This Article Abstract Full Text (PDF) Supplemental material Other Versions of this Article: MCB.00607-07v1 28/1/435    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by DeRan, M. Articles by Zhao, J. Search for Related Content PubMed PubMed Citation Articles by DeRan, M. Articles by Zhao, J.

Transcriptional Activation of Histone Genes Requires NPAT-Dependent Recruitment of TRRAP-Tip60 Complex to Histone Promoters during the G₁/S Phase Transition ^,

Michael DeRan,^1,2, Mary Pulvino,^1, Eriko Greene,^1, Chuan Su,^1,¶ and Jiyong Zhao^1*

Department of Biomedical Genetics,¹ Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester New York 14642²

Received 6 April 2007/ Returned for modification 15 June 2007/ Accepted 11 October 2007

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Transcriptional activation of histone subtypes is coordinately regulated and tightly coupled with the onset of DNA replication during S-phase entry. The underlying molecular mechanisms for such coordination and coupling are not well understood. The cyclin E-Cdk2 substrate NPAT has been shown to play an essential role in the transcriptional activation of histone genes at the G₁/S-phase transition. Here, we show that NPAT interacts with components of the Tip60 histone acetyltransferase complex through a novel amino acid motif, which is functionally conserved in E2F and adenovirus E1A proteins. In addition, we demonstrate that transformation/transactivation domain-associated protein (TRRAP) and Tip60, two components of the Tip60 complex, associate with histone gene promoters at the G₁/S-phase boundary in an NPAT-dependent manner. In correlation with the association of the TRRAP-Tip60 complex, histone H4 acetylation at histone gene promoters increases at the G₁/S-phase transition, and this increase involves NPAT function. Suppression of TRRAP or Tip60 expression by RNA interference inhibits histone gene activation. Thus, our data support a model in which NPAT recruits the TRRAP-Tip60 complex to histone gene promoters to coordinate the transcriptional activation of multiple histone genes during the G₁/S-phase transition.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Histone proteins are integral components of eukaryotic chromatin and play crucial roles in virtually all cellular processes that involve chromosomal DNA, such as DNA replication, transcription, DNA repair, recombination, and chromosome segregation (27, 28). The bulk of the histones are assembled with genomic DNA into chromosomes, and the biosynthesis of multiple histone subtypes (replication-dependent histones) is tightly coordinated and coupled with DNA synthesis during the S phase of the cell cycle (20, 36, 45, 51). Perturbation of such coordination and coupling can lead to the loss of chromosomes, DNA damage, and developmental arrest (39, 55, 62, 64), underscoring the importance of the proper regulation of these events.

The rate of histone synthesis in S phase is regulated at both the transcriptional and the posttranscriptional levels (20, 36, 45, 51). Histone gene transcription increases from 3- to 10-fold as cells enter S phase (20). The transcription of each histone subtype (H1, H2A, H2B, H3, and H4) in S phase is likely regulated by proteins or protein complexes that interact directly with the subtype-specific regulatory elements (SSREs) in the promoters of replication-dependent histone genes (20, 45). Indeed, it has been shown that Oct1 and its coactivator complex OCA-S interact with the H2B SSRE to activate H2B transcription, while HiNF-P interacts with the H4 SSRE to stimulate H4 expression (14, 40, 67). Components of OCA-S include nuclear p38/glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase, and the activity of OCA-S is regulated by NAD⁺ and NADH, suggesting a link between the histone gene transcription and the cellular metabolic state/redox status (67). The molecular mechanism underlying the regulation of H2B transcription by Oct1/OCA-S and cellular metabolic/redox states, however, is not yet clear. The mechanism of HiNF-P action is also not fully understood. Additional protein factors, such as YY1, HIRA, FLASH, and BZAP45, have also been implicated in the regulation of histone gene transcription with unknown molecular mechanisms (3, 12, 19, 31, 41, 61).

We and others have demonstrated previously that the cyclin E-Cdk2 substrate NPAT associates with histone gene promoters in S phase (66, 67). The overexpression of NPAT activates promoters of multiple histone genes through the SSREs within the promoters (66). The suppression of NPAT expression through RNA interference or conditional knockout impedes expression of all histone subtypes (16, 63). The promoter DNA sequences of different histone subtypes are quite divergent, and direct DNA binding by NPAT has not been detected. Therefore, it was proposed that coordination of the transcription of multiple histone subtypes by NPAT probably occurs through the interaction of NPAT with factors that regulate transcription of the individual subtypes (66). Indeed, both the physical and the functional interactions of NPAT with Oct-1/OCA-S and HiNF-P have been demonstrated (40, 67). Additionally, it has been shown that both the association of NPAT with histone promoters and the NPAT-mediated histone transcriptional activation are regulated by cyclin E-Cdk2 phosphorylation (34, 53, 66). Hence, NPAT functions as a key global regulator of coordinated transcriptional activation of multiple histone subtypes during the G₁/S-phase transition and links the cell cycle machinery to the regulation of histone gene expression. In addition to histone gene expression, NPAT has been shown to play a critical role in S-phase entry (16, 63, 65). Thus, NPAT may also play a role in coupling histone expression with the onset of DNA synthesis.

Despite recent advances in our understanding of the regulation of histone gene transcription, the molecular mechanisms underlying NPAT function, as well as the coordinated transcriptional activation of histone subtypes and the coupling of histone gene expression with DNA replication, have remained largely unknown. Given the importance of NPAT in histone gene transcription, an understanding of NPAT function would likely advance the elucidation of these mechanisms.

The transformation/transactivation domain-associated protein (TRRAP) was initially identified as a factor that interacts with the N terminus of c-Myc, as well as with the transactivation domain of E2F (37). TRRAP is an essential cofactor for oncogenic transformation by c-Myc and E1A through its direct interaction with these proteins (7, 37, 46). TRRAP also functions as an essential cofactor for E2F-mediated transcriptional activation (30). TRRAP, as well as its Saccharomyces cerevisiae homolog Tra1, has been shown to be a key component of several multiprotein histone acetyltransferase (HAT) complexes (4, 6, 8, 24, 35, 52, 58) and is likely involved in the recruitment of one or more of these HAT complexes to target gene promoters through its interaction with transcriptional activators, such as c-Myc, E2Fs, and p53 (2, 5, 15, 38, 56). In addition to transcription-related functions, the TRRAP-containing HAT complexes are also directly involved in double-stranded DNA break repair (6, 24, 42, 47, 50). Thus, TRRAP plays crucial roles in both the proliferation control and the maintenance of genomic integrity.

To elucidate the molecular mechanism by which NPAT regulates transcriptional activation of histone genes, we carried out a systematic deletion analysis to identify the domain(s) critical for NPAT function. Here, we describe the identification of a novel amino acid sequence motif termed the DLFD motif, which is conserved in the NPAT, E2F, and E1A proteins and is involved in the functions of these proteins. Our data, together with previous observations, indicate that the DLFD motif is required for the interaction of NPAT, and likely that of E2F and E1A, with the cofactor TRRAP. Moreover, our results show that TRRAP and Tip60 are recruited to histone gene promoters at the G₁/S-phase boundary by NPAT and are required for the transcriptional activation of histone genes. Consistent with the NPAT-dependent recruitment of TRRAP-Tip60, histone H4 acetylation at histone promoters also increases during the G₁/S-phase transition in an apparently NPAT-dependent manner. These results suggest a mechanism by which the transcriptional activation of histone genes is coordinately regulated during S-phase entry.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Cell culture, transfection, immunoprecipitation, luciferase reporter assays, Northern blotting, and antibodies. Human osteosarcoma U2OS cells and human embryonic kidney 293T (HEK293T) cells were purchased from ATCC and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (FBS). Human colon carcinoma HCT116 cells carrying one conditional allele of NPAT and one wild-type allele (referred to as NPAT^flox/– [63]) were generously provided by Wade Harper. Transient transfections were carried out either by calcium precipitation or by using FuGENE6 (Roche) as described previously (65, 66). Luciferase reporter assays, chromatin immunoprecipitation (ChIP) assays, and Northern blotting were performed essentially as described previously (16, 53, 65, 66).

Antibodies specific for the NPAT protein were described previously (65, 66). Antibodies against TRRAP (catalog no. T-17), Tip60 (catalog no. N-17 and K-17), and the GAL4 DNA binding domain (catalog no. RK5C1) were from Santa Cruz Biotechnology. Antibodies for -tubulin (catalog no. GTU88) and Flag tag (catalog no. M2) were from Sigma. Antibody specific for histone H4 acetylated at lysines 5, 8, 12, and 16 (catalog no. 06-866) was from Upstate Biotechnology.

Expression plasmids and construction of fusion proteins. Plasmids carrying the wild-type NPAT cDNA sequence were described previously (65, 66). For the construction of mammalian expression plasmids encoding the yeast GAL4 DNA binding domain fused with various NPAT sequences, DNA fragments encoding the indicated NPAT sequences were generated either by restriction enzyme digestion or by PCR and cloned in frame into the vector pFA-CMV (Stratagene). Bacterial glutathione S-transferase (GST) fusion constructs were generated by cloning the indicated NPAT fragments, prepared by PCR, into the vector pGEX (Amersham). The point mutation constructs were generated by PCR and cloned into appropriate expression plasmids. The PCR products were sequenced to confirm that the correct DNA sequences were obtained.

Preparation of GST-NPAT fusion proteins. GST fusion proteins containing either the wild-type or the mutant transactivation domain of NPAT were expressed in Escherichia coli BL21 cells. The bacterial cells were lysed by sonication. The lysates were incubated with glutathione-agarose beads (Sigma). After the GST fusion proteins were washed with a buffer of 50 mM Tris-HCl (pH 8.0), 1 M NaCl, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), they were eluted from the beads with reduced glutathione (Sigma) in phosphate-buffered saline. The eluted proteins were then loaded onto to an SP-Sepharose column (Amersham) equilibrated with SP buffer (5 mM phosphate [pH 7.0], 1 mM EDTA, 5% glycerol, 0.5 mM PMSF). The flowthrough was loaded onto a DEAE-Sepharose column (Amersham) equilibrated with buffer D (20 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1 mM EDTA, 5% glycerol, 0.5 mM PMSF). The proteins were eluted from the column by a 100 mM to 1 M NaCl gradient in D buffer. Fractions containing the fusion proteins were combined and dialyzed against phosphate-buffered saline.

Purification of nuclear proteins that interact with the transactivation domain of NPAT. HeLa S3 cells (from the National Cell Culture Center) were lysed in buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 10 mM EDTA, 0.4% NP-40; Panomics) and centrifuged to collect the nuclei. The nuclei were treated with buffer B (20 mM HEPES [pH 7.9], 400 mM NaCl, 1 mM EDTA, 10% glycerol; Panomics) and centrifuged to collect nuclear proteins in the supernatant. To remove proteins that interact with GST or with the NPAT transactivation domain independently of the DLFD motif, the nuclear extract was precleared by incubation with a mutant NPAT transactivation domain fusion protein (amino acids [aa] 262 to 329 or aa 262 to 350 [AAA]) and glutathione beads. The precleared nuclear extract was then incubated with GST-NPAT aa 262 to 338 or GST-NPAT aa 262 to 350 and glutathione beads. The beads were washed with buffer B with 0.1% NP-40. The proteins associated with the GST-NPAT fusion were eluted from the beads with 0.2% Sarkosyl in buffer B (43). The eluted proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and stained with colloidal Coomassie blue (Invitrogen). Protein bands specific for samples purified from the GST-NPAT aa 262 to 338 or from GST-NPAT aa 262 to 350 beads were excised for liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis at Taplin Biological Mass Spectrometry Facility of Harvard Medical School.

RNA interference by shRNA and quantitative real-time PCR analyses. For generating small hairpin RNAs (shRNAs) targeting human TRRAP mRNA, two sequences (shTRRAP-1, GGCTCGAAAGGAATGGATCC; and shTRRAP-2, GGCGACTACCTGGAGAACAT) were cloned into the pBS/U6 vector (54). The pBS/U6 plasmid expressing an shRNA specific for the firefly luciferase mRNA sequence (ACAAGACAATTGCACTGA) (57) was used as a control with Northern blotting experiments. The pBS/U6/Ski plasmid expressing an shRNA specific for the mouse Ski mRNA sequence (GCTGGAGGCAGAGTTGGAG) was also used as a control. For the Tip60 knockdown experiment, we employed two pLKO.1 constructs expressing Tip60-specific shRNAs, the RNA interference Consortium clones TRCN0000020314 (shTip60-1) and TRCN0000020315 (shTip60-2), targeting the sequences CGTCCATTACATTGACTTCAA and CCTCAATCTCATCAACTACTA, respectively. The pLKO.1 vector expressing a scrambled sequence (GTTCTCCGAACGTGTCACG) was used as a control.

After the knockdown, Tip60 mRNA levels were measured by using real-time quantitative PCR (qPCR). RNA was isolated using TRIzol (Invitrogen) reagent and then used as a template for cDNA synthesis by Moloney murine leukemia virus reverse transcriptase (Invitrogen) as described by the manufacturer. qPCRs using iQ SYBR green Supermix (Bio-Rad) were performed in triplicate with either the Tip60-specific primers TCCAGGCAATGAGATTTACCG and TCTTATGGTCAAGGAAACACTTGG or the GAPDH-specific primers CATGGGTGTGAACCATGAGA and CAGTGATGGCATGGACTGTG. Gene expression was normalized to GAPDH.

ChIP assays. The ChIP assays were carried out essentially as described previously (66). Briefly, HCT116 NPAT^flox/– cells were cross-linked with 1% formaldehyde for 10 min at room temperature. After undergoing cross-linking, the cells were lysed, and the chromatin was sonicated into 400- to 1,000-bp fragments, using a Branson 450 sonicator. The lysates were cleared by centrifugation at 11,000 rpm for 5 min at room temperature. A fraction of the lysates was saved as an input control, and the remaining lysates were diluted 10-fold with the dilution buffer. The diluted lysates were precleared with protein G beads (protein G-Sepharose; Amersham) and then incubated with antibodies specific for either NPAT, TRRAP, TIP60, acetylated H4, or the Flag tag and 15 µl of protein G-Sepharose at 4°C. Immunoprecipitated samples were washed three times with the dilution buffer and twice with a wash solution (50 mM Tris-HCl [pH 8.0], 500 mM NaCl, 1 mM EDTA, 0.5% Triton X-100) and then eluted with 1% SDS and 10 mM Tris-EDTA buffer at 65°C. The samples were treated with proteinase K at 50°C for 1 h. The input control samples were treated with 10 µg RNase at 37°C for 3 h and then 100 µg proteinase K at 50°C for 1 h. Reversion of cross-linking was carried out at 65°C overnight. DNA was phenol-chloroform extracted and ethanol precipitated. The DNA samples were subsequently quantitated by real-time PCR with SYBR green. Data analysis was performed using the method described previously (33). For the amplification of H4 sequences, the primers (5'-CTATTTCGGTTTGGCCCTTT-3' and 5'-CTGAGGCAGCGCCTTTATAC-3') were used to cover about a 120-bp promoter region of the H4/e gene. For the amplification of the H2B sequence, the previously described primer set (66), which covers a 180-bp promoter sequence upstream of the initiation codon ATG, was used.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
NPAT contains a transactivation domain with a motif conserved in the E2F and E1A proteins. In order to elucidate the mechanism by which NPAT coordinates histone gene transcription during the G₁/S-phase transition, we set out to identify the domain(s) in NPAT that is required for transcriptional activation. Short deletions from either the N terminus or the C terminus of NPAT abolished its ability to activate histone promoters (data not shown) (60), hampering the analysis of the internal domain(s) required for histone gene expression by the use of histone promoter-reporter assays. To circumvent this difficulty and to facilitate the identification of the domain involved in the transactivation, we fused full-length NPAT or various NPAT terminal deletions with the DNA binding domain (DBD) of the yeast transcriptional activator GAL4 protein and tested the fusions' abilities to activate a GAL4-responsive reporter. Fusion proteins containing either full-length NPAT or regions encompassing aa 262 to 350 of NPAT exhibited significant transcriptional activity (Fig. 1A and B), suggesting that a transcriptional activation domain resides in this region. The fusion of aa 262 to 350 of NPAT with the DBD activated the GAL4 reporter dramatically (Fig. 1C), confirming that this region carries a transcriptional activation function. To further define the transcriptional activation domain, we generated additional deletion constructs and tested their abilities to activate transcription. The domain that consists of aa 262 to 338 functions as a potent transcriptional activator (for convenience, it was referred to as the transactivation domain of NPAT). In contrast, the fusion containing aa 262 to 329, though expressed at a level similar to that of the fusion containing aa 262 to 338, has a greatly decreased ability to activate transcription (Fig. 1C). These data indicate that aa 329 to 338 are crucial for transcriptional activation.

View larger version (22K): [in this window] [in a new window]   FIG. 1. Identification of a functional DLFD motif. (A) Deletion analysis of the GAL4-NPAT fusion proteins. pFA-CMV vector, which expresses the GAL4 DBD, or a pFA-CMV plasmid that expresses the indicated DBD-NPAT fusion protein was transfected together with the GAL4-responsive luciferase reporter pFR-Luc (Stratagene) into U2OS cells. For the normalization of transfection efficiency, pCMV-LacZ, which expresses β-galactosidase, was also cotransfected. Twenty-four hours posttransfection, the cells were lysed and the activities of luciferase and β-galactosidase were assayed. The relative activity was calculated as previously described (66). The mean results and standard deviations from three independent experiments are depicted. (B) Schematic representation and summary of results shown in panel A. The positions of the first and last amino acids of the fused NPAT sequences are indicated on the left. Full-length NPAT contains 1,427 amino acids. The dotted lines indicate the region of NPAT required for transactivation. (C) The DLFD sequence is required for transactivation. The indicated GAL4 DBD-NPAT fusion proteins were tested for their ability to activate the pFR-Luc reporter. The expression levels of the fusion proteins were analyzed by Western blotting using an antibody specific for the GAL4-DBD. The Western blot of -tubulin was used as an equal loading control. (D) Conservation of the DLFD motif in NPAT, E2F and E1A proteins. The sequences surrounding the amino acids DLFD from human NPAT, human and Drosophila E2F and several human adenovirus E1A proteins are aligned. Identical amino acid residues are shaded black, and similar residues are shaded gray. The numbers indicate the locations of the amino acids in NPAT. (E) Essential role for the DLFD motif in NPAT-mediated histone promoter activation. Full-length wild-type NPAT, a mutant NPAT with the deletion of amino acid residues 262 to 350, and a mutant NPAT with the LFD sequence in the transactivation domain replaced by AAA sequence were tested for their ability to activate a histone H4 promoter (pGLH4(65)) as previously described (66). The expression of the wild-type and mutant NPAT was analyzed by Western blotting with an NPAT-specific antibody. The Western blot of -tubulin was used as a loading control.

TRRAP interacts with the transactivation domain of NPAT via the DLFD motif. Having identified a transactivation domain in NPAT that contains a conserved functional DLFD motif, we sought next to identify proteins that interact with this transactivation domain through the DLFD motif. In order to facilitate this investigation, two wild-type and two mutant forms of the transactivation domain were constructed and fused to GST (Fig. 2A). These GST fusion proteins were purified from bacteria and subsequently incubated with HeLa nuclear extract. Proteins that interacted with these NPAT transactivation domain fusion proteins were affinity purified, separated by SDS-PAGE, and visualized by Coomassie staining. The staining revealed that the wild-type transactivation domain binds to a number of proteins that showed weak or no interaction with the mutant transactivation domain (Fig. 2B, compare lanes 3 and 4 with lanes 1 and 2). The identities of the purified interacting proteins were determined by mass spectrometry.

View larger version (44K): [in this window] [in a new window]   FIG. 2. Interaction of TRRAP with NPAT. (A) Schematic representation of GST-NPAT fusion proteins used for affinity purification. (B). Identification of nuclear proteins interacting with functional transactivation domain of NPAT. HeLa nuclear extract was incubated with the indicated GST fusion proteins bound to the glutathione-agarose beads. Proteins associated with the fusion proteins were eluted and separated on an 8% SDS-PAGE gel. The proteins were visualized by colloidal Coomassie blue staining. The proteins were then identified by LC-MS/MS. (C) Interaction of TRRAP with NPAT transactivation domain requires the DLFD motif. The indicated GST fusion proteins were incubated with HeLa nuclear extract. Interaction of TRRAP with the fusion proteins was analyzed by Western blotting using a TRRAP-specific antibody (top panel). Ten percent of the input was loaded for analysis of the TRRAP level in HeLa nuclear extract. (Lower panel) a Coomassie blue-stained SDS-PAGE gel indicating equal amounts of GST fusion proteins were used for the pull-down experiments. (D) In vivo interaction of TRRAP with NPAT. HeLa nuclear extracts were immunoprecipitated with a monoclonal antibody specific for NPAT (DH3) or HA tag (12CA5). The immunoprecipitates were analyzed by Western blotting with a TRRAP-specific antibody. Five percent of the input was loaded for analysis of TRRAP in HeLa nuclear extract. One hundred percent of the immunoprecipitates was loaded for the analysis. (E) Confirmation of in vivo interaction of TRRAP with NPAT. HCT116 NPATflox/– cells were infected with either Ad-LacZ or Ad-Cre (Baylor Vector Development Laboratory) as indicated. Three days after infection, the whole cell lysates were immunoprecipitated with an NPAT-specific antibody. The presence of TRRAP in the immunoprecipitates was analyzed by Western blotting with a TRRAP-specific antibody. The input lanes were loaded with 2% (for TRRAP) and 5% (for NPAT) of the starting material used for the immunoprecipitation. One hundred percent of the immunoprecipitated material was analyzed for IP samples. Under the experimental conditions, the NPAT knockout efficiency is about 80% as previously reported (63).

To confirm the interaction between NPAT and TRRAP, observed with the initial mass spectrometry analysis, the GST fusion proteins were once again incubated with HeLa nuclear extract, and the interaction of TRRAP with the GST-fusion proteins was determined by Western blotting analysis with a TRRAP-specific antibody. As shown in Fig. 2C, the wild-type NPAT transactivation domain, but not the mutant domain, interacts with TRRAP, validating the observation that TRRAP interacts with the transactivation domain of NPAT via the DLFD motif. To determine whether endogenous NPAT and TRRAP interact, nuclear extracts prepared from HeLa cells were subjected to immunoprecipitation with an NPAT-specific antibody. TRRAP protein can be readily detected in the immunoprecipitates of the NPAT antibody but not in the immunoprecipitates of a control antibody (Fig. 2D), indicating that NPAT associates with TRRAP in vivo. Endogenous NPAT in anti-TRRAP immunoprecipitates was not detected, likely due to the low affinity of the available TRRAP antibody (data not shown). To verify that the coimmunoprecipitation of TRRAP results from the in vivo interaction between TRRAP and NPAT, rather than examine nonspecific immunoprecipitation by the anti-NPAT antibody, we compared coimmunoprecipitations of TRRAP by the NPAT-specific antibodies in both the wild-type NPAT and the HCT116 conditionally null NPAT cells. These latter cells (referred to as NPAT^flox/– cells) carry one mutant NPAT allele and one wild-type allele with exon 2 flanked by loxP sites. Infection of the NPAT^flox/– cells with adenovirus that expresses Cre recombinase (Ad-Cre) induces the excision of exon 2 of the wild-type allele, generating NPAT-deficient cells (63). As shown in Fig. 2E, the amount of TRRAP that coimmunoprecipitated is reduced in the Ad-Cre-infected NPAT^flox/– cells, where NPAT levels are decreased but not completely depleted under the experimental conditions. Coimmunoprecipitation of TRRAP with NPAT is due to the specific interaction of these two proteins, rather than a nonspecific association of these proteins with an antibody, as the antibody specific for the hemagglutinin (HA) tag immunoprecipitates neither NPAT nor TRRAP (data not shown). Together, these data show that NPAT associates with TRRAP in vivo, likely through the DLFD motif.

NPAT recruits TRRAP to histone promoters during the G₁/S-phase transition. We and others have previously shown that NPAT physically associates with histone promoters in vivo and that this association increases upon S-phase entry (66, 67). As NPAT interacts with TRRAP, which has been shown to be recruited by Myc and E2F to their respective target promoters (15, 38, 46, 56), it is possible that NPAT may recruit TRRAP to histone promoters to activate histone gene transcription during the G₁/S-phase transition. To test this possibility, we investigated the association of TRRAP with histone promoters in the HCT116 NPAT^flox/– cells under different conditions by ChIP assays. Similar to the cell cycle-dependent association of NPAT with the histone promoters (Fig. 3A) (67), the association of TRRAP with a histone H4 promoter increases about 10-fold in early S-phase cells compared to that with quiescent cells (Fig. 3A). In contrast, the association of TRRAP with the H4 promoter in vivo is compromised in the NPAT-deficient (Ad-Cre-infected) cells. Thus, TRRAP associates with histone promoters in S phase, and this association depends on NPAT. Under the experimental conditions used, the NPAT knockout efficiency is approximately 80 to 85% (63) Fig. 2 (and data not shown). The small increase in the association of TRRAP with the H4 promoter in the Ad-Cre-infected cells upon S-phase entry is likely due to the effect of the remaining NPAT protein. To determine more precisely the cell cycle stage at which TRRAP becomes associated with histone promoters, we analyzed the association of TRRAP with histone promoters at additional time points during the G₁-to-S-phase transition. As shown in Fig. 3B and Table 1, the association of TRRAP with the H4 promoter in vivo occurs at the G₁/S-phase boundary, as does the association of NPAT with the H4 promoter. The association of TRRAP and that of NPAT with a histone H2B promoter follow virtually identical kinetics (Fig. 3C). Thus, the associations of both NPAT and TRRAP with histone promoters occur during the G₁/S-phase transition, a point when S-phase-specific histone gene transcription is initiated. Again, the increased association of TRRAP with the histone promoters relies on NPAT (Fig. 3B and C). Thus, TRRAP associates with histone promoters in vivo at the G₁/S-phase boundary and in an NPAT-dependent manner.

View larger version (14K): [in this window] [in a new window]   FIG. 3. NPAT recruits TRRAP to histone promoters. (A) NPAT-dependent association of TRRAP with a histone H4 promoter at early S phase. (Left panel) HCT116 NPATflox/– cells were infected with either Ad-LacZ or Ad-Cre as indicated. Sixty hours after infection, the cells were starved for 36 h in medium containing 0.1% FBS. The cells were then stimulated to enter the cell cycle with 10% FBS. The cell cycle distribution of the cells at the indicated times was analyzed as previously described (53, 66). (Right panel) ChIP assays on serum-starved (0 h) or early S-phase cells (12 h). The cross-linked chromatin was immunoprecipitated with the indicated antibodies, and the presence of the H4 promoter DNA sequence in the immunoprecipitates was analyzed as described in Materials and Methods. The antibody specific for the Flag tag was used as a negative control. (B) NPAT-dependent association of TRRAP to an H4 promoter at the G1/S-phase boundary. The ChIP assays were carried out as described for panel A, except that the cells were harvested at 0, 8 and 10 h after serum stimulation. The amounts of DNA immunoprecipitated at different time points were compared, relative to the amounts at 0 h set as 1. (C) NPAT-dependent association of TRRAP to an H2B promoter at the G1/S-phase boundary. The ChIP assays were performed as described for panel B, except that primers specific for an H2B promoter were used. (D) NPAT-dependent, but S-phase-independent association of TRRAP with the H4 and H2B promoters. The NPATflox/– cells were treated as described for panel A, except that 5 µg/ml aphidicolin was added into the medium at the same time when the cells were stimulated with 10% FBS to block S-phase entry (53). The cells were harvested 18 h after serum and aphidicolin addition, and the ChIP assays were carried out as described for panels B and C. Under these experimental conditions, the levels of association of NPAT and TRRAP with histone promoters are 50 to 55% of those observed at 12 h after serum starvation.

View larger version (8K): [in this window] [in a new window]   FIG. 4. NPAT-dependent association of Tip60 with histone promoters. The treatment of NPATflox/– cells and ChIP assays with a Tip60-specific antibody were carried out as described for Fig. 3D.

View larger version (10K): [in this window] [in a new window]   FIG. 5. NPAT-dependent increase in histone H4 acetylation at histone promoters at the G1/S-phase boundary. (A) Increase in histone H4 acetylation at the G1/S-phase boundary. The treatment of the cells and ChIP analysis using an antibody specific for acetylated histone H4 were performed as described for Fig. 3B. (B) S-phase-independent increase in histone H4 acetylation. The treatment of cells and the ChIP assays with an antibody specific for acetylated histone H4 were carried out as described for Fig. 3D.

View larger version (37K): [in this window] [in a new window]   FIG. 6. TRRAP is required for transcriptional activation of histone genes. (A) Knockdown of TRRAP expression by TRRAP-specific shRNAs. HEK293T cells were transfected with pBS/U6 vector (control) or pBS/U6 plasmids expressing shRNAs specific for human TRRAP mRNA (shTRRRAP1 and shTRRAP2, respectively). pBabe-puro that carries a puromycin resistance gene was also cotransfected for selection with puromycin. Twenty-four hours posttransfection, puromycin was added into the culture medium to select for transfected cells. Three days after selection, the cells were harvested and expression of TRRAP was analyzed by Western blotting using a TRRAP-specific antibody. (B) Effect of TRRAP knockdown on H4 promoter activation. 293T cells were transfected with an H4 promoter-luciferase reporter (66), together with the pBS/U6 vector, pBS/U6 expressing a mouse Ski-specific shRNA or pBS/U6 expressing a TRRAP-specific shRNA. To normalize for transfection efficiency, the cells were also cotransfected with pCMV-LacZ. At the indicated time after transfection, the cells were harvested and the activities of luciferase and β-galactosidase were assayed as previously described (66). (C) Effect of TRRAP knockdown on H2B promoter activation. Activation of an H2B promoter (pGLH2B) (66) in cells transfected with the vector or plasmids expressing TRRAP-specific shRNAs or mouse Ski-specific shRNA was assayed as described for panel B. (D) Effect of TRRAP knockdown on the expression of endogenous histones. HEK293T cells were transfected with pBS/U6 expressing shRNAs specific for the luciferase gene (control) or TRRAP (shTRRAP-1 and shTRRAP-2). pBabe-puro was also cotransfected for selection. Twenty-four hours after transfection, puromycin was added into the medium to select for transfected cells. Two days after puromycin selection, the cells were harvested and mRNA levels of multiple histone genes were analyzed by Northern blotting, and the hybridization signals were quantitated using a phosphorimager as previously described (16). The levels of GAPDH were used as loading controls. The relative levels of the indicated histone mRNA in shTRRAP-expressing cells compared with those in control cells, after normalization with GAPDH signal, are shown below each Northern blot.

Similar to TRRAP, Tip60 also was observed to associate with histone promoters. Therefore, we investigated whether Tip60 is involved in histone promoter activation. We employed two shRNAs targeting two distinct sequences in Tip60 mRNA to knock down the expression of Tip60 (Fig. 7A). As shown in Fig. 7B and C, the suppression of Tip60 expression inhibits both the H2B and the H4 promoter activities, suggesting that Tip60 is also required for histone gene transcriptional activation.

View larger version (16K): [in this window] [in a new window]   FIG. 7. Tip60 is required for histone promoter activation. (A) Tip60 expression is reduced by two Tip60-specific shRNA constructs. U2OS cells were transfected with pLKO.1 constructs carrying Tip60-specific shRNA sequences or a control nonspecific scrambled sequence. pLKO.1 carries a puromycin resistance gene allowing for selection of transfected cells. Twenty-four hours after transfection, puromycin was added to culture media and transfected cells were selected. The cells were harvested three days after selection. Relative Tip60 mRNA levels were determined by real-time qPCR. The qPCR data were normalized to expression of GAPDH. (B) Effect of Tip60 knockdown on H2B promoter activation. U2OS cells were transfected with an H2B promoter luciferase reporter (66), together with pLKO.1/Scramble (shScr) or pLKO.1 expressing shRNAs specific for human Tip60 mRNA (shTip60-1 and shTip60-2, respectively). To normalize for transfection efficiency, the cells were cotransfected with pCMV-LacZ. At the indicated time after transfection, the cells were harvested and the activities of luciferase and β-galactosidase were assayed as described previously (66). (C) Effect of Tip60 knockdown on H4 promoter activation. Activation of an H4 promoter luciferase reporter (66) in cells transfected with pLKO.1/Scramble (shScr), pLKO.1/shTip60-1 or pLKO.1/shTip60-2 was assayed as described for panel B.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

View larger version (12K): [in this window] [in a new window]   FIG. 8. A model for coordinated transcriptional activation of histone subtypes by cyclin E-Cdk2 substrate NPAT. SSRE, subtype-specific regulator element; SSBP, proteins, such as Oct-1 and HiNF-P that directly bind SSRE elements within the promoters of a histone subtype; TFs, transcription factors, P, phosphorylation. See text for details.

The results shown in Fig. 3 and 4 suggest that the majority of TRRAP/Tip60 recruitment to histone gene promoters occurs immediately prior to S-phase entry. It is possible that TRRAP/Tip60 recruitment may involve a two-step mechanism in which additional recruitment of these factors takes place in S phase, as intermediate levels of association of NPAT and TRRAP with histone gene promoters were observed in the presence of aphidicolin. In addition to NPAT, the recruitment of the TRRAP/Tip60 complex to histone gene promoters may also involve other histone gene transcription factors.

According to the model proposed in Fig. 8, one might expect the NPAT (the LFD-to-AAA) mutant to be dominant negative. Our results, however, indicate that this mutant apparently has no inhibitory activity on histone promoter activation (Fig. 1E). The exact reason why the NPAT (AAA) mutant protein fails to function as a dominant-negative mutant is not clear. One possible explanation is that one or more of the proteins that interact with the NPAT transactivation domain may be involved in stabilizing the interaction of NPAT with histone promoters. Without this stabilizing interaction, the presence of the mutant at the promoter may be merely transient, thus resulting in a failure of the NPAT (AAA) mutant to be dominant negative.

In this study, we have identified a domain in NPAT that possesses intrinsic transactivation potential. Interestingly, this domain, referred to as the transactivation domain of NPAT, contains a DLFD motif that is required for NPAT-mediated transcriptional activation and is functionally conserved in E2F and adenovirus E1A proteins. Our results clearly demonstrate that the DLFD motif is crucial for the interaction of NPAT with TRRAP, as well as for NPAT-mediated transcriptional activation (Fig. 1 and 2). The DLFD motif also appears to be crucial for the interaction of several E2F proteins with TRRAP and for their transcriptional activation function. It was previously observed that deletion of the DLFD sequence in a transactivation domain of E2F1 (residues 389 to 422) fused to the GAL4 DNA-binding domain resulted in an almost complete loss of its transcriptional activation capability (13). Consistent with this observation, the LFD-to-AAA mutation in the transcriptional activation domain of E2F3 (residues 391 to 465) results in the loss of transactivation when the mutant domain is fused to the GAL4 DBD (our unpublished observation). Moreover, the replacement of the LFD sequence with AAA in the transactivation domain abolishes the interaction of E2F3 with TRRAP (our unpublished observation). It was reported that the last seven amino acids of E2F4, which include the second aspartic acid residue in the DLFD motif, are critical for its interaction with TRRAP and E2F4-mediated reporter activation (30). E1A may also utilize the DLFD motif to interact with TRRAP. It was shown that the deletion of E1A from the CR1 region, which includes the DLFD motif, abolishes both TRRAP binding and transformation (7). Thus, the DLFD motif functions as a TRRAP-interacting module that is conserved in NPAT, E2F, and E1A proteins. Several other TRRAP-interacting proteins, such as c-Myc, p53, and BRCA1 (2, 37, 44), apparently lack the DLFD motif and therefore likely interact with TRRAP through a different sequence motif(s). The existence of multiple TRRAP-interacting motifs may allow the recruitment of TRRAP-containing complexes by distinct factors to be differentially regulated. It is interesting to note that the DLFD motif is also part of the sequences in E2F proteins shown to interact with the retinoblastoma protein pRB (13, 21, 22, 32, 48). Hence, pRB may inhibit E2F function by preventing the association of E2F with TRRAP-containing HAT complexes.

TRRAP has been shown to be a component of a number of HAT complexes, including the GCN5/PCAF and Tip60 complexes (6, 8). We focused on the TRRAP-Tip60 HAT complex in this study because we observed an interaction between the NPAT transactivation domain and two other components of the Tip60 HAT complex, Tip48 and Tip49, in our initial mass spectrometric analysis (Fig. 2B). It is possible that, similar to E2F and c-Myc, which recruit Tip60 as well as GCN5 complexes to their target promoters, NPAT may interact with and recruit additional TRRAP-containing HAT complexes to histone promoters in vivo. Compared with the NPAT^flox/– cells infected with Ad-LacZ, the Ad-Cre-infected NPAT^flox/– cells showed only a moderate (30 to 55%) reduction in histone H4 acetylation at histone promoters at the G₁/S-phase boundary. This might be due to the fact that some residual NPAT protein remains in these cells and can still recruit the TRRAP-Tip60 complex to the histone promoters (Fig. 2E, 3, and 4). Alternatively, other protein factors might also recruit a HAT complex (or complexes) to the histone gene promoters to induce histone acetylation in concert with, but independent of, NPAT. Since proteins other than histones can also be the substrates of HATs (17, 18), the NPAT-recruited HAT(s) may also play a role in histone gene transcription by acetylating nonhistone proteins at histone promoters.

In addition to components of the Tip60 complex (Fig. 2B), NPAT appears to interact with YY1, BZAP45, and Hsp70, which have been implicated in histone gene transcription (12, 31, 41, 61, 67). Although an in vivo interaction of NPAT with these proteins remains to be determined, the observation raises the possibility that these proteins may participate in regulation of histone gene transcription through their cooperation with NPAT. The transactivation domain of NPAT apparently interacts with a number of additional proteins (Fig. 2B), which have not been shown to be involved in histone gene transcription. Further studies are needed to determine their interactions with NPAT in vivo, as well as their roles in transcriptional activation of histone genes. Such studies may shed new light on the coordinated regulation of histone gene transcription.

	ACKNOWLEDGMENTS

 
We thank Hartmut Land and Dirk Bohmann for helpful discussions and critical reading of the manuscript. We also thank Wade Harper for providing HCT116 NPAT^flox/– cells, Yang Shi for providing the pBS/U6 plasmid, Dennis McCance for providing the pBS/U6/Luc plasmid, Yin Sun for providing the pBS/U6/Ski plasmid, and Luojing Chen for providing the pLKO.1 nonspecific control. We are grateful to Peter Keng for help with FACS analysis, Anders Naar for suggestions on protein purification, and Taplin Biological Spectrometry Facility for mass spectrometric analysis.

This work was supported by NIH grant R01 GM65814 to J.Z.

	FOOTNOTES

 
* Corresponding author. Mailing address: Department of Biomedical Genetics, University of Rochester Medical Center, 601 Elmwood Avenue, Rochester, NY 14642. Phone: (585) 273-1453. Fax: (585) 273-1450. E-mail: Jiyong_zhao{at}urmc.rochester.edu

Published ahead of print on 29 October 2007.

Supplemental material for this article may be found at http://mcb.asm.org/.

These authors contributed equally to this work.

Present address: Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University, Baltimore, MD 21231.

^¶ Present address: Department of Parasitology, Nanjing Medical University, Nanjing, Jiangsu 210029, People's Republic of China.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Allard, S., R. T. Utley, J. Savard, A. Clarke, P. Grant, C. J. Brandl, L. Pillus, J. L. Workman, and J. Cote. 1999. NuA4, an essential transcription adaptor/histone H4 acetyltransferase complex containing Esa1p and the ATM-related cofactor Tra1p. EMBO J. 18:5108-5119.[CrossRef][Medline]

2. Ard, P. G., C. Chatterjee, S. Kunjibettu, L. R. Adside, L. E. Gralinski, and S. B. McMahon. 2002. Transcriptional regulation of the mdm2 oncogene by p53 requires TRRAP acetyltransferase complexes. Mol. Cell. Biol. 22:5650-5661.[Abstract/Free Full Text]

3. Barcaroli, D., L. Bongiorno-Borbone, A. Terrinoni, T. G. Hofmann, M. Rossi, R. A. Knight, A. G. Matera, G. Melino, and V. De Laurenzi. 2006. FLASH is required for histone transcription and S-phase progression. Proc. Natl. Acad. Sci. USA 103:14808-14812.[Abstract/Free Full Text]

4. Brand, M., K. Yamamoto, A. Staub, and L. Tora. 1999. Identification of TATA-binding protein-free TAFII-containing complex subunits suggests a role in nucleosome acetylation and signal transduction. J. Biol. Chem. 274:18285-18289.[Abstract/Free Full Text]

5. Brown, C. E., L. Howe, K. Sousa, S. C. Alley, M. J. Carrozza, S. Tan, and J. L. Workman. 2001. Recruitment of HAT complexes by direct activator interactions with the ATM-related Tra1 subunit. Science 292:2333-2337.[Abstract/Free Full Text]

6. Carrozza, M. J., R. T. Utley, J. L. Workman, and J. Cote. 2003. The diverse functions of histone acetyltransferase complexes. Trends Genet. 19:321-329.[CrossRef][Medline]

7. Deleu, L., S. Shellard, K. Alevizopoulos, B. Amati, and H. Land. 2001. Recruitment of TRRAP required for oncogenic transformation by E1A. Oncogene 20:8270-8275.[CrossRef][Medline]

8. Doyon, Y., and J. Cote. 2004. The highly conserved and multifunctional NuA4 HAT complex. Curr. Opin. Genet. Dev. 14:147-154.[CrossRef][Medline]

9. Dyson, N. 1998. The regulation of E2F by pRB-family proteins. Genes Dev. 12:2245-2262.[Free Full Text]

10. Dyson, N., P. Guida, C. McCall, and E. Harlow. 1992. Adenovirus E1A makes two distinct contacts with the retinoblastoma protein. J. Virol. 66:4606-4611.[Abstract/Free Full Text]

11. Dyson, N., and E. Harlow. 1992. Adenovirus E1A targets key regulators of cell proliferation. Cancer Surv. 12:161-195.[Medline]

12. Eliassen, K. A., A. Baldwin, E. M. Sikorski, and M. M. Hurt. 1998. Role for a YY1-binding element in replication-dependent mouse histone gene expression. Mol. Cell. Biol. 18:7106-7118.[Abstract/Free Full Text]

13. Flemington, E. K., S. H. Speck, and W. G. Kaelin, Jr. 1993. E2F-1-mediated transactivation is inhibited by complex formation with the retinoblastoma susceptibility gene product. Proc. Natl. Acad. Sci. USA 90:6914-6918.[Abstract/Free Full Text]

14. Fletcher, C., N. Heintz, and R. G. Roeder. 1987. Purification and characterization of OTF-1, a transcription factor regulating cell cycle expression of a human histone H2b gene. Cell 51:773-781.[CrossRef][Medline]

15. Frank, S. R., T. Parisi, S. Taubert, P. Fernandez, M. Fuchs, H. M. Chan, D. M. Livingston, and B. Amati. 2003. MYC recruits the TIP60 histone acetyltransferase complex to chromatin. EMBO Rep. 4:575-580.[CrossRef][Medline]

16. Gao, G., A. P. Bracken, K. Burkard, D. Pasini, M. Classon, C. Attwooll, M. Sagara, T. Imai, K. Helin, and J. Zhao. 2003. NPAT expression is regulated by E2F and is essential for cell cycle progression. Mol. Cell. Biol. 23:2821-2833.[Abstract/Free Full Text]

17. Glozak, M. A., N. Sengupta, X. Zhang, and E. Seto. 2005. Acetylation and deacetylation of non-histone proteins. Gene 363:15-23.[CrossRef][Medline]

18. Gu, W., and R. G. Roeder. 1997. Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90:595-606.[CrossRef][Medline]

19. Hall, C., D. M. Nelson, X. Ye, K. Baker, J. A. DeCaprio, S. Seeholzer, M. Lipinski, and P. D. Adams. 2001. HIRA, the human homologue of yeast Hir1p and Hir2p, is a novel cyclin-cdk2 substrate whose expression blocks S-phase progression. Mol. Cell. Biol. 21:1854-1865.[Abstract/Free Full Text]

20. Heintz, N. 1991. The regulation of histone gene expression during the cell cycle. Biochim. Biophys. Acta 1088:327-339.[Medline]

21. Helin, K., E. Harlow, and A. Fattaey. 1993. Inhibition of E2F-1 transactivation by direct binding of the retinoblastoma protein. Mol. Cell. Biol. 13:6501-6508.[Abstract/Free Full Text]

22. Helin, K., J. A. Lees, M. Vidal, N. Dyson, E. Harlow, and A. Fattaey. 1992. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F. Cell 70:337-350.[CrossRef][Medline]

23. Herceg, Z., W. Hulla, D. Gell, C. Cuenin, M. Lleonart, S. Jackson, and Z. Q. Wang. 2001. Disruption of Trrap causes early embryonic lethality and defects in cell cycle progression. Nat. Genet. 29:206-211.[CrossRef][Medline]

24. Ikura, T., V. V. Ogryzko, M. Grigoriev, R. Groisman, J. Wang, M. Horikoshi, R. Scully, J. Qin, and Y. Nakatani. 2000. Involvement of the TIP60 histone acetylase complex in DNA repair and apoptosis. Cell 102:463-473.[CrossRef][Medline]

25. Jenuwein, T., and C. D. Allis. 2001. Translating the histone code. Science 293:1074-1080.[Abstract/Free Full Text]

26. Kaelin, W. G., Jr., W. Krek, W. R. Sellers, J. A. DeCaprio, F. Ajchenbaum, C. S. Fuchs, T. Chittenden, Y. Li, P. J. Farnham, M. A. Blanar, et al. 1992. Expression cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like properties. Cell 70:351-364.[CrossRef][Medline]

27. Khorasanizadeh, S. 2004. The nucleosome: from genomic organization to genomic regulation. Cell 116:259-272.[CrossRef][Medline]

28. Kornberg, R. D., and Y. Lorch. 1999. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell 98:285-294.[CrossRef][Medline]

29. Lang, S. E., and P. Hearing. 2003. The adenovirus E1A oncoprotein recruits the cellular TRRAP/GCN5 histone acetyltransferase complex. Oncogene 22:2836-2841.[CrossRef][Medline]

30. Lang, S. E., S. B. McMahon, M. D. Cole, and P. Hearing. 2001. E2F transcriptional activation requires TRRAP and GCN5 cofactors. J. Biol. Chem. 276:32627-32634.[Abstract/Free Full Text]

31. Last, T. J., A. J. van Wijnen, M. J. Birnbaum, G. S. Stein, and J. L. Stein. 1999. Multiple interactions of the transcription factor YY1 with human histone H4 gene regulatory elements. J. Cell. Biochem. 72:507-516.[CrossRef][Medline]

32. Lee, C., J. H. Chang, H. S. Lee, and Y. Cho. 2002. Structural basis for the recognition of the E2F transactivation domain by the retinoblastoma tumor suppressor. Genes Dev. 16:3199-3212.[Abstract/Free Full Text]

33. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402-408.[CrossRef][Medline]

34. Ma, T., B. A. Van Tine, Y. Wei, M. D. Garrett, D. Nelson, P. D. Adams, J. Wang, J. Qin, L. T. Chow, and J. W. Harper. 2000. Cell cycle-regulated phosphorylation of p220(NPAT) by cyclin E/Cdk2 in Cajal bodies promotes histone gene transcription. Genes Dev. 14:2298-2313.[Abstract/Free Full Text]

35. Martinez, E., V. B. Palhan, A. Tjernberg, E. S. Lymar, A. M. Gamper, T. K. Kundu, B. T. Chait, and R. G. Roeder. 2001. Human STAGA complex is a chromatin-acetylating transcription coactivator that interacts with pre-mRNA splicing and DNA damage-binding factors in vivo. Mol. Cell. Biol. 21:6782-6795.[Abstract/Free Full Text]

36. Marzluff, W. F., and R. J. Duronio. 2002. Histone mRNA expression: multiple levels of cell cycle regulation and important developmental consequences. Curr. Opin. Cell Biol. 14:692-699.[CrossRef][Medline]

37. McMahon, S. B., H. A. Van Buskirk, K. A. Dugan, T. D. Copeland, and M. D. Cole. 1998. The novel ATM-related protein TRRAP is an essential cofactor for the c-Myc and E2F oncoproteins. Cell 94:363-374.[CrossRef][Medline]

38. McMahon, S. B., M. A. Wood, and M. D. Cole. 2000. The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol. Cell. Biol. 20:556-562.[Abstract/Free Full Text]

39. Meeks-Wagner, D., and L. H. Hartwell. 1986. Normal stoichiometry of histone dimer sets is necessary for high fidelity of mitotic chromosome transmission. Cell 44:43-52.[CrossRef][Medline]

40. Miele, A., C. D. Braastad, W. F. Holmes, P. Mitra, R. Medina, R. Xie, S. K. Zaidi, X. Ye, Y. Wei, J. W. Harper, A. J. van Wijnen, J. L. Stein, and G. S. Stein. 2005. HiNF-P directly links the cyclin E/CDK2/p220^NPAT pathway to histone H4 gene regulation at the G₁/S phase cell cycle transition. Mol. Cell. Biol. 25:6140-6153.[Abstract/Free Full Text]

41. Mitra, P., P. S. Vaughan, J. L. Stein, G. S. Stein, and A. J. van Wijnen. 2001. Purification and functional analysis of a novel leucine-zipper/nucleotide-fold protein, BZAP45, stimulating cell cycle regulated histone H4 gene transcription. Biochemistry 40:10693-10699.[CrossRef][Medline]

42. Murr, R., J. I. Loizou, Y. G. Yang, C. Cuenin, H. Li, Z. Q. Wang, and Z. Herceg. 2006. Histone acetylation by Trrap-Tip60 modulates loading of repair proteins and repair of DNA double-strand breaks. Nat. Cell Biol. 8:91-99.[CrossRef][Medline]

43. Naar, A. M., P. A. Beaurang, S. Zhou, S. Abraham, W. Solomon, and R. Tjian. 1999. Composite co-activator ARC mediates chromatin-directed transcriptional activation. Nature 398:828-832.[CrossRef][Medline]

44. Oishi, H., H. Kitagawa, O. Wada, S. Takezawa, L. Tora, M. Kouzu-Fujita, I. Takada, T. Yano, J. Yanagisawa, and S. Kato. 2006. An hGCN5/TRRAP histone acetyltransferase complex co-activates BRCA1 transactivation function through histone modification. J. Biol. Chem. 281:20-26.[Abstract/Free Full Text]

45. Osley, M. A. 1991. The regulation of histone synthesis in the cell cycle. Annu. Rev. Biochem. 60:827-861.[CrossRef][Medline]

46. Park, J., S. Kunjibettu, S. B. McMahon, and M. D. Cole. 2001. The ATM-related domain of TRRAP is required for histone acetyltransferase recruitment and Myc-dependent oncogenesis. Genes Dev. 15:1619-1624.[Abstract/Free Full Text]

47. Robert, F., S. Hardy, Z. Nagy, C. Baldeyron, R. Murr, U. Dery, J. Y. Masson, D. Papadopoulo, Z. Herceg, and L. Tora. 2006. The transcriptional histone acetyltransferase cofactor TRRAP associates with the MRN repair complex and plays a role in DNA double-strand break repair. Mol. Cell. Biol. 26:402-412.[Abstract/Free Full Text]

48. Shan, B., T. Durfee, and W. H. Lee. 1996. Disruption of RB/E2F-1 interaction by single point mutations in E2F-1 enhances S-phase entry and apoptosis. Proc. Natl. Acad. Sci. USA 93:679-684.[Abstract/Free Full Text]

49. Shan, B., X. Zhu, P. L. Chen, T. Durfee, Y. Yang, D. Sharp,