Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2008, p. 3190-3197, Vol. 28, No. 10
0270-7306/08/$08.00+0 doi:10.1128/MCB.02291-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Department of Cell Biology,1 Hamon Cancer Center for Therapeutic Oncology Research, UT Southwestern Medical Center, Dallas, Texas 753902
Received 27 December 2007/ Returned for modification 29 January 2008/ Accepted 10 March 2008
|
|
|---|
|
|
|---|
Together with the correlative observations described above, RASSF1A was implicated as a tumor suppressor gene through studies in which its reexpression in lung carcinoma cells reduced colony formation, suppressed anchorage-independent growth, and inhibited tumor formation in nude mice (6). Previously we have found that RASSF1A overexpression blocks proliferation and decreases the levels of cyclin D1, presumably preventing cells from passing through the Rb family cell cycle restriction point and entering S phase. Similarly, the reduction of RASSF1A protein levels by small interfering RNA (siRNA) increased cyclin D1 protein levels. Overexpression of viral oncoprotein E7, which inhibits the interaction between Rb and E2F, produced proliferative cells resistant to RASSF1A-induced cell cycle arrest, placing RASSF1A's antiproliferative effect prior to the Rb checkpoint (22). A supporting clinical correlation comes from studies of cervical cancer in which there is an inverse correlation between human papillomavirus infection (E7 expression) and RASSF1A methylation status, indicating that these two oncogenic changes disable similar tumorigenic pathways (5, 15).
A variety of interacting proteins have been characterized that may participate in RASSF1A-dependent regulatory events (3, 13, 23, 24). However, a mechanistic account of the consequences of RASSF1A loss for tumor progression remains elusive. Here we describe a detailed loss-of-function analysis to directly evaluate the impact of RASSF1A depletion on the molecular changes required for cell cycle progression. We found that RASSF1A inhibits cyclin D1 accumulation through an association with the Ewing sarcoma breakpoint protein (EWS). In addition, RASSF1A restricts APC/C activity in G1/S through a functional interaction with βTRCP. Together, these findings suggest that RASSF1A has both positive and negative inputs into cell cycle progression that may represent a fail-safe relationship. As a consequence, multiple genetic lesions would be required to overcome RASSF1A function during tumor progression. While loss of RASSF1A may not directly promote oncogenic transformation, it may provide a permissive environment for acquiring additional genetic lesions that lead to tumorigenesis.
|
|
|---|
Cell culture and transfection. HeLa cells were maintained in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum (FBS). MCF10A cells were maintained in mammary epithelial cell basal medium supplemented with epidermal growth factor and bovine pituitary extract (Cambrex). A549 cells were maintained in RPMI medium plus 5% FBS. For siRNA transfections, cells were plated at 50 to 75% confluence and transfected with 100 nM total siRNA by using Oligofectamine (Invitrogen) according to manufacturer's protocol. MCF10A cells were transfected by a trypsin-mediated method in which cells are briefly trypsinzed for 30 s prior to addition of the lipid-siRNA complex (18).
siRNAs. siRNA sequences were as follows: RASSF1A, GACCUCUGUGGCGACUUCATT and CACGUGGUGCGACCUCUGU; EWS, GACUCUGACAACAGUGCAATT and AAUGGCGUCCACGGAUUAC; Emi1, GAUGCUCAAACCAAGUUAU; CDH1, GAAGGGUCUGUUCACGUAU. For βTRCP silencing, the SMARTpool was obtained from Dharmacon (Lafayette, CO).
Immunoblotting and immunofluorescence. Rabbit antibodies against RASSF1A and -C were generated as previously described (4). Polyclonal antibody 4169 was generated with a combination of genetic and peptide immunization procedures. cDNA encoding amino acids 1 to 119 of RASSF1A was inserted into mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA). One milligram of the plasmid DNA was initially intrasplenically (i.s.) injected into a rabbit. Subsequently, 1 mg of the DNA was intramuscularly injected 30 and 45 days after the i.s. injection. The rabbit was subcutaneously injected with a keyhole limpet hemocyanin (KLH)-conjugated peptide (PAGRAGKGRTRLERANALRIA) corresponding to amino acids 15 to 35 of RASSF1A 14 days after the second intramuscular injection. Monoclonal antibody G5 was generated with a peptide specific to RASSF1A (SGEPELIELRELAPAGRAGKGR, corresponding to amino acids 2 to 22 of RASSF1A). BALB/c mice were injected i.s. with 100 µg of KLH-conjugated peptide. The mice were boosted four times with 60 µg of the KLH-conjugated peptide by subcutaneous injection during a 90-day period. Antibodies for cyclin A, cyclin B, EWS, FUS/TLS, and ERK2 were from Santa Cruz. Anti-Skp2 and -Emi1 antibodies were from Zymed, and anti-CDH1 antibody was from LabVision Corporation. MST2 antibody was obtained from Cell Signaling. A monoclonal antibody against bromodeoxyuridine (BrdU) was obtained from Becton Dickinson. Alexa 488 (Molecular Probes) was used as a secondary antibody for fluorescent labeling. Immunoblot assays were performed with proteins transferred to polyvinylidene difluoride membrane according to the manufacturer's protocol for each antibody. For BrdU visualization, cells were treated with 30 µM BrdU for 24 h and then fixed in 3.7% HCHO. Cells were permeabilized with methanol for 10 min at –20°C and then blocked in phosphate-buffered saline-5% bovine serum albumin-1% Tween for a minimum of 15 min. Anti-BrdU antibody was used at a dilution of 1:4. Cells were visualized on an Axiovert upright microscope (Zeiss) equipped with a Hamamatsu black and white camera.
Immunoprecipitation. HeLa cells grown to confluence on 60-mm2 dishes were lysed in buffer containing 0.5% Triton X-100 and 150 mM NaCl and 0.5% deoxycholate. Soluble lysate was incubated with protein A beads for 30 min, followed by incubation overnight with anti-RASSF1A monoclonal antibody G5 or rabbit immunoglobulin G and protein A beads. Beads were washed three times in lysis buffer with 500 mM NaCl. Following washes, sample buffer was added and lysates were boiled and separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by immunoblotting.
Fluorescence-activated cell sorter (FACS) analysis. At 72 h posttransfection, cells were trypsinized and resuspended in a 50:50 mixture of ethanol and phosphate-buffered saline. Following fixation for 30 min, cells were washed and labeled with propidium iodide (Sigma) at 40 µg/ml for 30 min at 37°C. For each analysis, 10,000 cells were collected by FACScan and analyzed with the CellQuest program (Becton Dickinson).
Quantitative PCR (qPCR). HeLa cells were transfected in 35-mm2 dishes with 100 nM siRNA. At 72 h posttransfection, RNA was extracted from cells with a High Pure RNA isolation kit (Roche Applied Science) according to the manufacturer's protocol. cDNA was synthesized with Super Script II reverse transcriptase (Invitrogen) according to the manufacturer's protocol. For cDNA synthesis, 1 µg of RNA and oligo(dT)12-18 primers were used. One-fifteenth of the cDNA reaction mixture was used with the Roche LightCycler System and LightCycler FastStart DNA Master Sybr green I (Roche Applied Systems). Primers were chosen to flank at least two siRNA target sequences and lie on separate exons. The primers used for cyclin D1 were 5'CCAGCTCCTGTGCTGCGAAG3' (forward) and 5'GCGGCCAGGTTCCAC3' (reverse). The primers used for βTRCP1 were 5'AGCTGTGCCAGACTCTGCTT3' (forward) and 5'GCTGGCAGAGCAGTTATGAA3' (reverse). The primers used for βTRCP2 were 5'TGCAGCGGGACTTTATTACC3' (forward) and 5'TCTCGTAGGCCACTGATAATTT (reverse). Values were normalized to glyceraldehyde-3-phosphate dehydrogenase and analyzed with the relative quantification mathematical model (Pfaffl).
|
|
|---|
![]() View larger version (24K): [in a new window] |
FIG. 1. RASSF1A interacts with EWS. (A) Schematic of RASSF1A protein. The region (amino acids 1 to 210) used in a yeast two-hybrid screen for interacting proteins is indicated. (B) 293 cells were transfected with Myc-tagged RASSF1A and the green fluorescent protein (GFP)-tagged EWS zinc finger domain (amino acids 175 to 210). After 48 h, cells were lysed and -myc-coupled agarose was used to immunoprecipitate RASSF1A. Lysates and immunoprecipitates were resolved by SDS-PAGE and immunoblotted with myc and green fluorescent protein antibodies as indicated. (C) HeLa cell lysates were immunoprecipitated with a RASSF1A-specific monoclonal antibody, G5. Lysates and immunoprecipitates were resolved by SDS-PAGE, transferred to polyvinylidene difluoride membrane, and immunoblotted with a polyclonal RASSF1A-specific antibody, 4169, and an EWS antibody as indicated. WB, Western blot; I.P., immunoprecipitate; WCL, whole-cell lysate; IgG, immunoglobulin G.
|
![]() View larger version (43K): [in a new window] |
FIG. 2. EWS regulates cyclin D1 expression. (A) HeLa cells were transfected with the indicated siRNAs in the presence of serum. Seventy-two hours later, lysates were resolved by SDS-PAGE and immunoblotted for indicated proteins. (B) Cyclin D1 mRNA concentrations from cells treated as described for panel A were evaluated by quantitative reverse transcription-PCR. Error bars represent the standard deviation from the mean of three biological replicates. (C) MCF10A cells were transfected with the indicated siRNAs. Seventy-two hours later, whole-cell lysates were immunoblotted to visualize the indicated proteins. ERK1/2 was included as a loading control (Ctrl). (D) HeLa cells were transfected as described for panel A, with the exception that cells were incubated in serum-free medium for 24 h prior to lysate collection as indicated. ERK1/2 was included as a loading control. (E) The indicated cell lines were transfected as described for panel A. At 48 h following transfection, BrdU was added to the medium for an additional 24 h. BrdU incorporation was detected with an anti-BrdU antibody, nuclei were counterstained with 4',6'-diamidino-2-phenylindole (DAPI), and the percentage of BrdU-positive cells was calculated by microscopic observation. At least 100 cells were analyzed for each condition in each experiment. Values were normalized to the BrdU incorporation frequency observed in untransfected (NT) cells, which was arbitrarily set to 100%. Error bars indicate the standard deviation from the mean of three biological replicates. Representative micrographs are shown for MCF10A cells at the bottom left. exp., expressed.
|
To determine where in the cell cycle RASSF1A-depleted cells were arrested, we treated control siRNA-transfected and RASSF1A siRNA-transfected cells with nocodazole for 18 h. Nocodazole interferes with microtubule dynamics and through activation of the spindle assembly checkpoint. FACS analysis for DNA content indicated that while control transfected cells treated with nocodazole accumulated in G2/M as expected, cells depleted of RASSF1A and treated with nocodazole retained a significant population of cells in G1 (Fig. 3A). Similar results were obtained with MCF10A cells (data not shown). This analysis suggests that RASSF1A positively contributes to G1/S phase progression.
![]() View larger version (16K): [in a new window] |
FIG. 3. siRNA of RASSF1A induces G1 arrest. (A) HeLa cells were transfected with the indicated siRNAs. At 48 h posttransfection, 100 ng/ml nocodazole was added to the medium and the cells were incubated for an additional 18 to 20 h. Cells were then trypsinized, fixed, and stained with propidium iodide. FACS profiles of propidium iodide intensity are shown. M1 indicates 2N, M2 indicates >2N and <4N, and M3 indicates 4N DNA content. (B) Whole-cell lysates from cells treated as described for panel A were immunoblotted to visualize the indicated proteins. ERK1/2 was included as a loading control (Ctrl).
|
![]() View larger version (23K): [in a new window] |
FIG. 4. CDH1 depletion rescues G1 arrest induced by siRNA of RASSF1A. (A) HeLa cells were transfected with the indicated siRNAs, and whole-cell lysates were immunoblotted to visualize the indicated proteins. (B) Cells treated as described for panel A were analyzed for BrdU incorporation as described for Fig. 2D. (C) HeLa cells were transfected with the indicated siRNAs. At 48 h posttransfection, 100 ng/ml nocodazole was added to the medium and the cells were incubated for an additional 18 to 20 h. FACS analysis was performed as described for Fig. 3B. Population distributions are shown relative to DNA content. Results are representative of three independent experiments. NT, not transfected; Ctrl, control.
|
RASSF1A mediates cell cycle regulation through βTRCP. Our observation that APC/C inactivation could reengage cell cycle progression in RASSF1A-depleted cells prompted us to examine the mechanism by which RASSF1A affects APC/C activity. Emi1 is an APC/C inhibitor that has been found to function at the G1/S transition and during G2 (21). Consistent with the hyperactive APC/C phenotype, we saw a significant decrease in Emi1 expression in RASSF1A knockdown cells (Fig. 5A). Transient overexpression of RASSF1A was also sufficient to induce a modest but reproducible increase in Emi1 accumulation (Fig. 5B). Surprisingly, we found that direct siRNA-mediated depletion of Emi1 resulted in apparent cell cycle arrest in S phase together with massive endoreduplication, a phenotype that was not altered by codepletion of RASSF1A (Fig. 5C and D). A very recent observation has demonstrated that Emi1 is required to allow cyclin A accumulation and S phase exit (16). To test the possibility that RASSF1A-dependent accumulation of Emi1 is required for the G1/S phase transition, we examined the consequence of depleting βTRCP, the F box protein required for SCF-mediated ubiquitination of Emi1 (17). We found that depletion of βTRCP1, -2, or both was sufficient to rescue Emi1 expression in the absence of RASSF1A expression (Fig. 6A and data not shown). Furthermore, siRNA of βTRCP1, -2, or both was sufficient to rescue cell cycle progression (Fig. 6B and data not shown). βTRCP knockdown was confirmed by qPCR (Fig. 6C). In combination with a recent report that RASSF1 proteins can bind directly to βTRCP, these observations indicate that RASSF1A plays a pivotal role in restricting βTRCP during the G1/S phase transition to allow APC/C inactivation by Emi1. In contrast to depletion of RASSF1A, depletion of EWS had no effect on Emi1 expression, suggesting that the βTRCP arm of RASSF1A regulation is distinct from effects on EWS function (Fig. 6D).
![]() View larger version (42K): [in a new window] |
FIG. 5. Emi1 mediates RASSF1A depletion-induced G1 arrest. (A) HeLa cells were transfected and immunoblotted for indicated proteins as described for Fig. 2A. (B) Cells were transfected with the indicated plasmids. At 48 h posttransfection, whole-cell lysates were immunoblotted for the indicated proteins. (C) BrdU incorporation was assayed as described for Fig. 2D. Representative micrographs are shown. (D) FACS analysis of HeLa cells transfected with the indicated siRNAs. Population distributions are shown relative to DNA content. Results are representative of three independent experiments. Ctrl, control; DAPI, 4',6'-diamidino-2-phenylindole.
|
![]() View larger version (65K): [in a new window] |
FIG. 6. βTRCP siRNA restores Emi1 levels and rescues G1 arrest. (A) At 72 h posttransfection with the indicated siRNAs, HeLa cell lysates were immunoblotted to visualize the indicated proteins. (B) BrdU incorporation was assayed as described for Fig. 2D. (C) βTRCP1 and -2 mRNA concentrations were measured by qPCR from samples treated as described for panel A. (D) At 72 h posttransfection with the indicated siRNAs, HeLa cell lysates were immunoblotted to visualize the indicated proteins. Ctrl, control; DAPI, 4',6'-diamidino-2-phenylindole.
|
|
|
|---|
![]() View larger version (18K): [in a new window] |
FIG. 7. Model of dual opposing regulatory connections of RASSF1A to cell cycle progression. The presence of RASSF1A provides a regulatory input for the restriction of EWS-dependent cyclin (Cyc) D1 accumulation (antiproliferative) and for the restriction of βTRCP-dependent Emi1 inactivation (proproliferative). Loss of this regulatory input allows aberrant cyclin D1 accumulation but also restricts cyclin A accumulation as a consequence of aberrant APC/C activity during the G1/S phase transition.
|
SCFβTRCP has been implicated as a regulator of Emi1 during prophase (17). Here, we show that inhibition of SCFβTRCP during G1 is an additional control point for Emi1 regulation. Recently, RASSF1A family member RASSF1C has been shown to interact directly with SCFβTRCP and regulate the degradation of β-catenin and I
B (11). Given the observation that RASSF1A family members, including RASSF1C, can function as a complex (14; our unpublished observations), SCFβTRCP likely represents the proximal molecular entry point for RASSF1A control of G1/S phase transitions, perhaps through deflection of the capacity of RASSF1C to activate SCFβTRCP (11). This scenario would predict that any protumorigenic consequences of unrestrained SCFβTRCP activity, bestowed upon the loss of the RASSF1A tumor suppressor, would require the continued expression of RASSF1C. In fact, RASSF1C is rarely, if ever, lost in human cancers despite frequent loss of heterozygosity at this locus coupled with selective inactivation of the RASSF1A splice form (7, 25).
We thank Hongtao Yu and members of our laboratories for helpful discussions.
Published ahead of print on 17 March 2008. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»