This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lund, M. K.
Right arrow Articles by Guthrie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lund, M. K.
Right arrow Articles by Guthrie, C.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2008, p. 3873-3881, Vol. 28, No. 11
0270-7306/08/$08.00+0     doi:10.1128/MCB.02153-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Autoregulation of Npl3, a Yeast SR Protein, Requires a Novel Downstream Region and Serine Phosphorylation{triangledown}

Mette K. Lund,1 Tracy L. Kress,2 and Christine Guthrie2*

Department of Molecular Biology, University of Aarhus, C. F. Mollers Alle, 8000 Aarhus C, Denmark,1 Department of Biochemistry and Biophysics, UCSF Medical School, Genentech Hall, 600 16th Street, San Francisco, California 941432

Received 3 December 2007/ Returned for modification 25 February 2008/ Accepted 26 March 2008


arrow
ABSTRACT
 
Npl3 is an SR-like protein with documented roles in mRNA export and transcription termination. Maintaining appropriate levels of Npl3 protein is critical for cell survival. Here we show that Npl3 negatively regulates its own expression via modulation of its mRNA levels. By creating gene chimeras, we demonstrate that the region downstream of the coding sequence of Npl3 is necessary and sufficient to confer regulation. The use of different polyadenylation sites in this region results in at least two stable RNAs; read-through of these sites causes the formation of 3'-extended RNAs that are highly unstable and therefore largely unproductive. Increasing the amount of Npl3 protein promotes read-through. Notably, the loss of Npl3 phosphorylation promotes the use of the productive polyadenylation sites, resulting in elevated levels of Npl3 protein. We propose that proper levels of Npl3 protein are achieved by a negative feedback loop in which phosphorylated Npl3 suppresses efficient recognition of the productive processing signals in its own transcript.


arrow
INTRODUCTION
 
Protein-coding mRNAs are produced in the nucleus by the cotranscriptional capping, polyadenylation, and splicing of primary transcripts prior to their export to the cytoplasm and engagement with the translation machinery. In Saccharomyces cerevisiae, the abundant RNA-binding protein Npl3 is involved in most, if not all, of these steps. Npl3 shares structural characteristics with two large classes of RNA binding proteins in higher eukaryotes, the SR (serine/arginine-rich) and hnRNP families. Both classes contain one or more N-terminal RNA recognition motifs, while their C termini contain amino acids required for distinctive posttranslational modifications (6). SR proteins are reversibly phosphorylated on multiple SR/RS dipeptides (reviewed in references 13 and 38), while many hnRNP proteins contain dimethylated arginines within closely repeated RGG tripeptides (23). Npl3 contains two RNA recognition motifs in its N terminus, and the C-terminal domain contains a number of RGG tripeptides (six of which are in the sequence context SRGG) and two RS dipeptides (3, 30). Previous work has shown that Npl3 is both methylated and phosphorylated (10, 25, 34, 46). Unlike that of mammalian SR proteins, Npl3 phosphorylation depends on the presence of a single RS dipeptide. Notably, the Sky1 kinase has high homology to the mammalian SR-specific protein kinase SRPK (10, 33).

Mammalian SR proteins are best understood for their roles in constitutive and regulated alternative splicing (reviewed in reference 13). More recently, a role for mammalian SR proteins in mRNA export has also been described (16, 17, 20). Conversely, yeast (S. cerevisiae) Npl3 was first identified by its requirement in mRNA export (21, 35), but we have now shown that Npl3 is also required for the efficient splicing of a subset of intron-containing genes (T. L. Kress and C. Guthrie, unpublished data). Interestingly, a novel role for Npl3 was identified in a genetic screen for mutants in which the efficiency of transcription termination is increased (4). Recently, this function has been correlated in vitro with the ability of high levels of Npl3 to antagonize the recruitment of factors required for 3' mRNA processing (4, 5, 44). Finally, impairment of the ability of Npl3 to shuttle results in increased association with polysomes, suggesting a role for Npl3 in the regulation of translation (43).

In light of the broad range of cellular functions with which Npl3 is associated, it is anticipated that the activity of Npl3 is tightly regulated, likely by multiple mechanisms. One way in which the activity of Npl3 is controlled is via posttranslational modification. The phosphorylation state of Npl3 is critical for its role in mRNA export, where dephosphorylation of RNA-bound Npl3 by the phosphatase Glc7 in the nucleus is coupled to the recruitment of the major mRNA export receptor Mex67 to the RNA (9, 10). Although the precise timing of dephosphorylation is unknown, Glc7 is physically associated with the 3' end machinery (27, 42). This association parallels the situation in mammals, where hypophosphorylated SR proteins act as adaptors for the mammalian homolog of Mex67, TAP/NXF1 (17, 20). Npl3 is exported, together with the mRNA (19), and once in the cytoplasm, Npl3 is phosphorylated by the kinase Sky1, allowing for the dissociation of the newly exported Npl3/RNA complexes and the reimport of Npl3 into the nucleus by the karyopherin Mtr10 (10, 28, 32, 46).

Balanced levels of Npl3 are critical for cell viability; both the overexpression and deletion of Npl3 are toxic (7, 36), indicating that the expression of Npl3 might also be regulated. A particularly effective strategy for controlling the levels of RNA binding proteins is through autoregulation; for example, when binding to a primary RNA target approaches saturation, further gene expression can be down-regulated by binding to secondary RNA targets (in this case, the protein's own RNA). We report here that Npl3 regulates its own expression by a novel mechanism in which appropriate levels of Npl3 are achieved by the inhibition of its normal cleavage and polyadenylation signals. Increasing levels of Npl3 protein suppress the use of these sites, resulting in 3'-extended RNAs that are targeted for degradation. This mechanism fits well with the observation that Npl3 can prevent premature transcription termination by suppressing cryptic 3' end formation (4, 44). Importantly, effective autoregulation requires that Npl3 be phosphorylated. We propose that phosphorylated Npl3 suppresses the use of the productive 3' end formation signals in the 3' untranscribed region (UTR) of NPL3.


arrow
MATERIALS AND METHODS
 
Yeast strains. The yeast strains used and constructed in this study are listed in Table 1. All strains are isogenic with yMKL200, which is in the deletion consortium genetic background (S288C derived). yTK87, where the S411A mutation is integrated in the NPL3 locus, was made by homologous recombination using MfeI-digested pRS306-npl-S411A and yMKL200 as the parental strain. yMKL186, in which the chromosomal copy of NPL3 is replaced by the S411A mutation, followed by the ADH1 terminator and the His3MX6 module, was generated by the method of Longtine et al. (24) by using yMKL200 as the parental strain and primers OWG63 (5'-AGAACCAGAGATGCTCCACGTGAAAGAGCACCAACCAGGTGAGGCGCGCCACTTCTAAA-3') and OWG54 (5'-TGTTTTCCTTTTTCATTTGTTCTCAGTCTCATATTTAAGGAATTCGAGCTCGTTTAAAC-3'). yMKL185 and yMKL187, where wild-type NPL3 is followed by the ADH1 terminator and the His3MX6 module, were created using by yMKL200 and yMKL201 as the parental strains, respectively, and the same OWG54 reverse primer and OWG62 (5'-AGAACCAGAGATGCTCCACGTGAAAGATCACCAACCAGGTGAGGCGCGCCACTTCTAAA-3'). yMKL281 and yMKL283, in which the chromosomal copy of RRP6 is replaced with the His3MX6 module, were created by the method of Longtine et al. (24) by using yMKL200 and yTK87 as the parental strains, respectively. yMKL325 and yMKL327 were isolated from a cross between yMKL283 and a xrn1::KAN MAT{alpha} strain from the consortium deletion library. Yeast was grown at 30°C in yeast extract-peptone-dextrose or in selective medium (synthetic dextrose-URA or synthetic dextrose-LEU) when plasmids were present.


View this table:
[in this window]
[in a new window]

 
TABLE 1. Yeast strains used in this studya

Plasmids. pRS315-GFP-Npl3 and pRS315-GFP-npl3-S411A have previously been described (10). pRS306-npl3-S411A was made by inserting the PvuII fragment from pRS315-GFP-npl3-S411A that contains the open reading frame (ORF) and 3' UTR of Npl3 into PvuII-digested pRS306. pRS316-GFP-DBP5UTR was obtained by homologous recombination in wild-type yeast of BsrGI-digested pRS316-Dbp5 (40) and a DNA fragment containing the coding region of green fluorescent protein (GFP) flanked by the last 40 and first 40 nucleotides (nt) of the 5' UTR and 3' UTR, respectively, of DBP5. The GFP-containing fragment was made by PCR using the primers OML64 (5'-CTTACCACCTTAGATCGGAATGAGTGATACAAAGAGAGATAGTAAAGGAGAAGAACTTTT) and OML65 (5' AAGCTTTTACGTATTTTGAGGTATTATGTACTGAATTCTATCGCGATTTGTATAGTTCATCCATGC-3'), with pRS315-GFP-Npl3 as the template. pRS316-GFP-NPL3UTR was obtained by homologous recombination in wild-type yeast of NruI/BamHI-digested pRS316-GFP-DBP5UTR and a DNA fragment containing the 3' UTR (nt 1 to 1136 after the ORF) of Npl3 flanked by the last 40 nt of the coding region of GFP and the first 40 nt following the BamHI site in pRS316-GFP-DBP5UTR. The fragment was made by PCR using the primers OML68 (5'-AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAAGCCATTTATATAGTTGA-3') and OML69 (5'-TGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGGTACACACTTCAATTAGTAC-3'), with pRS315-GFP-Npl3 as the template.

RNA analysis. RNA was extracted from exponentially growing yeast cultures by the hot-phenol method (31). For 3' rapid amplification of cDNA ends (RACE) experiments, 10 µg total RNA (purified as described above) was mixed with 5.5 µg of the adaptor primer (5'-GTTTCCCAGTCAGATCT19V-3') in 10 µl of annealing buffer (300 mM NaCl, 10 mM Tris [pH 7.5], 2 mM EDTA), incubated at 65°C for 10 min and transferred to ice. The hybridization mixture was transferred to 40 µl of preheated 1.25x extension mix (1.25 mM each deoxynucleoside triphosphate, 12.5 mM dithiothreitol, 12.5 mM Tris [pH 8], 7.5 mM MgCl2) and incubated at 45°C for 60 min after the addition of 20 U of avian myeloblastosis virus reverse transcriptase (Life Sciences, Inc.). The cDNA was used in PCRs by using a reverse primer annealing to the adaptor primer (5'-GTTTCCCAGTCAGATCT-3'), in combination with either a reverse primer annealing to the ORF of NPL3 or a reverse primer annealing to positions 236 to 255 in the 3' UTR. The PCR products were gel purified and sequenced. Primer extension analyses were performed on 10 µg of total RNA as described previously (2), and the data were quantified by PhosphorImager analysis. For Northern blotting analysis, 8 µg of total RNA in H2O was resuspended in denaturing loading buffer (50% formamide, 6% formaldehyde, 10% glycerol, 0.1 mg/ml ethidium bromide, and dyes) and separated in a 1.2% agarose gel (39). Gel and running buffer contained 0.5x Tris-borate-EDTA and no formaldehyde. The RNA was transferred to a HybondN+ (Amersham) membrane and UV cross-linked before the membrane was blocked for 2 h at 65°C with Rapid-Hyb buffer (Amersham). Next, the RNA was hybridized with a 32P-end-labeled probe in Rapid-Hyb buffer at 42°C for 16 to 20 h. The membrane was washed two times with washing buffer (2x SSC [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 0.1% sodium dodecyl sulfate [SDS]) at 42°C for 10 min and three times at room temperature for 20 min. The RNA was quantified by PhosphorImager analysis. At least two independent experiments were carried out in order to confirm reproducibility of the results. The following oligonucleotides were used for the primer extension and Northern analysis: for NPL3 and GFP-NPL3 RNA, 5'-GGTGCTGTTCTTCGACTGGGGCATCG-3'; for GFP RNA, 5'-TGTGCCCATTAACATCACCA-3'; for PGK1 RNA, 5'-ATCTTGGGTGGTGTTCC-3'; and for U2 snRNA, 5'-CAGATACTACACTTG-3'.

Protein analysis. Whole-cell lysate was prepared from equal A600 amounts of exponentially growing yeast cultures by bead-beating in trichloroacetic acid (TCA) buffer (20 mM Tris-HCl [pH 8.0], 50 mM NH4OAc, 2 mM EDTA, 10% TCA) in the presence of protease inhibitors. The lysate was centrifuged, and the pellets were resuspended in TCA-Laemmli loading buffer (3.5% [wt/vol] SDS, 80 mM Tris-base, 8 mM EDTA, 14% glycerol, 120 mM dithiothreitol). The protein content was analyzed by SDS-polyacrylamide gel electrophoresis, and immunoblotting was performed with the following antibodies: anti-Npl3 (1:3,000) (34), anti-Rpl3 (1:1,000) (41), and anti-GFP (1:1,000) (Roche).


arrow
RESULTS
 
Npl3 negatively regulates its own expression through modulation of NPL3 RNA levels. To explore the hypothesis that Npl3 is autoregulated, wild-type yeasts were transformed with a plasmid expressing N-terminal, GFP-tagged Npl3. The GFP-Npl3 module was flanked by the NPL3 gene's own 5' and 3' sequences. The downstream sequence (referred to from here on as the "3' region" of Npl3) included the first 1,135 nt of the 1,210 nt that separate the chromosomal Npl3 ORF and the downstream ORF. In the event of autoregulation, the expectation would be that the amount of endogenous Npl3 should decrease to maintain total Npl3 at the normal level. Indeed, when Npl3 levels were examined by Western blotting, the presence of exogenous GFP-Npl3 reduced endogenous Npl3 expression (Fig. 1A, compare lanes 1 and 2). We also observed that Npl3 protein levels increased (Fig. 1A, lane 3) when the 3' region of the endogenous NPL3 gene was replaced with the ADH1 terminator (referred to as NPL3-ADH1UTR) as a result of PCR-mediated protein-tagging strategies. This observation strongly suggested that the 3' region is important for maintaining an appropriate Npl3 concentration (see below). In addition, the NPL3-ADH1UTR strain provided a useful tool to test whether endogenous Npl3 can influence the level to which exogenous Npl3 can be expressed. In the NPL3-ADH1UTR strain, which has increased endogenous Npl3 levels, the amount of exogenously expressed GFP-Npl3 was reduced (Fig. 1A, compare lanes 2 and 4, and see Fig. 5A, lanes 2 and 5). Primer extension confirmed the presence of the GFP-Npl3 plasmid in the NPL3-ADH1UTR strain (Fig. 1B, lanes 2 and 4). Therefore, Npl3 negatively regulates its own expression.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 1. Npl3 is autoregulated. Whole-cell extracts were prepared from cells where the endogenous NPL3 ORF was followed by the 3' region of NPL3 (wt) or ADH1 (NPL3-ADH1UTR) and contained either an N-terminally tagged GFP-Npl3 plasmid (+) or an empty vector control (–). (A) Protein content was analyzed by Western blotting using polyclonal anti-Npl3 antibodies that recognize both endogenous untagged and plasmid-borne GFP-tagged Npl3. The Rpl3 component of the large ribosomal subunit was included as an internal loading control. (B) RNA content was analyzed by primer extension using a primer hybridizing to the coding region of NPL3 RNA, thus recognizing both endogenous untagged and plasmid-encoded GFP-NPL3 RNA. The primer extension shown is a representative of three independent experiments. Only the sections (from the same exposure) containing primer extension products are shown. (C) The relative amounts of NPL3 RNA were calculated after standardization to the amount of PGK1 mRNA (average ± standard deviation of three experiments).


Figure 5
View larger version (52K):
[in this window]
[in a new window]

 
FIG. 5. Phosphorylation of Npl3 is necessary for regulation. (A) Whole-cell extracts were prepared from cells where the endogenous NPL3 ORF was followed by the NPL3 or ADH1 3' region and contained either a wild-type (wt) GFP-Npl3 (lanes 2 and 5), a mutant GFP-S411A plasmid (lanes 3 and 6), or an empty vector control (lanes 1 and 4). Protein content was analyzed by Western blotting with anti-Npl3 polyclonal antibodies recognizing both tagged and untagged Npl3. (B and C) Whole-cell extracts were prepared from cells where the coding region of wild-type NPL3 and mutant npl3-S411A was followed by the NPL3 or ADH1 3' region. Npl3 protein was analyzed by Western blotting with Rpl3 as an internal loading control (B) and RNA content was analyzed by primer extension (C). The primer extension shown is representative of four independent experiments. The relative amounts of NPL3 RNA after standardization to the amount of PGK1 mRNA (average ± standard deviation) were for lane 1, 1.0 ± 0.0; for lane 2, 2.16 ± 0.36; for lane 3, 1.68 ± 0.21; and for lane 4, 1.89 ± 0.22.

Since Npl3 is an RNA binding protein with functions in multiple aspects of mRNA processing, it seemed plausible that autoregulation would happen at the level of RNA. To determine whether changes in Npl3 protein levels were mirrored by similar changes in NPL3 RNA levels, primer extension was carried out with a primer hybridizing to nt 51 to 76 of the coding region of Npl3, thus recognizing both NPL3 and GFP-NPL3 RNA species (Fig. 1B). Visualization of expressed RNA using tiling microarrays predicts that transcription of the NPL3 gene is initiated approximately 25 nt upstream of the ORF (37). In agreement with this prediction, primer extension on NPL3 RNA resulted in multiple bands with lengths of 100 to 105 nt (Fig. 1B). This result corresponds to a 20- to 25-nt-long 5' UTR. Consistent with the changes in protein levels, the amount of endogenous NPL3 RNA was reduced in the presence of exogenously expressed GFP-Npl3 (Fig. 1B and C, lanes 1 and 2). In addition, the increased levels of endogenous Npl3 in the NPL3-ADH1UTR strain reduced the RNA levels of exogenous GFP-NPL3 (Fig. 1B, compare lanes 2 and 4). Importantly, hybrid transcripts containing the NPL3 ORF and the ADH1 3' region were insensitive to exogenously expressed GFP-Npl3 (Fig. 1B and C, lanes 3 and 4), suggesting that the wild-type 3' region of NPL3 mediates the autoregulation by controlling NPL3 RNA levels.

NPL3 3' region can confer Npl3 responsiveness on an unrelated reporter. The 3' region of NPL3 is necessary for maintaining wild-type levels of NPL3 RNA and protein (Fig. 1A and B, lanes 3 and 4). Furthermore, the GFP-Npl3 construct that includes nt 1 to 1135 of this downstream region contains all the sequences essential for regulation (Fig. 1). To test whether the presence of the NPL3 3' region would be sufficient to render an unrelated RNA and protein sensitive to the concentration of Npl3, wild-type and NPL3-ADH1UTR strains were transformed with a plasmid containing the coding region of GFP fused to nt 1 to 1135 of the NPL3 3' region (GFP-NPL3UTR) (Fig. 2A) and the expression of the GFP reporter was assayed by Western blotting (Fig. 2B). If the 3' region of Npl3 is sufficient for autoregulation of Npl3, we would predict that the increased concentration of Npl3 in the NPL3-ADH1UTR strain should reduce GFP expression from the plasmid. Indeed, the amount of GFP produced from the GFP-NPL3UTR reporter was dramatically reduced in the presence of the higher Npl3 concentration (Fig. 2B, compare lanes 2 and 4). To confirm that this was a specific feature of the NPL3 3' region, we transformed the wild-type and NPL3-ADH1UTR strains with a plasmid containing GFP fused to the 3' region of DBP5 (GFP-DBP5UTR). The amount of GFP produced from the GFP-DBP5UTR reporter was unaffected (Fig. 2B, lanes 1 and 3), indicating that the observed regulation was controlled by the NPL3 3' region. Npl3 levels did not affect Dbp5 expression (data not shown). To confirm that Npl3 controls the protein concentration by influencing RNA levels, we performed primer extension on GFP RNA and, as predicted, the lower level of GFP protein in the NPL3-ADH1UTR strain was reflected by reduced GFP RNA levels (Fig. 2C; the reduction in GFP RNA appeared to be smaller than the reduction in GFP protein [see Discussion]). Thus, the 3' region of NPL3 is sufficient to confer sensitivity to Npl3 protein levels on an unrelated RNA and its corresponding protein.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 2. NPL3 3' region is sufficient for regulation. (A) Yeast was transformed with reporter plasmids containing the coding region of GFP fused to the 3' region of either NPL3 or DBP5. (B and C) Whole-cell extracts were prepared from cells where the endogenous NPL3 ORF was followed by the NPL3 (wt) or ADH1 3' region (NPL3-ADH1UTR) and contained the reporter plasmids. GFP protein was analyzed by Western blotting with Rpl3 as an internal loading control (B), and RNA content was analyzed by primer extension (C). The relative amounts of NPL3 RNA (average ± standard deviation of four independent experiments) were calculated after being standardized to the amount of PGK1 mRNA. wt, wild type.

Autoregulation involves production of 3'-extended NPL3 RNA. Our results indicate that the 3' region of NPL3 is necessary and sufficient for Npl3 autoregulation. Because Npl3 has been shown to function as an antagonist of transcription termination/3' end formation (4), an appealing model is that the regulation of 3' end formation is also involved in the autoregulatory process. If Npl3 prevents the efficient termination of its own transcript, this may result in 3'-extended NPL3 RNAs. To evaluate whether this is the case, we determined the cleavage/polyadenylation sites of the NPL3 mRNA by using the 3' RACE technique and identified three termination sites. 3' RACE analysis with a forward PCR primer in the ORF produced mainly a short product (3' RACE product 1), resulting from polyadenylation 17 nt downstream of the ORF (Fig. 3A), and a minor product (product 2), resulting from polyadenylation approximately 230 nt downstream of the ORF. Position 17 is followed by a stretch of 17 purines, primarily adenines; thus, the short product likely resulted from the hybridization of the oligo(dT) reverse transcriptase primer independently of a poly(A) tail. In addition, we detected another major site 407 nt downstream of the ORF and a minor site 449 nt downstream of the ORF (products 3 and 4) using a forward PCR primer that hybridized downstream of the 230 site.


Figure 3
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 3. Npl3 affects the balance between stable and unstable NPL3 RNA species. (A) Schematic of cleavage/polyadenylation sites of Npl3. Shown are four potential polyadenylation sites at positions 17, 230, 407, and 449 after the ORFs were detected by 3' RACE. Position 17 reflects the mispriming of the dT20V primer to positions 18 to 34 (GAAAAAAAAAGGAGAAA). (B) Whole-cell extracts were prepared from wild-type cells and cells deleted for NPL3, RRP6, XRN1, or UPF1. NPL3 and PGK1 RNAs were detected by Northern blotting. The ratios of the stable NPL3 RNA species (230 and 407/449) to the 3'-extended RNA were calculated and are displayed below the lane numbers. wt, wild type; 3'-ext, 3'-extended.

To determine whether 3'-extended NPL3 RNAs are in fact produced, we prepared total RNA from wild-type cells and carried out Northern blotting to analyze NPL3 mRNA length. RNAs produced by polyadenylation at 230 and 407/449 nt downstream of the 1,245-nt-long ORF and containing a 5' UTR of 20 to 25 nt were expected to be approximately 1,500 and 1,700 nt long, respectively (assuming that RNAs using the 407 and the 449 sites would not be separated on the gel). In agreement with this expectation, a probe annealing to the coding region detected two NPL3 RNA species migrating just below the 1,789-nt-long 16S rRNA in a wild-type strain that were absent in a strain deleted for the NPL3 gene (Fig. 3B, lanes 1 and 2). A probe hybridizing to position 326 to 345 downstream of the ORF recognized only the longest product (data not shown), confirming that the shorter RNA does not contain this region. Thus, the two bands migrating below the 16S rRNA most likely corresponded to NPL3 RNAs that were cleaved and polyadenylated at positions 230 and 407/449. In addition to these RNAs, a 3'-extended RNA was present at low levels.

Because 3'-extended RNAs might be unstable and therefore difficult to detect in a wild-type strain, we carried out the assay with a number of strains deleted for factors functioning in nuclear and cytoplasmic RNA degradation and compared these results to those from the wild-type strain (Fig. 3B, lanes 3 to 5). Upon deletion of the nuclear exosome component RRP6 or the cytoplasmic 5'-3' exonuclease XRN1, the amount of 3'-extended RNA increased substantially (Fig. 3B, compare lanes 3 and 4 to lane 2). An aberrantly extended 3' UTR can also trigger nonsense-mediated decay (NMD) (26). The 3'-extended RNA, however, was not detectably stabilized in a strain deleted for the NMD factor UPF1 (Fig. 3B, lane 5), making it unlikely that the 3'-extended RNA is an NMD target.

If Npl3 does regulate its own expression by promoting read-through/preventing termination, we predict increased Npl3 levels to reduce the amount of the short productive RNA and increase the amount of the nonproductive 3'-extended RNA. To test this prediction, we used the GFP-NPL3UTR reporter that produces transcripts with the coding region of GFP, followed by the 3' region (nt 1 to 1135) of NPL3. 3' RACE identified cleavage/polyadenylation sites at positions 407 and 449 (data not shown), which is similar to the situation found for NPL3 RNA. Thus, the reporter appeared to recapitulate the termination pattern of NPL3 transcripts. This result was confirmed when we transformed both a wild-type strain that has normal levels of endogenous Npl3 and the strain that overexpresses Npl3 (NPL3-ADH1UTR) with the GFP-NPL3UTR plasmid and measured the levels of GFP RNA species by Northern blotting (Fig. 4). While one short RNA (polyadenylation site 230) was predominant in wild-type cells, a minor RNA (polyadenylation site 407/449) and small amounts of a 3'-extended RNA were also present (Fig. 4, lane 1). As predicted, in a strain that overexpressed Npl3 (NPL3-ADH1UTR), the levels of the short GFP RNAs were greatly reduced (Fig. 4, lane 2). We did not observe an increase in the amount of the extended RNA in NPL3-ADH1UTR cells, most likely because the RNA is unstable, as we have shown above (Fig. 3). In order to stabilize the 3'-extended RNA, we deleted the nuclear exosome component RRP6 in the strain overexpressing Npl3 (NPL3-ADH1UTR). Indeed, when RRP6 was deleted, we observed an increase in the 3'-extended RNA (Fig. 4, compare lanes 3 and 4). These results show that excess Npl3 does indeed lead to increased formation of 3'-extended RNA, consistent with the model that Npl3 promotes read-through of the termination sites of its own 3' region, leading to the production of an unstable, nonproductive 3'-extended RNA.


Figure 4
View larger version (31K):
[in this window]
[in a new window]

 
FIG. 4. Increased Npl3 levels result in an increase in unstable 3'-extended (3'-ext) NPL3 RNA. Whole-cell extracts were prepared from wild-type, NPL3-ADH1UTR, rrp6{Delta}, and rrp6{Delta} NPL3-ADH1UTR strains containing the GFP reporter with the NPL3 3' region. GFP and PGK1 RNAs were detected by Northern blotting. The ratios of the stable GFP RNA species (230 and 407/449) to the 3'-extended RNA were calculated and are displayed below the lane numbers. wt, wild type.

Phosphorylation of Npl3 is critical for proper regulation. The C-terminal region of Npl3 contains a serine residue (S411) that is subject to phosphorylation by the cytoplasmic kinase Sky1 and dephosphorylation by the nuclear phosphatase Glc7 (9, 10). Npl3 contains eight SR/RS dipeptides in the C-terminal region, but Npl3 phosphorylation by Sky1 depends on the presence of only S411 (10). Furthermore, this serine is the substrate not only of Sky1 but also of additional kinases (10), strongly supporting the notion that phosphorylation is the major role of this residue. The mutation of S411 to alanine (npl3-S411A) inhibits the phosphorylation of Npl3 and gives rise to defects in mRNA export. Since the phosphorylation of Npl3 is important for at least one biological function of Npl3, we predicted that phosphorylation might also be critical for its regulation. Wild-type yeasts were transformed with plasmids expressing N-terminally tagged GFP-Npl3 and GFP-Npl3-S411A. While exogenously expressed GFP-Npl3 decreased the expression levels of endogenous Npl3 modestly (Fig. 5A, lanes 1 and 2), endogenous Npl3 levels were not affected by the presence of exogenous GFP-Npl3-S411A protein, indicating that phosphorylation is indeed necessary for Npl3 autoregulation. Since GFP-Npl3-S411A protein is detectable in both the cytoplasm and the nucleus, while GFP-Npl3 localizes exclusively to the nucleus (10), phosphorylation could potentially be required indirectly for autoregulation due to the effect on localization. There was, however, at least threefold more GFP-Npl3-S411A protein than GFP-Npl3 protein expressed from the plasmid (Fig. 5A, compare lanes 2 and 3), and even with a substantial fraction of the mutant protein in the cytoplasm, a large amount of mutant protein would be present in the nucleus. Therefore, the effect of phosphorylation on autoregulation is likely to be direct. Significantly more mutant GFP-Npl3-S411A protein than wild-type GFP-Npl3 was produced from the plasmid, even though more endogenously expressed Npl3 was present (Fig. 5A, lanes 2 and 3), raising the possibility that npl3-S411A RNA itself cannot be regulated. However, when the NPL3-ADHUTR strain that overexpresses endogenous Npl3 was transformed with the GFP-Npl3-S411A plasmid, the amount of exogenous GFP-S411A protein was reduced (Fig. 5A, compare lanes 3 and 6), suggesting that npl3-S411A RNA is sensitive to Npl3 levels. An alternative explanation for the increased expression of mutant GFP-Npl3-S411A protein is that phosphorylated Npl3 is the form of the protein that that suppresses the 3' end formation. If the lack of regulation by the Npl3-S411A protein is indeed caused by a failure of the dephosphorylated protein to perform a function necessary for regulation, the phosphorylation-deficient Npl3-S411A protein should also fail to downregulate its own expression when present as the only copy of NPL3, with the consequence being an increased concentration of mutant Npl3. Western blotting (Fig. 5B) and primer extension (Fig. 5C) confirmed that the npl3-S411A strain contained both more Npl3 protein and RNA than did the corresponding wild-type strain (Fig. 5B and C, compare lanes 1 and 3). Combining the S411A mutation with the ADH1 terminator did not increase Npl3 protein and RNA levels further (Fig. 5B and C, compare lanes 2 to 4), indicating that the phosphorylation of Npl3 and the 3' region of NPL3 cooperate to control the concentration of Npl3 protein.

If the phosphorylation of Npl3 is required in order for Npl3 to function as an antiterminator of its own transcript, the inhibition of phosphorylation should result in the increased production of short translatable RNAs and a concomitant reduction in read-through product. Northern blot analysis showed that the levels of the short 230 and 407/449 RNAs were increased in the npl3-S411A strain (Fig. 6, compare lanes 1 and 2). Since the amount of the 3'-extended RNA was almost at background levels in the wild-type strain, it was not possible to accurately detect a reduction in the npl3-S411A strain. Therefore, the npl3-S411A mutation was combined with the deletion of both RRP6 and XRN1. The rationale for using this strain background, where both nuclear and cytoplasmic degradation is prevented, is that the npl3-S411A mutation results in defects in mRNA export and therefore might affect the export of the different Npl3 RNA species differentially. In the rrp6{Delta} xrn1{Delta} strain background, the npl3-S411A mutation did lead to a reduction in the production of the 3'-extended RNA and an increase in 230 and 407/449 RNAs (Fig. 6, lanes 3 and 4). Thus, phosphorylation is critical for the ability of Npl3 to prevent efficient 3' end processing of its own transcript.


Figure 6
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 6. Unphosphorylated Npl3 promotes termination. Whole-cell extracts were prepared from wild-type, npl3-S411A, rrp6{Delta} xrn1{Delta}, and rrp6{Delta} xrn1{Delta} npl3-S411A strains. (A) RNA content was analyzed by Northern blotting. (B) The relative amounts of Npl3 RNA were calculated after being standardized to the amount of PGK1 mRNA.


arrow
DISCUSSION
 
Npl3 is a highly abundant RNA binding protein whose levels must be strictly controlled; either too little or too much Npl3 is toxic (7, 36). We show here that one homeostatic mechanism involves an autoregulatory feedback loop that relies on a novel 3' region containing several potential cleavage/polyadenylation sites. We have found that the NPL3 gene produces at least three RNA transcripts. The use of different cleavage/polyadenylation sites results in the production of at least two stable RNAs. When mRNA degradation was inhibited by mutation of the nuclear or cytoplasmic turnover machinery, we observed the accumulation of a 3'-extended RNA. Thus, the read-through products are normally unstable and would not substantially contribute to Npl3 protein production. Notably, the 3' region of Npl3 is both necessary and sufficient to render an unrelated GFP-reporter construct responsive to the concentration of Npl3 in vivo. That is, increased levels of Npl3 protein result in increased read-through of the normal, upstream termination/polyadenylation site(s), reducing the production of translatable transcripts and GFP reporter protein. Finally, we show that this feedback mechanism requires that Npl3 protein is phosphorylatable.

Molecular mechanism of Npl3 autoregulation. The formation of mRNA 3' ends in yeast is a two-step procedure. The nascent transcript is cleaved 20 to 30 nt downstream of the polyadenylation signal through the cooperation of cleavage factors (CF) IA and IB and the cleavage/polyadenylation factor, followed by poly(A) tail addition by Pap1 (29). Yeast termination/polyadenylation signals are degenerate, and antitermination factors may associate with the elongating polymerase to prevent the recognition of cryptic sites located in the coding sequence. It has been suggested that Npl3 functions as such an antiterminator by reducing recruitment of the multisubunit factor CF IA (Pcf11, Rna14, Rna15, and Clp1) to weak sites (4), and an increasing amount of data supports this notion. First, NPL3 interacts genetically with RNA15 and the CF IB component HRP1 (15). Second, Npl3 reduces the transcription termination efficiency of reporter transcripts both in vitro and in vivo in a way that is correlated with reduced recruitment of Rna15 to the polyadenylation site in vivo (4). In a manner similar to that described above, the binding of Npl3 to a model substrate in vitro antagonizes Rna15 recruitment (5) and, finally, Npl3 reduces use of cryptic poly(A) sites in the coding sequence of RNA14 by blocking Rna15 and Pcf11 recruitment (44). Our data are consistent with a model in which the 3' region of NPL3 is sensitive to the concentration of Npl3, functioning as a natural substrate for transcription termination/3' end formation antagonizing activity of Npl3. Thus, the general role of Npl3 as a suppressor of cryptic sites is coupled to a specific role in its own regulation. It is likely that Npl3 autoregulation is accomplished through a major activity of Npl3 and, therefore, the role of Npl3 in 3' end formation may be more important than previously anticipated.

In mammalian cells, the U1 snRNP-specific U1A protein negatively autoregulates its own polyadenylation. U1A protein is recruited to an element in the 3' UTR of the U1A gene, allowing U1A to interact with and inhibit the activity of poly(A) polymerase (1, 14). An appealing model is that the autoregulation of Npl3, an RNA binding protein, also involves direct binding of Npl3 to its own 3' region. The identification of the predicted binding site, however, may be a challenging task. Chromatin immunoprecipitation experiments indicate that Npl3 is recruited to transcribed genes independently of the sequence of the nascent RNA (22), and analysis of cellular RNAs immunoprecipitated together with Npl3 failed to identify strong consensus RNA motifs correlated with Npl3 binding (18). Thus, other factors may contribute to the recruitment/binding of Npl3 to its target RNA.

NPL3 3' UTR is unusual with respect to length and sequence. The distance between NPL3's coding region and termination sites is unusually long (230 to 449 nt); the average 3' UTR in S. cerevisiae is approximately 100 nt long (11). This might reflect inefficient termination/polyadenylation, which in turn is likely to contribute to regulation. To ask whether the use of the distal sites is simply due to the absence of suitable sites closer to the coding region, we submitted a sequence containing the NPL3 ORF and the 1,000 downstream nucleotides to the mRNA 3' processing site predictor (12), a discrete state-space model (DSM) that calculates the likelihood of each position being the 3' end of the transcript. Interestingly, the DSM predictor suggested a number of high-scoring sites within 130 nt after the coding region, implying a more complex explanation. In agreement with our Northern blotting results, the DSM predictor also suggested the presence of strong 3' end processing sites 231 and 407 nt downstream of the coding region of Npl3. The production of the 3'-extended NPL3 RNA, however, suggests that these apparently strong sites are inefficiently used. The DSM predictor does not take the sequence context into account and occasionally makes false predictions in regions where matches to the processing elements are strong but the context for cleavage is poor (12). Thus, inhibitory sequence/structure elements within the NPL3 3' UTR may antagonize the usage of otherwise strong 3' processing signals. This is consistent with the model that Npl3 autoregulation relies on inefficient upstream 3' end formation and an unproductive downstream site.

Additional modes of Npl3 regulation. The mutation of the Sen1 helicase, which functions in the termination of noncoding RNA polymerase II transcripts, results in a reduced association of RNA polymerase II with the 3' end of the NPL3 gene 3' UTR (37). Therefore, we considered the possibility that Sen1 functions, together with Npl3, in suppressing the 3' end processing of NPL3 transcripts under wild-type conditions. However, we found that the mutation of SEN1 did not affect the distribution of NPL3 RNA species (data not shown) and, therefore, Sen1 is unlikely to be involved in Npl3 autoregulation. Future studies should address which additional factors are important for the autoregulatory mechanism.

As reviewed in the Introduction, Npl3 is an RNA binding protein predicted to be involved in an extensive range of cellular functions. The abundance of the majority of yeast proteins is predicted to range from 1,000 to 10,000 molecules per cell, and so with approximately 80,000 Npl3 molecules per cell, Npl3 is a highly expressed protein (8). Given the multitude of processes that can be affected by Npl3 and its high levels, it is likely that multiple mechanisms are involved in maintaining appropriate Npl3 levels. We noted that changes in protein levels in some instances appeared larger than the accompanying change in RNA levels. In particular, the reduction in GFP protein produced from the construct expressing GFP fused to the NPL3 3' region (GFP-NPL3UTR) in cells overexpressing Npl3 appeared to be more dramatic than the corresponding reduction in RNA levels (Fig. 2). The association of Npl3 with translating ribosomes increases when reimport to the nucleus is compromised, suggesting a potential role in translational regulation (43). Our data are consistent with the notion that Npl3 autoregulation includes an additional layer of regulation involving negative translational control.

An additional role for posttranslational modification. Npl3 differs from typical mammalian SR proteins in two significant respects, both of which involve the status of posttranslational modifications. First, while the RS domains of SR proteins are highly phosphorylated, Npl3 phosphorylation depends on the presence of a single serine residue, S411, in the so-called SR domain (10). Second, this C-terminal domain of Npl3 also contains multiple RGG repeats that are arginine methylated, a characteristic of hnRNP proteins (23, 34, 46). Since, in at least some instances, hnRNP proteins function to antagonize SR proteins in the regulation of alternative splicing, it has always been a curiosity that the yeast protein carries both modifications (see reference 34). Here we have shown that the Npl3-S411A mutant protein, which cannot be phosphorylated, fails to be efficiently autoregulated, resulting in elevated levels of Npl3 protein. Our results suggest that phosphorylated Npl3 is the form of the protein that suppresses the use of the productive cleavage/polyadenylation sites in its own 3' region and, by extension, functions generally in the suppression of cryptic 3' sites located in coding regions of other genes. An interesting question for the future is whether methylation, which is known to promote efficient export of Npl3 (25, 45), is also required for its role in transcription termination/autoregulation. Notably, mutations that prevent the methylation of Npl3 have severe growth defects when combined with a deletion of the CBC80 gene, which encodes a subunit of the nuclear cap binding complex (25). This observation, combined with the finding that Cbc80 plays a role in the suppression of cryptic termination/3' end processing sites (44), points to a role for Npl3 methylation in transcription termination/autoregulation.


arrow
ACKNOWLEDGMENTS
 
We thank J. R. Warner for anti-Rpl3 antibodies and D. Brow for the sen1-E1597K strain. We also thank members of the Guthrie laboratory for helpful discussions and critical reading of the manuscript.

This work was supported by NIH grant GM21119 (to C.G.) and fellowships from the American Heart Organization (to M.K.L.) and the American Cancer Society (to T.L.K.). C.G. is an American Cancer Society Research Professor of Molecular Genetics.


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry and Biophysics, Genentech Hall, 600 16th Street, San Francisco, CA 94143-2200. Phone: (415) 476-2321. Fax: (415) 502-5306. E-mail: guthrie{at}biochem.ucsf.edu Back

{triangledown} Published ahead of print on 7 April 2008. Back


arrow
REFERENCES
 
    1
  1. Boelens, W. C., E. J. Jansen, W. J. van Venrooij, R. Stripecke, I. W. Mattaj, and S. I. Gunderson. 1993. The human U1 snRNP-specific U1A protein inhibits polyadenylation of its own pre-mRNA. Cell 72:881-892.[CrossRef][Medline]
  2. 2
  3. Boorstein, W. R., and E. A. Craig. 1989. Primer extension analysis of RNA. Methods Enzymol. 180:347-369.[Medline]
  4. 3
  5. Bossie, M. A., C. DeHoratius, G. Barcelo, and P. Silver. 1992. A mutant nuclear protein with similarity to RNA binding proteins interferes with nuclear import in yeast. Mol. Biol. Cell 3:875-893.[Abstract]
  6. 4
  7. Bucheli, M. E., and S. Buratowski. 2005. Npl3 is an antagonist of mRNA 3' end formation by RNA polymerase II. EMBO J. 24:2150-2160.[CrossRef][Medline]
  8. 5
  9. Bucheli, M. E., X. He, C. D. Kaplan, C. L. Moore, and S. Buratowski. 2007. Polyadenylation site choice in yeast is affected by competition between Npl3 and polyadenylation factor CFI. RNA 13:1756-1764.[Abstract/Free Full Text]
  10. 6
  11. Dreyfuss, G., V. N. Kim, and N. Kataoka. 2002. Messenger-RNA-binding proteins and the messages they carry. Nat. Rev. Mol. Cell Biol. 3:195-205.[CrossRef][Medline]
  12. 7
  13. Flach, J., M. Bossie, J. Vogel, A. Corbett, T. Jinks, D. A. Willins, and P. A. Silver. 1994. A yeast RNA-binding protein shuttles between the nucleus and the cytoplasm. Mol. Cell. Biol. 14:8399-8407.[Abstract/Free Full Text]
  14. 8
  15. Ghaemmaghami, S., W. K. Huh, K. Bower, R. W. Howson, A. Belle, N. Dephoure, E. K. O'Shea, and J. S. Weissman. 2003. Global analysis of protein expression in yeast. Nature 425:737-741.[CrossRef][Medline]
  16. 9
  17. Gilbert, W., and C. Guthrie. 2004. The Glc7p nuclear phosphatase promotes mRNA export by facilitating association of Mex67p with mRNA. Mol. Cell 13:201-212.[CrossRef][Medline]
  18. 10
  19. Gilbert, W., C. W. Siebel, and C. Guthrie. 2001. Phosphorylation by Sky1p promotes Npl3p shuttling and mRNA dissociation. RNA 7:302-313.[Abstract]
  20. 11
  21. Graber, J. H., C. R. Cantor, S. C. Mohr, and T. F. Smith. 1999. Genomic detection of new yeast pre-mRNA 3'-end-processing signals. Nucleic Acids Res. 27:888-894.[Abstract/Free Full Text]
  22. 12
  23. Graber, J. H., G. D. McAllister, and T. F. Smith. 2002. Probabilistic prediction of Saccharomyces cerevisiae mRNA 3'-processing sites. Nucleic Acids Res. 30:1851-1858.[Abstract/Free Full Text]
  24. 13
  25. Graveley, B. R. 2000. Sorting out the complexity of SR protein functions. RNA 6:1197-1211.[CrossRef][Medline]
  26. 14
  27. Gunderson, S. I., K. Beyer, G. Martin, W. Keller, W. C. Boelens, and L. W. Mattaj. 1994. The human U1A snRNP protein regulates polyadenylation via a direct interaction with poly(A) polymerase. Cell 76:531-541.[CrossRef][Medline]
  28. 15
  29. Henry, M., C. Z. Borland, M. Bossie, and P. A. Silver. 1996. Potential RNA binding proteins in Saccharomyces cerevisiae identified as suppressors of temperature-sensitive mutations in NPL3. Genetics 142:103-115.[Abstract]
  30. 16
  31. Huang, Y., R. Gattoni, J. Stevenin, and J. A. Steitz. 2003. SR splicing factors serve as adapter proteins for TAP-dependent mRNA export. Mol. Cell 11:837-843.[CrossRef][Medline]
  32. 17
  33. Huang, Y., T. A. Yario, and J. A. Steitz. 2004. A molecular link between SR protein dephosphorylation and mRNA export. Proc. Natl. Acad. Sci. USA 101:9666-9670.[Abstract/Free Full Text]
  34. 18
  35. Kim Guisbert, K., K. Duncan, H. Li, and C. Guthrie. 2005. Functional specificity of shuttling hnRNPs revealed by genome-wide analysis of their RNA binding profiles. RNA 11:383-393.[Abstract/Free Full Text]
  36. 19
  37. Krebber, H., T. Taura, M. S. Lee, and P. A. Silver. 1999. Uncoupling of the hnRNP Npl3p from mRNAs during the stress-induced block in mRNA export. Genes Dev. 13:1994-2004.[Abstract/Free Full Text]
  38. 20
  39. Lai, M. C., and W. Y. Tarn. 2004. Hypophosphorylated ASF/SF2 binds TAP and is present in messenger ribonucleoproteins. J. Biol. Chem. 279:31745-31749.[Abstract/Free Full Text]
  40. 21
  41. Lee, M. S., M. Henry, and P. A. Silver. 1996. A protein that shuttles between the nucleus and the cytoplasm is an important mediator of RNA export. Genes Dev. 10:1233-1246.[Abstract/Free Full Text]
  42. 22
  43. Lei, E. P., and P. A. Silver. 2002. Intron status and 3'-end formation control cotranscriptional export of mRNA. Genes Dev. 16:2761-2766.[Abstract/Free Full Text]
  44. 23
  45. Liu, Q., and G. Dreyfuss. 1995. In vivo and in vitro arginine methylation of RNA-binding proteins. Mol. Cell. Biol. 15:2800-2808.[Abstract]
  46. 24
  47. Longtine, M. S., A. McKenzie III, D. J. Demarini, N. G. Shah, A. Wach, A. Brachat, P. Philippsen, and J. R. Pringle. 1998. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14:953-961.[CrossRef][Medline]
  48. 25
  49. McBride, A. E., J. T. Cook, E. A. Stemmler, K. L. Rutledge, K. A. McGrath, and J. A. Rubens. 2005. Arginine methylation of yeast mRNA-binding protein Npl3 directly affects its function, nuclear export, and intranuclear protein interactions. J. Biol. Chem. 280:30888-30898.[Abstract/Free Full Text]
  50. 26
  51. Muhlrad, D., and R. Parker. 1999. Aberrant mRNAs with extended 3' UTRs are substrates for rapid degradation by mRNA surveillance. RNA 5:1299-1307.[Abstract]
  52. 27
  53. Nedea, E., X. He, M. Kim, J. Pootoolal, G. Zhong, V. Canadien, T. Hughes, S. Buratowski, C. L. Moore, and J. Greenblatt. 2003. Organization and function of APT, a subcomplex of the yeast cleavage and polyadenylation factor involved in the formation of mRNA and small nucleolar RNA 3'-ends. J. Biol. Chem. 278:33000-33010.[Abstract/Free Full Text]
  54. 28
  55. Pemberton, L. F., J. S. Rosenblum, and G. Blobel. 1997. A distinct and parallel pathway for the nuclear import of an mRNA-binding protein. J. Cell Biol. 139:1645-1653.[Abstract/Free Full Text]
  56. 29
  57. Proudfoot, N., and J. O'Sullivan. 2002. Polyadenylation: a tail of two complexes. Curr. Biol. 12:R855-R857.[CrossRef][Medline]
  58. 30
  59. Russell, I. D., and D. Tollervey. 1992. NOP3 is an essential yeast protein which is required for pre-rRNA processing. J. Cell Biol. 119:737-747.[Abstract/Free Full Text]
  60. 31
  61. Schmitt, M. E., T. A. Brown, and B. L. Trumpower. 1990. A rapid and simple method for preparation of RNA from Saccharomyces cerevisiae. Nucleic Acids Res. 18:3091-3092.[Free Full Text]
  62. 32
  63. Senger, B., G. Simos, F. R. Bischoff, A. Podtelejnikov, M. Mann, and E. Hurt. 1998. Mtr10p functions as a nuclear import receptor for the mRNA-binding protein Npl3p. EMBO J. 17:2196-2207.[CrossRef][Medline]
  64. 33
  65. Siebel, C. W., L. Feng, C. Guthrie, and X. D. Fu. 1999. Conservation in budding yeast of a kinase specific for SR splicing factors. Proc. Natl. Acad. Sci. USA 96:5440-5445.[Abstract/Free Full Text]
  66. 34
  67. Siebel, C. W., and C. Guthrie. 1996. The essential yeast RNA binding protein Np13p is methylated. Proc. Natl. Acad. Sci. USA 93:13641-13646.[Abstract/Free Full Text]
  68. 35
  69. Singleton, D. R., S. Chen, M. Hitomi, C. Kumagai, and A. M. Tartakoff. 1995. A yeast protein that bidirectionally affects nucleocytoplasmic transport. J. Cell Sci. 108:265-272.[Abstract]
  70. 36
  71. Sopko, R., D. Huang, N. Preston, G. Chua, B. Papp, K. Kafadar, M. Snyder, S. G. Oliver, M. Cyert, T. R. Hughes, C. Boone, and B. Andrews. 2006. Mapping pathways and phenotypes by systematic gene overexpression. Mol. Cell 21:319-330.[CrossRef][Medline]
  72. 37
  73. Steinmetz, E. J., C. L. Warren, J. N. Kuehner, B. Panbehi, A. Z. Ansari, and D. A. Brow. 2006. Genome-wide distribution of yeast RNA polymerase II and its control by Sen1 helicase. Mol. Cell 24:735-746.[CrossRef][Medline]
  74. 38
  75. Stojdl, D. F., and J. C. Bell. 1999. SR protein kinases: the splice of life. Biochem. Cell Biol. 77:293-298.[CrossRef][Medline]
  76. 39
  77. Tollervey, D. 1987. A yeast small nuclear RNA is required for normal processing of pre-ribosomal RNA. EMBO J. 6:4169-4175.[Medline]
  78. 40
  79. Tseng, S. S., P. L. Weaver, Y. Liu, M. Hitomi, A. M. Tartakoff, and T. H. Chang. 1998. Dbp5p, a cytosolic RNA helicase, is required for poly(A)+ RNA export. EMBO J. 17:2651-2662.[CrossRef][Medline]
  80. 41
  81. Vilardell, J., and J. R. Warner. 1997. Ribosomal protein L32 of Saccharomyces cerevisiae influences both the splicing of its own transcript and the processing of rRNA. Mol. Cell. Biol. 17:1959-1965.[Abstract]
  82. 42
  83. Walsh, E. P., D. J. Lamont, K. A. Beattie, and M. J. Stark. 2002. Novel interactions of Saccharomyces cerevisiae type 1 protein phosphatase identified by single-step affinity purification and mass spectrometry. Biochemistry 41:2409-2420.[CrossRef][Medline]
  84. 43
  85. Windgassen, M., D. Sturm, I. J. Cajigas, C. I. Gonzalez, M. Seedorf, H. Bastians, and H. Krebber. 2004. Yeast shuttling SR proteins Npl3p, Gbp2p, and Hrb1p are part of the translating mRNPs, and Npl3p can function as a translational repressor. Mol. Cell. Biol. 24:10479-10491.[Abstract/Free Full Text]
  86. 44
  87. Wong, C. M., H. Qiu, C. Hu, J. Dong, and A. G. Hinnebusch. 2007. Yeast cap binding complex (CBC) impedes recruitment of cleavage factor IA to weak termination sites. Mol. Cell. Biol. 27:6520-6531.[Abstract/Free Full Text]
  88. 45
  89. Xu, C., and M. F. Henry. 2004. Nuclear export of hnRNP Hrp1p and nuclear export of hnRNP Npl3p are linked and influenced by the methylation state of Npl3p. Mol. Cell. Biol. 24:10742-10756.[Abstract/Free Full Text]
  90. 46
  91. Yun, C. Y., and X. D. Fu. 2000. Conserved SR protein kinase functions in nuclear import and its action is counteracted by arginine methylation in Saccharomyces cerevisiae. J. Cell Biol. 150:707-718.[Abstract/Free Full Text]


Molecular and Cellular Biology, June 2008, p. 3873-3881, Vol. 28, No. 11
0270-7306/08/$08.00+0     doi:10.1128/MCB.02153-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • McBride, A. E., Conboy, A. K., Brown, S. P., Ariyachet, C., Rutledge, K. L. (2009). Specific sequences within arginine-glycine-rich domains affect mRNA-binding protein function. Nucleic Acids Res 37: 4322-4330 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lund, M. K.
Right arrow Articles by Guthrie, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lund, M. K.
Right arrow Articles by Guthrie, C.