| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, May 2008, p. 3526-3537, Vol. 28, No. 10
0270-7306/08/$08.00+0 doi:10.1128/MCB.01986-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Max Planck Institute of Immunobiology, Department of Cellular and Molecular Immunology, 79108 Freiburg, Germany
Received 5 November 2007/ Returned for modification 18 December 2007/ Accepted 5 March 2008
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
β-Catenin is a multidomain protein consisting of 12 armadillo repeats (arm) that mediate the alternative associations with the amino (N) termini of LEF1/TCF proteins, with components of the cytosolic APC/axin destruction complex and with the membrane-bound adhesion molecule E cadherin (reviewed in reference 51). In addition, β-catenin contains an amino-terminal domain that regulates protein stability and a C-terminal domain that confers transcription activation potential (27). The C-terminal domain of β-catenin has been found to interact with multiple proteins, including the histone acetyltransferases CBP/p300 and TRRAP/Tip60, the histone methylation complex MLL1, the MED12 component of the mediator complex, TBP, and Parafibromin, which is part of a transcription elongation complex (24, 32, 41, 48, 52). Transcription activation by β-catenin is also augmented by the association of Brg-1, a component of a nucleosome remodeling complex, with the armadillo repeats of β-catenin (5). However, the C terminus of β-catenin does not appear to be sufficient for transcriptional activation in response to Wnt signaling. First, β-catenin lacking the C-terminal domain retains an activation potential in mammalian transfection assays and in the fly (18, 27). In addition, a fusion of the C terminus of armadillo, the Drosophila orthologue of β-catenin, to the Drosophila TCF protein lacking the β-catenin interaction domain failed to restore signaling activity in transgenic flies (54). Additional activation functions of β-catenin could be accounted for by a transactivation function of the amino-terminal domain (27) and by the association of B-cell lymphoma 9 (BCL9)/Legless (Lgs) with the first armadillo repeats of β-catenin (34).
BCL9/Lgs was identified in a genetic screen for wingless/Wnt signal transducing components in Drosophila (34), and it had been previously found to be translocated and overexpressed in B-cell lymphomas (64). BCL9 has been shown to contain three homology domains (HD1, HD2, and HD3) that are highly conserved between Drosophila, zebrafish, and mammals (34). The HD2 domain of BCL9 mediates the interaction with β-catenin, whereas the HD1 domain associates with a nuclear protein, Pygopus (7, 34, 42, 53). Notably, the amino-terminal third of the Drosophila BCL9/Lgs protein, comprising all three homology domains, is necessary and sufficient to rescue wingless signal activity in BCL9/Lgs mutant flies (34). BCL9 by itself has not been found to mediate transcriptional activation, and the primary function of BCL9 in Wnt signaling has been proposed to consist of a "scaffolding" function for the recruitment of the transcriptional coactivator Pygopus (50). In mammalian cells, another BCL9 gene, termed BCL9-2 or BCL9L, has been identified and proposed to mediate a Wnt response in a Pygopus-independent manner by its association with a tyrosine-142-phosphorylated form of β-catenin, which impairs the association with
-catenin (1, 10). Additional analysis of BCL9L showed that it also collaborates with Pygopus and can functionally replace BCL9 both in cultured cells and in vivo (25).
The nuclear protein Pygopus has been shown to contain a C-terminal domain that mediates association with the HD1 domain of BCL9 and an amino-terminal PHD domain that has been implicated in recruiting a transcription coactivator (26, 34, 53). In addition, the exclusive nuclear localization of Pygopus has been shown to facilitate the nuclear localization of BCL9 protein, which by itself is found in both the cytoplasm and the nucleus (55). Based on these observations, a "chain of adaptors" model in which Pygopus is the most distal component has been proposed (50). Recently, Pygopus has also been found to be associated constitutively with TCF target genes in Drosophila salivary glands and tissue cultures in a BCL9/Lgs-independent manner (19). Analysis of the function of the Pygopus 1 (Pygo1) and Pygo2 genes in the mouse by the combined targeted gene inactivation revealed fairly specific developmental defects rather than general defects in Wnt signaling (47). Therefore, the question as to whether BCL9 can also function independently of Pygopus arises. Here, we study the function of BCL9 and find that it contains a transcriptional activation domain that synergizes with the activation domain of β-catenin and acts, at least in part, independently of Pygopus and in a cell-type-specific manner.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and transfection. Raji, Namalwa, Bjab, and Jurkat cells were grown in RPMI supplemented with 10% fetal calf serum and penicillin-streptomycin-glutamine (PSG). HeLa and HEK293 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and PSG. Suspension cells were electroporated using the GenePulser II system (Bio-Rad). Lymphoid cells were electroporated using 1 µg reporter, 1 µg β-galactosidase, 0.5 µg TCF4E, and 3 µg β-catenin. BCL9 amounts are indicated in the figure legends. Pygopus1 (L-017154-00-005), Pygopus2 (L-013908-01-005), and control small interfering RNA (siRNA; D-001810-10-05) were transiently transfected at a concentration of 400 nM (Dharmacon). BCL9 and BCL9-2 knockdown Raji B cells were generated by stably integrating pSuper.neo+GFP (Oligoengine) with a BCL9-directed construct (5'GATCCCCCCTCAGAGCAGAGTATTAATTCAAGAGATTAATACTCTGCTCTGAGGTTTTTC) and pSuper.puro (Oligoengine) with a BCL9-2-directed construct (5'GATCCCCGGAACAGATTGGGCTGCATTTCAAGAGAATGCAGCCCAATCTGTTCCTTTTTC). Cells were selected with 1 mg/ml G418 and 1 µg/ml puromycin containing RPMI complete medium. HeLa cells were transiently transfected with Lipofectamine 2000 (Invitrogen). HEK293 cells were transiently transfected by the calcium phosphate method, using 0.1 µg reporter, 0.1 µg β-galactosidase, 0.05 µg TCF4E, 0.5 µg β-catenin, and 0.1 and 0.5 µg of BCL9.
Reporter gene assays. The total amount of DNA was kept constant by addition of empty-vector plasmid DNA (pCI; Clontech). Cells were harvested at 36 h posttransfection in reporter lysis buffer (Promega), and luciferase assays were conducted according to the manufacturer's instructions (Promega). Firefly luciferase activities were normalized against the independently measured activity of cotransfected β-galactosidase, using chlorphenolred-β-D-galactopyranoside (CPRG) as a substrate.
Plasmids. The hTCF4E, siamois, and cdx1 constructs have been described previously (23, 24). The LEF7-fos reporter, LEF1, and β-catenin constructs have been described previously (27). Gal4 VP16 was described previously (11). Gal45x luciferase was described previously (65). β-Catenin coding sequences were PCR amplified using Pfu polymerase (Stratagene) and cloned in pGEX3X (GE Healthcare). Point mutations in β-catenin have been introduced using QuikChange site-directed mutagenesis (Stratagene). CβS-BCL9-myc constructs under the control of a cytomegalovirus promoter have been cloned using standard cloning techniques. Bacterial BCL9 expression constructs were cloned into pGEX3X (GE Healthcare), yielding an N-terminal glutathione S-transferase (GST) fusion protein. Details are available upon request.
Immunoblot and coimmunoprecipitation assays. Cells were lysed in coimmunoprecipitation buffer (CoIP buffer; 50 mM Tris-Cl, pH 7.5, 15 mM EGTA, 100 mM NaCl, 0.1% [wt/vol] Triton X-100) supplemented with protease inhibitor mix and 0.5 mM phenylmethylsulfonyl fluoride, using sonication. Cell debris was spun down and protein concentration determined according to the Bradford method (Bio-Rad). Five hundred micrograms to one milligram of total protein was used for one immunoprecipitation, using 1 µg of antibody. Precipitates bound to protein G beads (GE Healthcare) were washed several times with CoIP buffer and liberated with sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer. Proteins were resolved on 8 to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, transferred to nitrocellulose membranes, and developed with the indicated primary and secondary antibodies. Immunoblots were incubated with enhanced chemiluminescence reagent (GE Healthcare) and exposed to X-ray films.
Recombinant protein purification. Expression constructs were transformed into BL21 and induced with 1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) at a temperature of 25°C. Upon sonication of the cell pellet, proteins were affinity purified over glutathione Sepharose (GE Healthcare) and extensively washed with a buffer containing 300 mM NaCl, 20 mM HEPES, pH 7.6, 10% glycerol, 0.5% Triton X-100, 1 mM EDTA, and 1 mM dithiothreitol. Proteins were eluted with a buffer containing 50 mM Tris-Cl, pH 8.0, and 20 mM glutathione, and for storage, the buffer was exchanged on a 25-ml desalting column (GE Healthcare) to phosphate-buffered saline, 10% glycerol, and 1 mM dithiothreitol. For circular dichroism (CD) measurements, GST-coupled proteins were cut with Factor Xa (NEB) according to the manufacturer's protocol. Cleaved GST was removed with glutathione Sepharose, and Factor Xa was removed using Factor Xa removal resin (Qiagen). CD protein samples were dialyzed against 25 mM sodium phosphate buffer, pH 7.5, without salt, and protein concentration was determined according to the theoretically determined extinction coefficients.
CD spectroscopy. Spectra were accumulated on a Jasco J-720 spectrometer. Protein solutions were filtered prior measurement. Samples were collected at an ambient temperature in a cuvette with a 0.1-cm path length. Each CD spectrum consists of eight scans at 100 nm/min, with a 1-nm slit width. Data were collected from 190 to 300 nm. CD spectra were background corrected and scaled to mean molecular ellipticity.
GST pulldown assay. Ten micrograms each of the indicated constructs was bound to glutathione beads and equilibrated in CoIP buffer. One microgram of recombinantly purified β-catenin was added, and after 1 h of incubation at 4°C on a rotary shaker, the beads were washed several times with CoIP buffer and analyzed as described for the coimmunoprecipitation assays. In the case of TRRAP interaction studies, recombinant β-catenin constructs were bound in the presence of 20 mM Tris-Cl, pH 7.5, 150 mM KCl, 0.2 mM EDTA, pH 8.0, 20% glycerol, and 0.1% Igepal CA-630. Bound proteins were incubated with 500 µg nuclear extract and essentially treated as described above, using the latter buffer instead of CoIP buffer.
Sybr green-based real-time PCR. BCL9 and Pygopus mRNA expression levels were measured using Sybr green-based real-time PCR. Total RNA was isolated with TRIzol (Invitrogen), and 2 µg of RNA was transcribed to cDNA by using 200 U Superscript II (Invitrogen) and 0.1 nmol Oligo(dT)12-18 (Roche). PCR was performed with the AbiPrism 7500 sequence detection system (Applied Biosystems). Reverse transcriptase (RT) controls were done in parallel without adding enzyme. Obtained cycle numbers were normalized to β-actin levels. Primers were used at 100 nM, and the sequences were as follows: BCL9For, 5'-AGAGAGAAGCACAGCGCCTC; BCL9Rev, 5'-CTGCAGTCTGGTATTCTGGGAAG; BCL9-2For, 5'-CAGAACCCCCTGTCACTGATG; BCL9-2Rev, 5'-CGATGGTCTTGATGGCATTG; Pygo1For, 5'-CCAAACTCTG ACCATCTAGTGGC; Pygo1Rev, 5'-GGAACGTGAGGTGGCATTCT; Pygo2For, 5'-CAGCACCGGGAGGAAGC; Pygo2Rev, 5'-TCTGGACTCTTCATTTGCAGACC; β-ActinFor, 5'-TTGCCGACAGGATGCAGAA; β-ActinRev, 5'-CACGGAGTACTTGCGCTCAG; hAxin2For, 5'-GTGAAGGCCAATGGCCAA; hAxin2Rev, 5'-CAGGCGGTGGGTTCTCG; hEcadherinFor, 5'-GAACGCATTGCCACATACACTC; and hEcadherinRev, 5'-CATTCCCGTTGGATGACACAG.
Generation of β-catenin-deficient ES cells with stably integrated wild-type and M6 β-catenin constructs. β-Cateninfloxdel/floxed embryonic stem (ES) cells (9) were cultured in Dulbecco's modified Eagle's medium supplemented with 15% fetal calf serum, PSG, nonessential amino acids, sodium pyruvate, and 1,000 U of leukemia inhibitory factor/ml. ES cells were stably transfected with either wild-type or M6 β-catenin constructs. Stable clones were selected with 1 µg/ml puromycin and identified by immunoblot analysis. Positive clones were transiently transfected with a modified Cre recombinase expression vector with an internal ribosome entry site-enhanced green fluorescent protein (EGFP; H. J. Fehling) to generate β-cateninfloxdel/floxdel ES cells. β-Cateninfloxdel/floxdel ES cell clones were identified due to EGFP expression. ES cells (β-cateninfloxdel/floxdel) were transiently transfected with Lipofectamine 2000 (Invitrogen), using 1.0 µg reporter, 1.0 µg β-galactosidase, 0.5 µg TCF4E, and 3.0 µg and 6.0 µg of wild-type β-catenin or 3.0 µg and 6.0 µg of M6 β-catenin. Further analysis was performed similarly to that for transfected cell lines.
| RESULTS |
|---|
|
|
|---|
|
|
2-fold) in HEK293 cells (1, 34). To examine whether the function of BCL9 in this synthetic promoter context is more pronounced in Raji cells, we transfected these cells with the LEF7-fos luciferase construct, together with β-catenin and either TCF4E or LEF1. A modest two- to fivefold activation was observed upon expression of BCL9 (Fig. 2E and F). Likewise, no obvious BCL9 response was detected with the cdx1 and LEF7-fos promoters in HEK293 cells (Fig. 1F and data not shown). To examine whether Pygopus could enhance the BCL9 response of the LEF7-fos promoter, we also coexpressed Pygopus in HEK293 cells. Consistent with previous observations, we failed to detect an enhancement of the BCL9 response (56; data not shown). Moreover, we could not enhance the BCL9 effect by the expression of p300/CBP, which is limiting for Wnt-dependent gene activation in HEK293 cells (23; data not shown). These results suggest that BCL9 functions in a cell-type-specific manner whereby the contribution to β-catenin depends on the promoter context. A strong promoter activity correlates with a weak BCL9 response.
BCL9-dependent transactivation is, in part, independent of Pygopus.
Currently, it is assumed that BCL9 has a scaffolding function for the recruitment of Pygopus as a transcriptional coactivator (50). To examine the relative contribution of Pygopus to the transactivation by BCL9, we generated and tested a mutant form of BCL9 (
HD1) in which the residues mediating the interaction with Pygopus (homology domain HD1) have been deleted (Fig. 3A). In transactivation assays with Raji cells, we assessed whether the observed activation potential of BCL9 is dependent on Pygopus. In comparison with the up to
18-fold enhancement of the activity of the siamois promoter by wild-type BCL9, the activation potential of
HD1-BCL9 was only 2-fold lower, suggesting that BCL9 itself may harbor a transactivation domain (Fig. 3B). Equal expression levels of the two constructs were confirmed by immunoblot analysis of extracts from HEK293 cells that have been transfected with the myc-tagged BCL9 or
HD1-BCL9 expression plasmid (Fig. 3C).
|
HD1-BCL9 (Fig. 3D). Efficient association of Pygo2 was observed with the wild-type but not the
HD1-BCL9 protein. The modest decrease of transcriptional activation by the
HD1 mutation could, in principle, also be due to a multimerization of the mutant BCL9 protein with endogenous wild-type BCL9. Therefore, we also examined the effect of Pygo2 on transcriptional activation by
HD1-BCL9 in Raji cells, in which the expression levels of endogenous BCL9 and BCL9-2 had been reduced by siRNA. We generated Raji cell clones by stable transfection of BCL9 and BCL9-2 siRNA and examined downregulation of mRNA and protein levels by quantitative RT-PCR and immunoblot analysis. In one clone, we observed 10-fold and
3-fold downregulations of BCL9 and BCL9-2 mRNA, respectively (Fig. 3E). We also observed a marked downregulation of BCL9 protein in immunoblot analysis (Fig. 3F). As no anti-BCL9-2 antibody is available, we could not assess the downregulation of BCL9-2 protein. Using the BCL9 BCL9-2 double-knockdown cells for transient transfection, we observed an approximately threefold increase of activation of β-catenin-dependent transcription by BCL9 compared to the level for wild-type Raji cells (Fig. 3G and B). However, activation by
HD1-BCL9 was also only modestly reduced in BCL9 BCL9-2 double-knockdown cells. We also examined the effects of siRNA-mediated downregulation of Pygo1 and Pygo2 in Raji cells. Transient transfection of Pygo1 and Pygo2 siRNA into Raji cells reduced mRNA levels to 6% and 13%, respectively (data not shown). Cotransfection of Pygo1 and Pygo2 siRNA, individually or in combination, decreased BCL9-mediated transactivation of the siamois promoter by a factor of <2 (data not shown). Taken together, these experiments suggest that the transactivation function of BCL9 is, to a large extent, independent of Pygopus proteins.
Previous experiments with Drosophila melanogaster indicated that a BCL9 deletion construct comprising only homology domains 1 to 3 (HD1-3) was able to rescue development in a BCL9/Lgs mutant background (34). In contrast, the amino-terminal third of BCL9, containing HD1-3, was unable to augment β-catenin-dependent transactivation, despite a level of expression similar to that of wild-type BCL9 (Fig. 3H and data not shown). Moreover, we found that overexpression of the HD1-3 fragment of BCL9 reduced transactivation by wild-type BCL9 to a level that is even lower than that observed without expression of exogenous BCL9 (Fig. 3I). This "squelching" effect of HD1-3, below the level observed with TCF4E-β-catenin alone, suggests that endogenous BCL9 contributes to reporter activity.
Delineation of a transactivation domain in the C terminus of BCL9.
To delineate the putative transactivation domain in BCL9, we generated a series of C-terminally truncated proteins (Fig. 4A). Immunoblot analysis with an anti-BCL9 antibody indicated that the expression levels of these constructs were similar (Fig. 4B). Truncation of amino acids residing C-terminal of residue 833 (
C3) markedly impaired BCL9-dependent transactivation (Fig. 4C). To confirm that this mutant BCL9 protein and other C-terminally truncated proteins are properly folded, we analyzed their potential for interaction with Pygopus and β-catenin. To this end, we cotransfected expression plasmids for BCL9 and epitope-tagged Pygopus or β-catenin and performed a coimmunoprecipitation experiment (Fig. 4D and E). As anticipated, this analysis confirmed that all C-terminally truncated BCL9 proteins were able to interact with both Pygopus and β-catenin. ClustalW analysis of the region C-terminal of residue 833 revealed two domains (HD4 and HD5) that are conserved between vertebrate BCL9 and BCL9-2 proteins but are not conserved in Drosophila Legless (not shown).
|
|
C β-catenin, which lacks the C-terminal transactivation domain. Consistent with previous observations,
C β-catenin alone activated the siamois promoter at a threefold-lower level than wild-type β-catenin (Fig. 5E) (27). In combination with BCL9, the activation of the siamois promoter by
C β-catenin was augmented only 2-fold, whereas a 15-fold enhancement was observed with wild-type β-catenin (Fig. 5E). As
C β-catenin accumulates at a higher level than wild-type β-catenin, we used S33A β-catenin, which accumulates at a level similar to that for
C β-catenin (27; data not shown). With S33A β-catenin, we observed a 22-fold enhancement of transactivation by BCL9. The marked dependence of BCL9-mediated transactivation on the C-terminal region of β-catenin raised the question of whether the C terminus of β-catenin has a role in the physical interaction between BCL9 and β-catenin. To examine this possibility, we performed a GST pulldown experiment with GST-HD1-3 and wild-type β-catenin or
C β-catenin. With both forms of β-catenin, we observed similar efficiencies of interaction (Fig. 5F). Thus, the dependence of the transactivation function of BCL9 on the C-terminal domain of β-catenin may reflect a functional synergy between both activation domains.
Mutational analysis of the β-catenin C terminus identifies amino acids that influence coactivator binding and transactivation.
To gain further insight into the function of the C-terminal activation domain of β-catenin, we performed a mutational analysis. Secondary structure analysis of the C-terminal region predicted two short
-helices and a β-sheet motif (Fig. 6A). Moreover, a comparison of the amino acid sequences of human β-catenin and D. melanogaster armadillo allowed for the identification of conserved residues (Fig. 6B). We introduced clustered point mutations that changed conserved residues to alanines (constructs M1 to M7), and we examined the effects of these mutations on the physical interaction with coactivators. Consistent with a recent report, a mass spectrometric analysis of proteins that bind to the C-terminal region of β-catenin allowed us to identify TRRAP (transformation/transcription domain-associated protein) as an interaction partner (48; data not shown). To define the minimal domain of β-catenin that interacts with TRRAP, we performed a GST pulldown experiment in which GST fusions of different domains of β-catenin were incubated with a nuclear extract from HeLa cells. Immunoblot analysis with an anti-TRRAP antibody indicated that the amino acids between positions 727 and 781 of β-catenin comprise the minimal domain that interacts with TRRAP (Fig. 6C). Further truncations of the β-catenin C terminus markedly impaired the interaction with TRRAP (Fig. 6C). Analysis of the set of point mutations indicated that the M6 mutation (L774A/W776A) significantly reduced the interaction with TRRAP (Fig. 6C). We also confirmed the effects of the M6 mutation on the interaction with TRRAP in coimmunoprecipitations with extracts from HEK293 cells that have been transfected with myc-tagged β-catenin and FLAG-tagged TRRAP constructs. Efficient coimmunoprecipitation was detected with wild-type and S33A β-catenin but not with mutant β-catenin lacking the C terminus (
C) or carrying the M6 mutation, although in long exposures of the autoradiogram, a weak signal could be detected (Fig. 6D and data not shown). The immunoblot analysis for detection of myc-tagged β-catenin, whose results are shown in the lower panel of Fig. 6D, also demonstrates that wild-type and M6 β-catenin constructs are expressed at equal levels.
|
L774A/W776A mutant β-catenin displays differences in secondary structure formation and reporter gene activation. Mutation of the hydrophobic amino acids L774 and W776 virtually abrogated the putative hydrophobic β-sheet at the extreme C terminus of β-catenin (Fig. 6A). To assess the effect of the mutation on the secondary structure, we adopted the CD approach (31, 49). Purified recombinant wild-type and mutant (M6) β-catenin peptides (aa 727 to 781) were analyzed in the absence or presence of trifluoroethanol (TFE) and at different pH concentrations. Both parameters were shown to facilitate the formation of secondary structure, which are observed during the interaction of unfolded protein domains with protein partners (13). With the wild-type β-catenin peptide, the addition of TFE resulted in a new shoulder at 220 nm, suggesting the formation of some secondary structure (Fig. 7A). The shoulder was less pronounced with the M6 β-catenin peptide (Fig. 7B). Variations of pH had no significant effect on the CD spectra of both wild-type and M6 β-catenin peptides (Fig. 7C and D). Quantitative analysis of the spectra by use of the CONTIN algorithm revealed a modest induction of secondary structures in the wild-type β-catenin peptide upon addition of TFE (Fig. 7E). This analysis suggested that the M6 mutation impairs the ability of the C-terminal β-catenin peptide to adopt some secondary structure.
|
|
| DISCUSSION |
|---|
|
|
|---|
First, we observed cell type specificity in the function of BCL9. Although BCL9 mRNA is ubiquitously expressed and immunoblot analysis with a monoclonal anti-BCL9 antibody revealed similar protein expression levels in different cell lines, BCL9 augments β-catenin-dependent transcription primarily in lymphoid cells. In transfection assays, we observed a 5-fold activation of a siamois reporter construct in Jurkat T cells and an up to 16-fold activation in Raji B cells. In contrast, no significant promoter activation by BCL9 was detected in fibroblastic HeLa and HEK293 cells. Given the similar BCL9 protein expression levels in these cells, the cell type specificity of BCL9 function is rather unexpected and raises the possibility that posttranslational modifications or the interactions with partner proteins differ in lymphoid versus nonlymphoid cells. BCL9 has been initially identified as a gene that is translocated (t1;14)(q21;q32) in human B-cell lymphomas (64). The translocation and presumed overexpression of BCL9 protein have been proposed to contribute to the transformation of B-lymphoid cells. Moreover, a significant number of B-cell non-Hodgkin lymphomas have been correlated with alterations in the genomic organization and expression of the BCL9 locus (29). The effect of BCL9 overexpression on leukemogenesis may also be related to the cell-type-specific function of BCL9. Up-regulation of the BCL9-related protein BCL9L has also been detected in invasive carcinomas of colonic mucosa cells, raising the possibility that dysregulation of BCL9 and BCL9L contributes to aberrant activation of a nuclear Wnt response (46).
A second aspect of our findings concerns the promoter specificity of BCL9 function. In our transfection experiments, we found that the natural cdx1 and siamois promoters, which contain multiple LEF1/TCF-binding sites, respond much more strongly to BCL9 than the synthetic LEF7-fos promoter. In these experiments, we noted that the efficiency of activation by β-catenin is significantly lower with natural promoters than with the synthetic promoter. In particular, the activation of the LEF7-fos promoter by LEF1 and β-catenin is
440-fold, and it is enhanced only 2-fold by the coexpression of BCL9. In contrast, the activation of the siamois promoter by LEF1 and β-catenin is 7-fold, but it can be augmented 19-fold by BCL9. Moreover, the replacement of LEF1 with TCF1E, which increases β-catenin-dependent activation of the siamois promoter by a factor of 24, results in an additional 10-fold activation by BCL9. However, reporter activation via BCL9 is independent of the E tail, which has been recently identified as an auxiliary DBD in TCF1E and TCF4E (4; data not shown). Nevertheless, the increased activity of the TCF1E/β-catenin complex, relative to the level for LEF1/β-catenin, may reflect differences in binding of Wnt-responsive elements by LEF1 and TCF1E (3, 4). The more pronounced effect of BCL9 in the context of natural promoters raises the interesting possibility that the promoter strength might influence the dependence on BCL9. Similar promoter selectivity has been previously observed for the coactivator OcaB, which interacts with Oct transcription factors. In B-lymphoid cells, a subset of immunoglobulin kappa promoters with "suboptimal" Oct-binding sites shows a pronounced dependence on OcaB, whereas kappa promoters with "optimal" Oct-binding sites are independent of OcaB (15).
A third surprising result of our study was the identification of a potent transactivation function of BCL9. Previous genetic and functional analysis of Drosophila indicated that the amino-terminal third of BCL9/Lgs protein, including homology domains 1 to 3, is necessary and sufficient for the transcriptional regulation of Wnt target genes by BCL9/Lgs (34). Moreover, the forced expression of the HD1-3 part of BCL9 was found to complement mutations in BCL9/Lgs, and the function of BCL9 was attributed to the recruitment of Pygopus via the HD1 domain to DNA-bound TCF/β-catenin complexes (26, 34). According to these findings, a "chain of adaptors" model in which BCL9/Lgs acts solely as a "scaffolding" protein has been proposed (50). However, our transactivation experiments with lymphoid cell lines revealed a strong transactivation domain in the C-terminal half of BCL9. We found that truncations of the C terminus virtually abrogate the transcriptional activation potential of BCL9. In addition, we showed that the activation by BCL9 is, at least in part, independent of the recruitment of Pygopus, as the deletion of the HD1 domain or siRNA-mediated downregulation of Pygo1 and Pygo2 had a relatively modest effect on transactivation by BCL9.
The C-terminal region of BCL9 includes two homology domains (HD4 and HD5) that are highly conserved between mice, humans, and zebrafish. Interestingly, these homology domains are not found in the Drosophila Legless protein. HD4 and HD5 are also highly conserved between BCL9 and BCL9L/BCL9-2 (1). However, our functional analysis indicated that transactivation is mediated by a proline-rich domain residing between HD4 and HD5. Proline-rich domains have been identified as transactivation domains in several transcription factors (reviewed in references 20 and 57). A modest twofold contribution of the C-terminal half of BCL9L/BCL9-2 to transcriptional activation has been observed in transfection assays of HEK293 and SW480 cells, whereas a fourfold effect was observed in S33Y-β-catenin-induced transformation (1). Although these effects are modest compared to the function of the transactivation domain of BCL9 in Raji lymphoid cells, we consider it likely that the effects are mediated by the equivalent region in BCL9L.
Despite the cell-type-specific function of the transactivation domain in the context of full-length BCL9 protein, the domain shows similar activities in lymphoid and nonlymphoid cell lines when fused to a Gal4 DBD. This difference raises the interesting possibility that the lymphoid specificity of BCL9 function may involve the "unmasking" of a constitutive transactivation domain. Such changes in protein structure may involve cell-type-specific protein modifications or the differential interaction of protein partners. For example, the function of the C-terminal transactivation domain of β-catenin is regulated by modification of the tyrosine 654 residue in armadillo repeat 12, which has been proposed to modulate its juxtaposition with the C-terminal transactivation domain (43).
The proteins or complexes that determine the function of the C-terminal transactivation domain of BCL9 are still unknown. The apparent functional synergy with the transactivation domain of β-catenin raised the possibility that one of the known interaction partners of the C terminus of β-catenin also binds to the transactivation domain of BCL9. To this end, we performed coimmunoprecipitations of overexpressed epitope-tagged BCL9 to detect interactions with coexpressed CBP/p300, TRRAP, or parafibromin/Hyx. However, no interactions were detected, suggesting that another protein is involved in mediating the functional synergy. A functional collaboration between BCL9/Lgs and the C-terminal transactivation domain of β-catenin has also been observed in experiments in which a mutant BCL9/Lgs protein, carrying a D164A mutation that abrogates the interaction with β-catenin, was used in a transactivation experiment with β-catenin and parafibromin (41). In this experiment, the mutant form of β-catenin was found not to respond to parafibromin, suggesting that the function of Parafibromin is dependent on both the C terminus of β-catenin and BCL9. Parafibromin is a component of the PAF complex which is involved in transcriptional initiation and elongation by RNA polymerase II (2, 45, 66). Based on the interactions of CBP/p300, Brg1, and parafibromin with distinct but overlapping domains of β-catenin, it has been suggested that the recruitment of these cofactors results in a sequential or concerted histone acetylation, chromatin remodeling, and polymerase activation (41). Indeed, a careful kinetic study of the recruitment of β-catenin and β-catenin-associated proteins by Sierra and coworkers, in which the association of proteins with the c-Myc promoter was determined by chromatin immunoprecipitations, allowed for insight into the dynamics of target gene activation (48). This study showed that LEF1/TCF proteins are bound to the Wnt-responsive promoter prior to stimulation, whereas β-catenin and BCL9, Pygopus, p300 and RNA polymerase II are recruited 30' after stimulation (48). Notably, β-catenin and its protein partners dissociated 60' after stimulation and a cycling reassociation and dissociation of these proteins were found to be regulated by casein kinase II-mediated phosphorylation of the β-catenin interaction domain of LEF1 (60).
In addition to the Brg1 and CBP/p300 chromatin-modifying complexes that associate with the C terminus of β-catenin, the TRRAP/Tip60 histone acetyltransferase complex and the mixed-lineage-leukemia 1 (MLL-1) histone methyltransferase complex, which promotes H3K4 trimethylation, have been identified as cofactors of β-catenin (37, 48). Consistent with these observations, we have also identified the TRRAP/GCN5 (SAGA) complex as an interaction partner of the C terminus of β-catenin.
Although the function of BCL9 and its cofactor Pygopus in the nuclear response of Wnt signaling has been established both genetically and biochemically, the question as to whether they are obligatory cofactors of β-catenin or whether they act in a more specific context remains. For example, targeted inactivation of the Pygo2 gene or both Pygo1 and Pygo2 genes in the mouse results in relatively modest phenotypic defects (36, 47). In particular, Pygo1 Pygo2 double-deficient mice showed defects in the development of the lens of the eye and defects in the branching morphogenesis of the kidney. In addition, the crossing of Pygo1 Pygo2 double-deficient mice with transgenic mice carrying a lacZ reporter gene under the control of multimerized LEF1/TCF-binding sites indicated that Wnt signaling activity is modestly impaired (36, 47). Our observation that BCL9 can, at least in part, also act independently of Pygopus raises the interesting possibility that distinct cofactor complexes are recruited at different promoters and/or cell types. Conversely, Pygopus has also been found to directly interact with the Drosophila TCF protein, which may allow for bypassing the adaptor function of BCL9/Lgs (19). BCL9 has three conserved protein domains (HD3 to HD5), for which no interaction partners have yet been identified. These protein domains of BCL9 may allow for interactions with other DNA-binding proteins, providing some dependence on promoter context. In conclusion, our experiments indicated that BCL9 harbors a strong activation domain that synergizes with β-catenin and functions in a cell-type-specific and promoter-selective manner, which may help to augment and diversify the nuclear responses to Wnt signaling.
| ACKNOWLEDGMENTS |
|---|
This work was supported by the funds of the Max Planck Society and a grant from the German Research Foundation (DFG).
| FOOTNOTES |
|---|
Published ahead of print on 17 March 2008. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Adelman, K., W. Wei, M. B. Ardehali, J. Werner, B. Zhu, D. Reinberg, and J. T. Lis. 2006. Drosophila Paf1 modulates chromatin structure at actively transcribed genes. Mol. Cell. Biol. 26:250-260.
3. Atcha, F. A., J. E. Munguia, T. W. Li, K. Hovanes, and M. L. Waterman. 2003. A new beta-catenin-dependent activation domain in T cell factor. J. Biol. Chem. 278:16169-16175.
4. Atcha, F. A., A. Syed, B. Wu, N. Hoverter, N. N. Yokoyama, J. H. Ting, J. E. Munguia, H. J. Mangalam, J. L. Marsh, and M. L. Waterman. 2007. A unique DNA binding domain converts TCFs into strong Wnt effectors. Mol. Cell. Biol. 27:8352-8363.
5. Barker, N., A. Hurlstone, H. Musisi, A. Miles, M. Bienz, and H. Clevers. 2001. The chromatin remodelling factor Brg-1 interacts with beta-catenin to promote target gene activation. EMBO J. 20:4935-4943.[CrossRef][Medline]
6. Behrens, J., J. P. von Kries, M. Kuhl, L. Bruhn, D. Wedlich, R. Grosschedl, and W. Birchmeier. 1996. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 382:638-642.[CrossRef][Medline]
7. Belenkaya, T. Y., C. Han, H. J. Standley, X. Lin, D. W. Houston, and J. Heasman. 2002. pygopus encodes a nuclear protein essential for wingless/Wnt signaling. Development 129:4089-4101.
8. Brannon, M., M. Gomperts, L. Sumoy, R. T. Moon, and D. Kimelman. 1997. A beta-catenin/XTcf-3 complex binds to the siamois promoter to regulate dorsal axis specification in Xenopus. Genes Dev. 11:2359-2370.
9. Brault, V., R. Moore, S. Kutsch, M. Ishibashi, D. H. Rowitch, A. P. McMahon, L. Sommer, O. Boussadia, and R. Kemler. 2001. Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128:1253-1264.[Abstract]
10. Brembeck, F. H., T. Schwarz-Romond, J. Bakkers, S. Wilhelm, M. Hammerschmidt, and W. Birchmeier. 2004. Essential role of BCL9-2 in the switch between beta-catenin's adhesive and transcriptional functions. Genes Dev. 18:2225-2230.
11. Bruhn, L., A. Munnerlyn, and R. Grosschedl. 1997. ALY, a context-dependent coactivator of LEF-1 and AML-1, is required for TCRalpha enhancer function. Genes Dev. 11:640-653.
12. Brunner, E., O. Peter, L. Schweizer, and K. Basler. 1997. pangolin encodes a Lef-1 homologue that acts downstream of Armadillo to transduce the Wingless signal in Drosophila. Nature 385:829-833.[CrossRef][Medline]
13. Buck, M. 1998. Trifluoroethanol and colleagues: cosolvents come of age. Recent studies with peptides and proteins. Q. Rev. Biophys. 31:297-355.[CrossRef][Medline]
14. Cadigan, K. M., and R. Nusse. 1997. Wnt signaling: a common theme in animal development. Genes Dev. 11:3286-3305.
15. Casellas, R., M. Jankovic, G. Meyer, A. Gazumyan, Y. Luo, R. Roeder, and M. Nussenzweig. 2002. OcaB is required for normal transcription and V(D)J recombination of a subset of immunoglobulin kappa genes. Cell 110:575-585.[CrossRef][Medline]
16. Cheng, J., A. Z. Randall, M. J. Sweredoski, and P. Baldi. 2005. SCRATCH: a protein structure and structural feature prediction server. Nucleic Acids Res. 33:W72-W76.
17. Clevers, H. 2006. Wnt/beta-catenin signaling in development and disease. Cell 127:469-480.[CrossRef][Medline]
18. Cox, R. T., L.-M. Pai, C. Kirkpatrick, J. Stein, and M. Pfeifer. 1999. Roles of the C terminus of armadillo in wingless signaling in drosophila. Genetics 153:319-332.
19. de la Roche, M., and M. Bienz. 2007. Wingless-independent association of Pygopus with dTCF target genes. Curr. Biol. 17:556-561.[CrossRef][Medline]
20. Dyson, H. J., and P. E. Wright. 2005. Intrinsically unstructured proteins and their functions. Nat. Rev. Mol. Cell Biol. 6:197-208.[CrossRef][Medline]
21. Fang, M., J. Li, T. Blauwkamp, C. Bhambhani, N. Campbell, and K. M. Cadigan. 2006. C-terminal-binding protein directly activates and represses Wnt transcriptional targets in Drosophila. EMBO J. 25:2735-2745.[CrossRef][Medline]
22. Giese, K., A. Amsterdam, and R. Grosschedl. 1991. DNA-binding properties of the HMG domain of the lymphoid-specific transcriptional regulator LEF-1. Genes Dev. 5:2567-2578.
23. Hecht, A., and M. P. Stemmler. 2003. Identification of a promoter-specific transcriptional activation domain at the C terminus of the Wnt effector protein T-cell factor 4. J. Biol. Chem. 278:3776-3785.
24. Hecht, A., K. Vleminckx, M. P. Stemmler, F. van Roy, and R. Kemler. 2000. The p300/CBP acetyltransferases function as transcriptional coactivators of beta-catenin in vertebrates. EMBO J. 19:1839-1850.[CrossRef][Medline]
25. Hoffmans, R., and K. Basler. 2007. BCL9-2 binds Arm/beta-catenin in a Tyr142-independent manner and requires Pygopus for its function in Wg/Wnt signaling. Mech. Dev. 124:59-67.[CrossRef][Medline]
26. Hoffmans, R., R. Stadeli, and K. Basler. 2005. Pygopus and legless provide essential transcriptional coactivator functions to armadillo/beta-catenin. Curr. Biol. 15:1207-1211.[CrossRef][Medline]
27. Hsu, S. C., J. Galceran, and R. Grosschedl. 1998. Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with beta-catenin. Mol. Cell. Biol. 18:4807-4818.
28. Hu, Y., J. Kazenwadel, and R. James. 1993. Isolation and characterization of the murine homeobox gene cdx-1. J. Biol. Chem. 268:27214-27225.
29. Itoyama, T., G. Nanjungud, W. Chen, V. G. Dyomin, J. Teruya-Feldstein, S. C. Jhanwar, A. D. Zelenetz, and R. S. Chaganti. 2002. Molecular cytogenetic analysis of genomic instability at the 1q12-22 chromosomal site in B-cell non-Hodgkin lymphoma. Genes Chromosomes Cancer 35:318-328.[CrossRef][Medline]
30. Jho, E.-H., T. Zhang, C. Domon, C.-K. Joo, J.-N. Freund, and F. Constantini. 2002. Wnt/β-catenin/TCF signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol. 22:1172-1183.
31. Kelly, S. M., T. J. Jess, and N. C. Price. 2005. How to study proteins by circular dichroism. Biochim. Biophys. Acta 1751:119-139.[Medline]
32. Kim, S., X. Xu, A. Hecht, and T. G. Boyer. 2006. Mediator is a transducer of Wnt/beta-catenin signaling. J. Biol. Chem. 281:14066-14075.
33. Kimelman, D., and W. Xu. 2006. beta-Catenin destruction complex: insights and questions from a structural perspective. Oncogene 25:7482-7491.[CrossRef][Medline]
34. Kramps, T., O. Peter, E. Brunner, D. Nellen, B. Froesch, S. Chatterjee, M. Murone, S. Zullig, and K. Basler. 2002. Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-TCF complex. Cell 109:47-60.[CrossRef][Medline]
35. Leung, J. Y., F. T. Kolligs, R. Wu, Y. Zhai, R. Kuick, S. Hanash, K. R. Cho, and E. R. Fearon. 2002. Activation of Axin2 expression by β-catenin-T cell factor. A feedback repressor pathway regulating Wnt signaling. J. Biol. Chem. 277:21657-21665.
36. Li, B., C. Rheaume, A. Teng, V. Bilanchone, J. E. Munguia, M. Hu, S. Jessen, S. Piccolo, M. L. Waterman, and X. Dai. 2007. Developmental phenotypes and reduced Wnt signaling in mice deficient for pygopus 2. Genesis 45:318-325.[CrossRef][Medline]
37. Li, J., C. Sutter, D. S. Parker, T. Blauwkamp, M. Fang, and K. M. Cadigan. 2007. CBP/p300 are bimodal regulators of Wnt signaling. EMBO J. 26:2284-2294.[CrossRef][Medline]
38. Lickert, H., C. Domon, G. Huls, C. Wehrle, I. Duluc, H. Clevers, B. I. Meyer, J.-N. Freund, and R. Kemler. 2000. Wnt/β-catenin signaling regulates the expression of the homeobox gene cdx1 in embryonic intestine. Development 127:3805-3813.[Abstract]
39. Lustig, B., B. Jerchow, M. Sachs, S. Weiler, T. Pietsch, U. Karsten, M. van de Wetering, H. Clevers, P. M. Schlag, W. Birchmeier, and J. Behrens. 2002. Negative feedback loop of Wnt signaling through upregulation of Conductin/Axin2 in colorectal cancer and liver tumors. Mol. Cell. Biol. 22:1184-1193.
40. Molenaar, M., M. van de Wetering, M. Oosterwegel, J. Peterson-Maduro, S. Godsave, V. Korinek, J. Roose, O. Destree, and H. Clevers. 1996. XTcf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos. Cell 86:391-399.[CrossRef][Medline]
41. Mosimann, C., G. Hausmann, and K. Basler. 2006. Parafibromin/Hyrax activates Wnt/Wg target gene transcription by direct association with beta-catenin/Armadillo. Cell 125:327-341.[CrossRef][Medline]
42. Parker, D. S., J. Jemison, and K. M. Cadigan. 2002. Pygopus, a nuclear PHD-finger protein required for Wingless signaling in Drosophila. Development 129:2565-2576.
43. Piedra, J., D. Martinez, J. Castano, S. Miravet, M. Dunach, and A. G. de Herreros. 2001. Regulation of beta-catenin structure and activity by tyrosine phosphorylation. J. Biol. Chem. 276:20436-20443.
44. Riese, J., X. Yu, A. Munnerlyn, S. Eresh, S. C. Hsu, R. Grosschedl, and M. Bienz. 1997. LEF-1, a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. Cell 88:777-787.[CrossRef][Medline]
45. Rozenblatt-Rosen, O., C. M. Hughes, S. J. Nannepaga, K. S. Shanmugam, T. D. Copeland, T. Guszczynski, J. H. Resau, and M. Meyerson. 2005. The parafibromin tumor suppressor protein is part of a human Paf1 complex. Mol. Cell. Biol. 25:612-620.
46. Sakamoto, I., S. Ohwada, H. Toya, N. Togo, K. Kashiwabara, T. Oyama, T. Nakajima, H. Ito, S. Adachi, T. Jigami, and T. Akiyama. 2007. Up-regulation of a BCL9-related beta-catenin-binding protein, B9L, in different stages of sporadic colorectal adenoma. Cancer Sci. 98:83-87.[CrossRef][Medline]
47. Schwab, K. R., L. T. Patterson, H. A. Hartman, N. Song, R. A. Lang, X. Lin, and S. S. Potter. 2007. Pygo1 and Pygo2 roles in Wnt signaling in mammalian kidney development. BMC Biol. 5:15.[CrossRef][Medline]
48. Sierra, J., T. Yoshida, C. A. Joazeiro, and K. A. Jones. 2006. The APC tumor suppressor counteracts beta-catenin activation and H3K4 methylation at Wnt target genes. Genes Dev. 20:586-600.<