of cells/104 events) by total organ weight. This approach was taken as a proxy for the conventional method of taking the product of the estimated total cell number and multiplying it by the relative frequency of cells to determine the absolute cell number.
| RESULTS |
|---|
|
|
|---|
VII-targeted mice.
Homologous recombination in murine ES cells was used to generate Cre-conditional Ets1
VII cell lines, with loxP sites flanking the alternatively spliced exon VII (Fig. 1A, targeted allele). Homologous recombination was observed in 22 of 97 G418-resistant ES cell colonies by Southern blot analysis (a representative example is shown in Fig. 1B). Excision of the floxed exon VII targeted allele was accomplished by adenoviral delivery of Cre recombinase to Ets1
VIIfloxed/+ ES cells and verified in subclones by PCR (Fig. 1C). After in vitro Cre recombination-mediated exon VII deletion, targeted ES cell lines were used to generate aggregation chimeras. Germ line transmission of the targeted allele in chimeric mice was verified by Southern blot analysis of DNA from tail biopsies of agouti offspring (data not shown). Heterozygous offspring were used to establish Ets1
VII 129-strain coisogenic mice, which were interbred for analysis. Loss of the full-length transcript and expression of the Ets1
VII transcript were verified by real-time qPCR (Table 1). Loss of the full-length p51-Ets1 protein and expression of the p42-Ets1 protein was confirmed by Western blotting (Fig. 1D). In the thymus and spleen of wild-type mice, full-length p51-Ets1 is the most abundantly expressed isoform; however, in heterozygotes, there is a marked increase in the expression of the targeted allele (p42-Ets1) and a concomitant decrease in p51-Ets1 expression (Fig. 1D). This result suggests that relative Ets1 isoform levels are maintained in normal lymphoid tissues via a feedback autoregulatory mechanism involving the autoinhibition domain of p51-Ets1 or by changes in posttranscriptional processing. While variable expression levels were reported in other studies (4), we observe that wild-type thymocytes and splenocytes have a reproducibly low proportion of p42-Ets1 protein relative to p51-Ets1 (Fig. 1D, lower band). Homozygote expression of Ets1
VII transcripts ranges from a 12% reduction to a twofold elevation relative to Ets1
VII transcript levels in wild-type mice, depending upon the thymocyte subpopulation analyzed (Table 1). Consistent with other published studies (1), the highest expression of all Ets1 transcripts is in the CD4+CD8+ population of thymocytes in Ets1
VII homozygotes and wild-type littermates (Table 1).
|
VII homozygous mice.
Ets1
VII homozygous mice are born at less than the expected Mendelian ratio from heterozygous intercrosses of 129-strain coisogenic mice, suggesting a low penetrant pre- or perinatal lethality (1:1.7:0.57 +/+:+/:/ survival, n = 242). Surviving mice mature to adulthood, are fertile, and are not overtly distinguishable from wild-type littermates. However, gross anatomic examinations of mice revealed pronounced thymic enlargement (thymomegaly) in homozygotes and more moderate thymomegaly in heterozygotes. The mean thymic weight was 60% greater in homozygotes and 30% greater for heterozygotes than for wild-type littermates (P < 0.000001 by ANOVA) (Fig. 2A). This difference was not attributable to alterations in total body mass between genotypes, as homozygotes have a 69% higher thymus:body mass ratio than wild-type mice (P < 0.000005 by ANOVA) (Fig. 2B). The thymomegaly of heterozygotes is more modest relative to total body mass (Fig. 2B). Thymomegaly in homozygotes was not associated with a histologically identifiable alteration in thymic structure other than increased organ size and more intense hematoxylin staining in the medulla, potentially indicating increased numbers of mature thymocytes (data not shown). Flow cytometric analyses of isolated thymocytes revealed statistically significant differences in relative thymocyte subpopulations, showing increased relative frequency of CD4CD8+ cells (25% increase; P < 0.055) (Fig. 3A to C). To normalize these data to total cell numbers, we multiplied organ weight by relative frequency of each cell type to determine the calculated cell mass for each population. This revealed a trend toward increased mean cell number in all thymocyte subtypes, with a 45% increase in CD4+CD8+ cells and an 86% increase in CD4CD8+ cells, results which achieved statistical significance (P < 0.05) (Fig. 3A, D, and E). Thus, the CD4CD8+ compartment showed both the greatest increase in mean normalized cell number and the highest relative increase in Ets1
VII transcripts. In summary, all thymocyte populations are expanded in the mutant when measured on the basis of normalized cell number and compared to the pool size of these cells in the wild-type mice. Statistical significance was achieved for this difference in the CD4+CD8+ and CD4CD8+ cells but not in the CD4CD8 and CD4+CD8 cells. Also, the normalized cell number increase in CD4CD8+ cells is not accompanied by a decrease in CD4+CD8 cells.
|
|
VII homozygous mice.
Phenotypic differences detected in the peripheral lymphoid compartment of Ets1
VII homozygotes include reduced spleen size (microsplenia) and peripheral blood lymphopenia. A statistically significant 34% decrease in the spleen weight of Ets1
VII homozygous mice was confirmed by ANOVA (P = 0.00006) (Fig. 2C). This phenotype was independent of changes in total body mass. Mean spleen:body mass of homozygotes was 31.5% reduced from the wild-type mean (P < 0.00013 by ANOVA) (Fig. 2D). No statistically significant alteration in the relative frequency of lymphoid-derived cells was observed for homozygotes relative to wild-type littermates (CD19+ B cells, CD94+NK cells, CD4+ T cells, CD8+ T cells) (Fig. 4A and B). However, based on a normalized cell number, statistically significant reductions in both B- and T-lymphocyte populations were observed. B cells were reduced 34% relative to the wild type (P < 0.05), and CD4+ and CD8+ T cells were reduced 29% and 38%, respectively (P < 0.01) (Fig. 4A, right half; Fig. 4C to E). This result is similar to the 22% and 44% reductions reported for Ets1 knockout mice (4). As in the thymus, the CD8+ population is the most severely affected, though the expression level of Ets1
VII transcripts in sorted splenocytes has yet to be determined. In the myeloid compartment, there were no statistically significant alterations in the relative percentages of splenocytes; however, there was a trend toward an increased proportion of myeloid cells (Gr-1+ and/or Mac-1+) (Fig. 5A and B). Consistent with these results, there was a 42% decrease in nonmyeloid cells based on normalized cell numbers (Gr-1Mac-1, P < 0.01) (Fig. 5A, right half; Fig. 5C). Taken together, these results suggest that the underlying microsplenia is likely due to a decrease in lymphoid-derived cells.
|
|
VII homozygous mice.
In addition to microsplenia, an incompletely penetrant lymphopenia in the peripheral blood of three out of seven homozygous mice tested was observed. Affected mice had a 50% reduction in the number of leukocytes per volume of blood and a twofold elevation in the relative percentage of circulating Gr-1hi Mac-1+ cells (data not shown). Collectively, these results suggest that the size of the peripheral lymphocyte pool is dependent upon the expression of proper ratios of both the full-length p51-Ets1 and the p42-Ets1 isoforms.
Increased cell proliferation in lymphoid organs of Ets1
VII homozygous mice.
In order to establish the etiology of the thymomegaly, microsplenia, and peripheral lymphopenia in Ets1
VII mice, we assessed cell size, proliferation, and apoptosis. No significant differences in cell size were detected by comparisons of mean forward scatter of freshly isolated splenocytes and thymocytes, irrespective of genotype (data not shown). To determine the role of cell proliferation in the thymomegaly and microsplenia of Ets1
VII mutants, BrdU was administered to mice intraperitoneally, and S-phase cells were measured by IHC. In contrast to reports of Ets1-null mice having normal cell cycles for unchallenged thymocytes and splenocytes, Ets1
VII homozygotes showed a marked increase in the numbers of proliferative cells of both the spleen and the thymus relative to those of wild-type littermates. In the wild-type thymus, the vast majority of proliferating cells are found in the subcapsular region, with more diffuse BrdU staining in the cortex, and few proliferating cells are detected in the medulla (Fig. 6A). By contrast, thymuses of homozygotes show a marked increase in the levels of proliferating cortical thymocytes, levels comparable to those seen in the subcapsular region (Fig. 6B). The zone of proliferating cells in the subcapsular region of homozygotes appears less organized and less distinct than that observed for wild-type mice. This altered distribution may result from a loss of regional specificity of subcapsular CD4CD8 thymocytes and/or increased proliferation of thymocytes normally found in the cortex. Though our data did not achieve statistical significance, the trend toward an increased relative proportion of CD4CD8 cells suggests the former. These data collectively implicate cell cycle misregulation as contributing to thymomegaly. Spleens of homozygotes were found to have a marked increase in the proliferation of splenocytes in the red pulp (Fig. 6C and D), perhaps as a compensatory response to the marked reduction in the lymphocyte compartment of the spleen (Fig. 4). No obvious change in proliferation was observed for the white pulp splenocytes, with germinal centers being observed for both wild types and homozygotes.
|
VII mutant mice.
To determine the contribution of apoptosis to the thymomegaly and microsplenia in Ets1
VII mice, primary thymocytes and splenocytes were stained with annexin V and subjected to flow cytometric quantification. Annexin V detects the early membrane asymmetry of phosphatidylserine characteristic of cells initiating apoptosis. Consistent with the observed thymomegaly, thymocytes of both Ets1
VII homozygotes and heterozygotes had a 50% mean reduction in the frequency of apoptosis compared to wild-type littermates (P < 0.001) (Fig. 7A).
|
Reduced expression of key cell cycle regulators p16Ink4a and p27Kip1 in thymuses of Ets1
VII homozygous mice.
To investigate the molecular mechanism underlying the increased proliferation in Ets1
VII thymuses, we studied the expression of p16Ink4a (Cdkn2a) and p27Kip1 (Cdkn1b). These two proteins are reported to be expressed throughout the thymus, at levels consistent with roles as important negative regulators of thymocyte proliferation in mice (26). Furthermore, alterations in the expression of these proteins have been shown to be important in lymphoid organ size. RT-PCR analyses of littermates demonstrate a slightly diminished expression of Cdkn1b transcripts in homozygotes relative to wild types (Fig. 8A). Western blot analyses of protein from Ets1
VII homozygotes and heterozygotes show profound decreases in p27Kip1 protein expression relative to those for wild-type littermates (Fig. 8B). Ets1 has been implicated as a direct regulator of Cdkn2a transcription (23, 43). RT-PCR analyses of littermates also demonstrate a diminished expression of Cdkn2a transcripts in homozygotes relative to wild types (Fig. 8C). These results suggest that full-length p51-Ets1 may positively regulate the expression of these genes to limit proliferation in the thymus and spleen of wild-type mice.
|
VII homozygous mice.
Full-length p51-Ets1 participates in promoter regulation via cooperative binding. The murine CD44 gene has three putative heterodimeric Ets/Runx1 (AML1) binding sites, which may be occupied by p51-Ets1 and partner AML1 in cooperative binding (Fig. 9A). RT-PCR analyses of thymocyte and splenocyte mRNA demonstrated greatly diminished expression of CD44 transcripts in Ets1
VII mice (Fig. 9B), even when cycle number was increased and other CD44-specific primer pairs were used (data not shown). Cell-surface expression of CD44 is important for homing of thymic progenitors from the bone marrow to the thymus and also as a definitive differentiation antigen of subtypes of CD4CD8 thymocytes. Flow cytometric analysis of thymocyte cell-surface CD44 expression demonstrated a reduced frequency of CD44-expressing cells compared to wild types; a slight reduction in heterozygotes and an additional 40% reduction in homozygotes was observed (Fig. 9C).
|
| DISCUSSION |
|---|
|
|
|---|
VII mutant to those previously published for Ets1 knockout mice is presented in Table 2. An analysis of Ets1
VII mutants demonstrates that the absence of full-length p51-Ets1 is associated with superphysiological expression of p42-Ets1, increased proliferation, and altered apoptosis. Increased proliferation in the thymus and spleen of homozygotes was observed, with associated reductions in the expression of p16Ink4a and p27Kip1, whereas results for heterozygotes were more comparable to those for wild types (Fig. 8). Thymocytes of both Ets1
VII homozygotes and heterozygotes had a 50% mean reduction in apoptosis, compared to that of wild-type littermates (Fig. 7A). This contrasts with the diminished survival reported for Ets1 knockout mice and complemented Rag2/ chimeras (12, 40). These results suggest that dosage of Ets1 isoforms may be a critical modulator of apoptosis, as Ets1
VII heterozygous mice exhibit an intermediate effect on apoptosis.
|
VII homozygotes, suggesting that this phenotype begins at the earliest (CD4CD8) stage of thymopoiesis. At this stage, Ets1
VII may act as a downstream amplifier of pre-TCR signals. This is plausible mechanistically, given that the pre-TCR proliferative signal is transduced by Ras/Erk1/2, which may impinge on Ets1. ERK1/2 phosphorylation of Thr38 residue on both Ets1 isoforms has been demonstrated to augment Ets1 transcriptional activity (49). Also, CD4CD8 cells have a lower threshold for ligand-independent pre-TCR signaling, based in part on increased Ca2+ capacitive entry (20, 45). This is significant, considering that such Ca2+ flux-mediated signaling normally represses full-length p51-Ets1, but not p42-Ets1, transcriptional activity. Thus, in Ets1
VII mutants, p42-Ets1 not only is expressed at higher levels than normal but also may represent a more active transcriptional regulator based on a lack of responsiveness to the inhibitory Ca2+ signal. We have shown that p16Ink4a levels are diminished in the Ets1
VII homozygote thymus. p16Ink4a is known to antagonize pre-TCR-mediated expansion and/or survival of differentiating thymocytes (30). Collectively, these data may implicate either hyperactivation of Ets1 downstream effector functions in response to pre-TCR signal or transduction of a spurious signal (57). Alterations in the expression of p16Ink4a or p27Kip1 have also been shown to be important in lymphoid organ size. Mice transgenic for either p16Ink4a or p27Kip1 show partial developmental arrest at the CD4CD8 stage and reduced proliferation and function of lymphocytes (30, 56). Gene-targeted mice deficient in either p16Ink4a or p27Kip1 develop thymic hyperplasia (41, 13, 51). Mice deficient in p27Kip1 also develop splenic hyperplasia. Chromatin immunoprecipitation demonstrates that Ets1 binds to the Cdkn2a promoter in vivo, supporting the notion that it is a direct Ets1 target (43). Our results argue that full-length Ets1 positively regulates these genes in the thymus and spleen of wild-type mice; therefore, in Ets1
VII thymuses, these genes are not activated and cause increased proliferation. Thus, the thymomegaly phenotype could be due to elevated expression of the p42-Ets1 isoform and/or the loss of the full-length p51-Ets1 isoform, with a balance of isoforms being more important in the regulation of apoptosis and the presence of p51-Ets1 (even at low levels) being more important in the suppression of proliferation. Thymomegaly in Ets1
VII mutants contrasts with the 65% reduction in thymic cellularity reported for Ets1-null animals (Table 2; 4, 7). Furthermore, the loss of both Ets1 isoforms results in the absence of proliferative phenotypes (reduced thymic cellularity), arguing that the thymomegaly phenotype results from elevated expression of p42-Ets1 (40). Nevertheless, it can also be argued that the presence of low levels of p51-Ets1 counteracts the effects of elevated p42-Ets1 levels, as observed in Ets1
VII heterozygotes. In addition, the continued expression of the Ets1
VII allele may block a compensatory response that is active in Ets1 knockout mice. This could explain the relatively large increase in p42-Ets1 protein expression shown on immunoblots compared to the twofold elevation at the transcript level, which may suggest the involvement of posttranscriptional regulation of Ets1 expression (Fig. 1D; Table 1).
Diminished spleen mass with no disruption in the organization of red pulp, white pulp, and germinal centers is a disorder generally referred to as microsplenia and a phenotype observed for Ets1
VII mutant mice. No change in proliferation was observed in the white pulp splenocytes, with germinal centers being observed for both wild-type and Ets1
VII homozygotes (Fig. 4 and 6). Since the majority of splenic lymphoid cells are located in the white pulp region, these results indicate that the observed increase in splenic red pulp proliferation is due to either nonlymphoid cells or ectopic lymphocytes. Since myeloid cell numbers in Ets1
VII mutants were normal, this result would also suggest either that there is either (i) a global induction of apoptosis across splenocyte lineages and myeloid cells but not lymphoid cells (which are able to mount proliferative compensation) or (ii) a mislocalization of lymphocytes that are undergoing proliferative expansion (e.g., homeostatic expansion). Such a mislocalization may result in the loss of appropriate costimulation and contribute to the elevated apoptosis that is observed with these animals. The presence of organized white pulp and germinal centers suggests that lymphocyte migration and immune response may not be completely lost in Ets1
VII homozygotes.
We have also demonstrated a role for Ets1 isoforms in maintaining peripheral lymphoid homeostasis. There are many models that can be proposed to explain how Ets1 may exert these effects. Peripheral lymphopenia in the Ets1
VII homozygotes may be due to defects in primary thymopoiesis. Alternatively, the reverse could be the case, i.e., peripheral lymphopenia may drive defects in primary thymopoiesis. One model is that Ets1 functions in primary thymopoiesis as a survival signal. Elevated p42-Ets1 expression in Ets1
VII mutants results in abnormally high-level survival of T cells that would normally have been lost during negative selection. These defective T cells have persistently high-level Ets1 expression, which normally diminishes with migration to the periphery (Fig. 1D), and they may have abnormal TCR signaling. Upon entry into the peripheral compartment, however, such defects would render these surviving mutant T cells more susceptible to marked apoptosis, as shown by the Ets1
VII mutants.
In the thymus and peripheral lymphoid compartment, cell-surface receptor expression, cell division, and apoptosis exert strict controls on lymphocyte type and number. Lymphocyte homeostasis can control the balance between an insufficient number of cells to mount an immune response or the excessive proliferation and/or overstimulation of an immune response associated with pathological conditions, such as cancer and autoimmune disorders (16, 42). Studies using antibodies to block CD44 function have demonstrated a role in lymphocyte activation, differentiation, homing/migration, and proliferation (15, 21, 31, 44, 47). We have shown that CD44 expression is diminished in the Ets1
VII mutants. As CD44 is important in the homing of thymic progenitors to the subcapsular region of the thymus, the disorganization of this region in Ets1
VII homozygotes, as shown by BrdU IHC data, suggests the possibility that diminished CD44 expression may lead to ectopic localization of these cells throughout the cortex (Fig. 6; data not shown). In experimental lymphopenia, antigen-independent proliferation of cells expressing memory cell markers (CD44Hi, CD122+, Ly6C+) leads to recovery of normal or near-normal lymphocyte numbers (39). Such homeostatic proliferation occurs from the expansion of preexisting memory cells or from naïve cells that acquire memory cell characteristics (27, 55). The process requires normal thymopoiesis to establish a competent naïve pool that expresses the required cytokines (e.g., interleukin 7) and has the ability to upregulate the genetic program(s) required for the memory cell phenotype.
Flow cytometric analysis of splenocytes from wild-type mice revealed 8 to 18% of cells to be CD44hi (Fig. 9D). In marked contrast, heterozygotes and homozygotes had a 50% reduction in the mean relative frequency of these cells (Fig. 9D). This difference is even more pronounced when considering the fact that affected mice have microsplenia and that the relative frequency corresponds to a much lower absolute number of cells. Thus, the resulting naïve cell pool for the Ets1
VII mutants is expected to be defective in effecting an immune response and in establishing a memory cell phenotype. While it is not clear the relative contributions of memory cells or cells undergoing homeostatic proliferation accounting for the remaining CD44hi splenocytes in homozygotes, two things are clear: (i) that there are fewer cells with the memory phenotype than would be expected for wild-type mice and (ii) that there is a failure of homeostatic proliferation to maintain proper numbers of peripheral lymphocytes. Moreover, CD44 has been shown to affect cell proliferation via posttranslational control of p27Kip1 expression (17) and, thus, could contribute to the diminished expression of p27Kip1 protein in Ets1
VII heterozygotes and homozygotes (Fig. 8B). Supporting this possibility is the observed dramatic loss of CD44 expression in the thymus and spleen of Ets1
VII homozygotes, as shown by RT-PCR (Fig. 9B).
Alterations in the splenic microenvironment, for example, by deregulation of Fas or TNF expression, could also contribute to the peripheral lymphopenia phenotype. A marked increase in proliferation in spleens of Ets1
VII homozygotes was observed, indicating the possibility that homeostatic proliferation is initiated but with defective lymphocytes undergoing apoptosis at an accelerated rate. In the periphery, CD44 expression is a marker of activated cells, memory cells, and cells undergoing homeostatic proliferation. In unpublished observations, we have confirmed the loss of memory cell function in these mice by vaccination with the MVA strain of vaccinia virus, followed by a challenge one week later (data not shown). The day following challenge, gamma interferon (IFN-
) production was elevated in wild-type mice, while IFN-
levels in homozygotes was equivalent to levels in baseline unchallenged mice (data not shown). This rapid IFN-
response is a measure of memory cell activity (34).
Collectively, these results indicate isoform-specific requirements for Ets1 in the control of normal thymopoiesis, T-cell homeostasis, and peripheral lymphoid homeostasis. Ongoing studies are focused on the impact of compensatory mechanisms induced by persistent or transient imbalances in Ets1 isoform expression. Such compensatory mechanisms can be pursued in vivo and in vitro using inducible, tissue-specific, Cre excision-mediated disruption of the conditional Ets1VII allele described here.
| ACKNOWLEDGMENTS |
|---|
We acknowledge Takis S. Papas for his role in inspiring the initiation of this project, Makio Ogawa for helpful suggestions and guidance during the course of this work, Yong Z. Gong and the MUSC Gene Targeting & Knockout Mouse Facility for their assistance in the generation of the gene-targeted mouse lines described, HaiQun Zeng and the Hollings Cancer Center Cell Sorting Facility for cellular analyses, and E. Starr Hazard and the Biomolecular Computing Resource for assistance with bioinformatic computations.
| FOOTNOTES |
|---|
Published ahead of print on 5 March 2007. ![]()
T.H. and F.O.B. contributed equally to this work. ![]()
Present address: First Department of Internal Medicine, Shinshu University School of Medicine, Matsumoto, 3-1-1 Asahi, Matsumoto 390-8621, Japan. ![]()
Present address: Division of Blood Transfusion, Mie University Hospital, Takao Deguchi, Department of Pediatrics, Mie University School of Medicine, 2-174 Edobashi, Tsu City, Mie 514-8507, Japan. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Baillat, D., A. Begue, D. Stehelin, and M. Aumercier. 2002. ETS-1 transcription factor binds cooperatively to the palindromic head to head ETS-binding sites of the stromelysin-1 promoter by counteracting autoinhibition. J. Biol. Chem. 277:29386-29398.
3. Ballschmieter, P., M. Braig, R. K. Lindemann, A. Nordheim, and J. Dittmer. 2003. Splicing variant DeltaVII-Ets1 is downregulated in invasive Ets1-expressing breast cancer cells. Int. J. Oncol. 22:849-853.[Medline]
4. Barton, K., N. Muthusamy, C. Fischer, C. N. Ting, T. L. Walunas, L. L. Lanier, and J. M. Leiden. 1998. The Ets-1 transcription factor is required for the development of natural killer cells in mice. Immunity 9:555-563.[CrossRef][Medline]
5. Bellacosa, A., K. Datta, S. E. Bear, C. Patriotis, P. A. Lazo, N. G. Copeland, N. A. Jenkins, and P. N. Tsichlis. 1994. Effects of provirus integration in the Tpl-1/Ets-1 locus in Moloney murine leukemia virus-induced rat T-cell lymphomas: levels of expression, polyadenylation, transcriptional initiation, and differential splicing of the Ets-1 mRNA. J. Virol. 68:2320-2330.
6. Bories, J. C., D. M. Willerford, D. Grevin, L. Davidson, A. Camus, P. Martin, D. Stehelin, and F. W. Alt. 1995. Increased T-cell apoptosis and terminal B-cell differentiation induced by inactivation of the Ets-1 proto-oncogene. Nature 377:635-638.[CrossRef][Medline]
7. Clements, J. L., S. A. John, and L. A. Garrett-Sinha. 2006. Impaired generation of CD8+ thymocytes in Ets-1-deficient mice. J. Immunol. 177:905-912.
8. Cowley, D. O., and B. J. Graves. 2000. Phosphorylation represses Ets-1 DNA binding by reinforcing autoinhibition. Genes Dev. 14:366-376.
9. Degnan, B. M., S. M. Degnan, T. Naganuma, and D. E. Morse. 1993. The ets multigene family is conserved throughout the Metazoa. Nucleic Acids Res. 21:3479-3484.
10. Dittmer, J. 2003. The biology of the Ets1 proto-oncogene. Mol. Cancer 2:29.[CrossRef][Medline]
11. Eyquem, S., K. Chemin, M. Fasseu, and J. C. Bories. 2004. The Ets-1 transcription factor is required for complete pre-T cell receptor function and allelic exclusion at the T cell receptor beta locus. Proc. Natl. Acad. Sci. USA 101:15712-15717.
12. Eyquem, S., K. Chemin, M. Fasseu, M. Chopin, F. Sigaux, A. Cumano, and J. C. Bories. 2004. The development of early and mature B cells is impaired in mice deficient for the Ets-1 transcription factor. Eur. J. Immunol. 34:3187-3196.[CrossRef][Medline]
13. Fero, M. L., M. Rivkin, M. Tasch, P. Porter, C. E. Carow, E. Firpo, K. Polyak, L. H. Tsai, V. Broudy, R. M. Perlmutter, K. Kaushansky, and J. M. Roberts. 1996. A syndrome of multiorgan hyperplasia with features of gigantism, tumorigenesis, and female sterility in p27(Kip1)-deficient mice. Cell 85:733-744.[CrossRef][Medline]
14. Fisher, R. J., M. Fivash, J. Casas-Finet, J. W. Erickson, A. Kondoh, S. V. Bladen, C. Fisher, D. K. Watson, and T. Papas. 1994. Real-time DNA binding measurements of the ETS1 recombinant oncoproteins reveal significant kinetic differences between the p42 and p51 isoforms. Protein Sci. 3:257-266.[Abstract]
15. Foger, N., R. Marhaba, and M. Zoller. 2000. CD44 supports T cell proliferation and apoptosis by apposition of protein kinases. Eur. J. Immunol. 30:2888-2899.[CrossRef][Medline]
16. Fry, T. J., B. L. Christensen, K. L. Komschlies, R. E. Gress, and C. L. Mackall. 2001. Interleukin-7 restores immunity in athymic T-cell-depleted hosts. Blood 97:1525-1533.
17. Gadhoum, Z., M. P. Leibovitch, J. Qi, D. Dumenil, L. Durand, S. Leibovitch, and F. Smadja-Joffe. 2004. CD44: a new means to inhibit acute myeloid leukemia cell proliferation via p27Kip1. Blood 103:1059-1068.
18. Green, D. R., N. Droin, and M. Pinkoski. 2003. Activation-induced cell death in T cells. Immunol. Rev. 193:70-81.[CrossRef][Medline]
19. Grenningloh, R., B. Y. Kang, and I. C. Ho. 2005. Ets-1, a functional cofactor of T-bet, is essential for Th1 inflammatory responses. J. Exp. Med. 201:615-626.
20. Haks, M. C., S. M. Belkowski, M. Ciofani, M. Rhodes, J. M. Lefebvre, S. Trop, P. Hugo, J. C. Zuniga-Pflucker, and D. L. Wiest. 2003. Low activation threshold as a mechanism for ligand-independent signaling in pre-T cells. J. Immunol. 170:2853-2861.
21. Hogerkorp, C. M., S. Bilke, T. Breslin, S. Ingvarsson, and C. A. Borrebaeck. 2003. CD44-stimulated human B cells express transcripts specifically involved in immunomodulation and inflammation as analyzed by DNA microarrays. Blood 101:2307-2313.
22. Hsu, T., and R. A. Schulz. 2000. Sequence and functional properties of Ets genes in the model organism Drosophila. Oncogene 19:6409-6416.[CrossRef][Medline]
23. Huot, T. J., J. Rowe, M. Harland, S. Drayton, S. Brookes, C. Gooptu, P. Purkis, M. Fried, V. Bataille, E. Hara, J. Newton-Bishop, and G. Peters. 2002. Biallelic mutations in p16INK4a confer resistance to Ras- and Ets-induced senescence in human diploid fibroblasts. Mol. Cell. Biol. 22:8135-8143.
24. Jorcyk, C. L., D. K. Watson, G. J. Mavrothalassitis, and T. S. Papas. 1991. The human ETS1 gene: genomic structure, promoter characterization and alternative splicing. Oncogene 6:523-532.[Medline]
25. Kaartinen, V., and A. Nagy. 2001. Removal of the floxed neo gene from a conditional knockout allele by the adenoviral Cre recombinase in vivo. Genesis 31:126-129.[CrossRef][Medline]
26. Kanavaros, P., K. Stefanaki, D. Rontogianni, D. Papalazarou, M. Sgantzos, D. Arvanitis, C. Vamvouka, V. Gorgoulis, I. Siatitsas, N. J. Agnantis, and M. Bai. 2001. Immunohistochemical expression of p53, p21/waf1, rb, p16, cyclin D1, p27, Ki67, cyclin A, cyclin B1, bcl2, bax and bak proteins and apoptotic index in normal thymus. Histol. Histopathol. 16:1005-1012.[Medline]
27. Kieper, W. C., and S. C. Jameson. 1999. Homeostatic expansion and phenotypic conversion of naive T cells in response to self peptide/MHC ligands. Proc. Natl. Acad. Sci. USA 96:13306-13311.
28. Kim, W. Y., M. Sieweke, E. Ogawa, H. J. Wee, U. Englmeier, T. Graf, and Y. Ito. 1999. Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains. EMBO J. 18:1609-1620.[CrossRef][Medline]
29. Koizumi, S., R. J. Fisher, S. Fujiwara, C. Jorcyk, N. K. Bhat, A. Seth, and T. S. Papas. 1990. Isoforms of the human ets-1 protein: generation by alternative splicing and differential phosphorylation. Oncogene 5:675-681.[Medline]
30. Lagresle, C., B. Gardie, S. Eyquem, M. Fasseu, J. C. Vieville, M. Pla, F. Sigaux, and J. C. Bories. 2002. Transgenic expression of the p16INK4a cyclin-dependent kinase inhibitor leads to enhanced apoptosis and differentiation arrest of CD4CD8 immature thymocytes. J. Immunol. 168:2325-2331.
31. Lesley, J., R. Hyman, and P. W. Kincade. 1993. CD44 and its interaction with extracellular matrix. Adv. Immunol. 54:271-335.[Medline]
32. Li, R., H. Pei, and T. Papas. 1999. The p42 variant of ETS1 protein rescues defective Fas-induced apoptosis in colon carcinoma cells. Proc. Natl. Acad. Sci. USA 96:3876-3881.
33. Lionneton, F., E. Lelievre, D. Baillat, D. Stehelin, and F. Soncin. 2003. Characterization and functional analysis of the p42Ets-1 variant of the mouse Ets-1 transcription factor. Oncogene 22:9156-9164.[CrossRef][Medline]
34. Liu, F., and J. L. Whitton. 2005. Cutting edge: re-evaluating the in vivo cytokine responses of CD8+ T cells during primary and secondary viral infections. J. Immunol. 174:5936-5940.
35. Liu, H., and T. Grundstrom. 2002. Calcium regulation of GM-CSF by calmodulin-dependent kinase II phosphorylation of Ets1. Mol. Biol. Cell 13:4497-4507.
36. Liu, H., M. Holm, X. Q. Xie, M. Wolf-Watz, and T. Grundstrom. 2004. AML1/Runx1 recruits calcineurin to regulate granulocyte macrophage colony-stimulating factor by Ets1 activation. J. Biol. Chem. 279:29398-29408.
37. Lucas, B., F. Vasseur, and C. Penit. 1993. Normal sequence of phenotypic transitions in one cohort of 5-bromo-2'-deoxyuridine-pulse-labeled thymocytes. Correlation with T cell receptor expression. J. Immunol. 151:4574-4582.[Abstract]
38. Maroulakou, I. G., and D. B. Bowe. 2000. Expression and function of Ets transcription factors in mammalian development: a regulatory network. Oncogene 19:6432-6442.[CrossRef][Medline]
39. Murali-Krishna, K., and R. Ahmed. 2000. Cutting edge: naive T cells masquerading as memory cells. J. Immunol. 165:1733-1737.
40. Muthusamy, N., K. Barton, and J. M. Leiden. 1995. Defective activation and survival of T cells lacking the Ets-1 transcription factor. Nature 377:639-642.[CrossRef][Medline]
41. Nakayama, K., N. Ishida, M. Shirane, A. Inomata, T. Inoue, N. Shishido, I. Horii, D. Y. Loh, and K. Nakayama. 1996. Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell 85:707-720.[CrossRef][Medline]
42. O'Flaherty, E., W. K. Wong, S. J. Pettit, K. Seymour, S. Ali, and J. A. Kirby. 2000. Regulation of T-cell apoptosis: a mixed lymphocyte reaction model. Immunology 100:289-299.[CrossRef][Medline]
43. Ohtani, N., Z. Zebedee, T. J. Huot, J. A. Stinson, M. Sugimoto, Y. Ohashi, A. D. Sharrocks, G. Peters, and E. Hara. 2001. Opposing effects of Ets and Id proteins on p16INK4a expression during cellular senescence. Nature 409:1067-1070.[CrossRef][Medline]
44. Ponta, H., L. Sherman, and P. A. Herrlich. 2003. CD44: from adhesion molecules to signalling regulators. Nat Rev. Mol. Cell. Biol. 4:33-45.[CrossRef][Medline]
45. Puthier, D., F. Joly, M. Irla, M. Saade, G. Victorero, B. Loriod, and C. Nguyen. 2004. A general survey of thymocyte differentiation by transcriptional analysis of knockout mouse models. J. Immunol. 173:6109-6118.