This Article Abstract Full Text (PDF) Other Versions of this Article: MCB.00019-08v1 28/12/3979    most recent Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Google Scholar Articles by Gao, L. Articles by Gross, D. S. PubMed PubMed Citation Articles by Gao, L. Articles by Gross, D. S.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, June 2008, p. 3979-3994, Vol. 28, No. 12
0270-7306/08/$08.00+0     doi:10.1128/MCB.00019-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Sir2 Silences Gene Transcription by Targeting the Transition between RNA Polymerase II Initiation and Elongation

Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, Shreveport, Louisiana 71130-3932

Received 7 January 2008/ Returned for modification 25 February 2008/ Accepted 26 March 2008

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
It is well accepted that for transcriptional silencing in budding yeast, the evolutionarily conserved lysine deacetylase Sir2, in concert with its partner proteins Sir3 and Sir4, establishes a chromatin structure that prevents RNA polymerase II (Pol II) transcription. However, the mechanism of repression remains controversial. Here, we show that the recruitment of Pol II, as well as that of the general initiation factors TBP and TFIIH, occurs unimpeded to the silent HMRa1 and HML1/HML2 mating promoters. This, together with the fact that Pol II is Ser5 phosphorylated, implies that SIR-mediated silencing is permissive to both preinitiation complex (PIC) assembly and transcription initiation. In contrast, the occupancy of factors critical to both mRNA capping and Pol II elongation, including Cet1, Abd1, Spt5, Paf1C, and TFIIS, is virtually abolished. In agreement with this, efficiency of silencing correlates not with a restriction in Pol II promoter occupancy but with a restriction in capping enzyme recruitment. These observations pinpoint the transition between polymerase initiation and elongation as the step targeted by Sir2 and indicate that transcriptional silencing is achieved through the differential accessibility of initiation and capping/elongation factors to chromatin. We compare Sir2-mediated transcriptional silencing to a second repression mechanism, mediated by Tup1. In contrast to Sir2, Tup1 prevents TBP, Pol II, and TFIIH recruitment to the HML1 promoter, thereby abrogating PIC formation.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In eukaryotes, transcription occurs in the context of chromatin. A traditional view is that nucleosomes exert their regulatory role by impeding the access of proteins, both gene-specific regulators and general transcription factors (GTFs), to the DNA (33). In support of this idea, when the TATA box is assembled into a nucleosome in vitro, its accessibility for TATA binding protein (TBP) is reduced by at least four orders of magnitude (27), while the accessibility of a high-affinity heat shock element for its cognate HSF activator is reduced by more than three orders of magnitude (66). However, it is now appreciated that in vivo, chromatin modification and remodeling complexes, in combination with histone variants and the intrinsically low affinity of many gene promoters for histones, collaborate in making the euchromatic template accessible to these and other regulatory factors (reviewed in references 36 and 71).

Heterochromatin, the cytologically condensed compartment of the eukaryotic nucleus, likewise is a substrate of chromatin-remodeling complexes and other regulatory factors (reviewed in reference 16), yet genes residing in heterochromatin generally are transcriptionally silent. A key feature of heterochromatin is its ability to repress gene expression in a position-dependent but sequence-independent fashion. Thus, the position of a gene on the chromosome, rather than its associated enhancer, upstream activation sequence (UAS), and promoter elements, can dictate its expression state. The budding yeast Saccharomyces cerevisiae does not contain condensed chromatin at the cytological level; however, it does contain domains of silent chromatin that resemble, in both their molecular and epigenetic characteristics, the repressed heterochromatic domains of higher eukaryotes (46).

In S. cerevisiae, silent chromatin is found at the telomeres, the ribosomal DNA repeats, and the two cryptic mating-type loci, HMR and HML, located near the right and left telomeres of chromosome III, respectively (14, 51). The silent mating loci bear genes (a1 and a2 at HMR and 1 and 2 at HML) that encode transcriptional regulators. Their activation in a wild-type cell requires their transposition to a centromere-proximal euchromatic site, MAT, located on the same chromosome. This transposition, which occurs only in homothallic haploid cells, is initiated by the HO double-stranded DNA endonuclease that cuts a specific site within the MAT locus. The double-stranded break subsequently is repaired by nonreciprocal homologous recombination between the mating-type genes located in MAT and those of the opposite mating type found at either HMR or HML, which act as the donors of mating information. The directionality of mating-type interconversion is determined by a recombinational enhancer located proximal to HML and that, when active (as is the case in a cells), increases the probability that HML will serve as the donor of mating-type information. When the enhancer is repressed, as is the case in cells, HMR serves as the donor (reviewed in references 64 and 72).

Silencing at the HM loci is controlled by cis-acting elements termed silencers. These contain binding sites for sequence-specific factors (ORC, Rap1, and Abf1) that trigger the formation of a specialized chromatin structure through the concerted recruitment of the Sir2, Sir3, and Sir4 silencing proteins (reviewed in references 18 and 43). The silencing complex horizontally propagates along the chromatin fiber through iterative cycles of H4 K16 deacetylation catalyzed by Sir2, an evolutionarily conserved NAD⁺-dependent lysine deacetylase (26, 63). The deacetylation of H4 K16 and the resultant production of O-acetyl-ADP-ribose are necessary for the formation of a trimeric complex between Sir2/Sir4 and Sir3 (25, 38). The resultant chromatin structure consists of positioned, hypoacetylated, and hypomethylated nucleosomes (7, 49, 52, 70).

Transcription is a multistep process, and each step is highly regulated. Initially, sequence-specific activators bind to UAS elements (enhancers); these, in turn, recruit polymerase II (Pol II) and GTFs to the core promoter, leading to the formation of the preinitiation complex (PIC) (schematically summarized in Fig. 1). Transcription initiation requires the general factor TFIIH, the ATPase subunit of which unwinds the DNA, leading to the formation of an open complex. Also, the kinase subunit of TFIIH phosphorylates Ser5 residues of the carboxy-terminal domain (CTD) of Rpb1, the large Pol II subunit (53). Early elongation often is accompanied by a pause, during which the pre-mRNA is capped at its 5' end. Following this step, which generally takes place when the nascent mRNA chain is 25 to 35 nucleotides long (48), Pol II engages in productive elongation concomitant with the phosphorylation of Ser2 residues with the CTD and the recruitment of elongation factors, including TFIIS, DSIF (Spt4/Spt5), and the Paf1 complex (Paf1C) (53). (As indicated in Fig. 1, Spt4/Spt5 may play an additional role in instigating the Pol II pause following early elongation [53].)

View larger version (9K): [in this window] [in a new window]   FIG. 1. Order of recruitment of initiation, capping, and elongation factors at a typical Pol II gene. Factors and activities depicted are principally those evaluated in this study and are not meant to be comprehensive. This work demonstrates that SIR-dependent silent chromatin is permissive to steps in the transcriptional cascade upstream of the initiation-elongation transition (asterisk) while being restrictive to steps downstream of it.

Investigations of an ectopically silenced heat shock transgene cast additional doubt on the steric hindrance mechanism. These studies showed that despite efficient, SIR-dependent silencing, the hsp82 promoter remained accessible, as measured by nuclease hypersensitivity (35). Consistently with this, UAS and TATA genomic footprints were retained (57), and essentially normal levels of the activator HSF, the initiation factor TBP, and Pol II itself were present (56). An analysis of the naturally silenced HMRa1 promoter supported these conclusions, as both TBP and Pol II were detected in the SIR-repressed state (56). These findings gave rise to the notion that SIR acts at a point downstream of both activator binding and PIC recruitment to silence transcription. More recently, a third model has been proposed: PIC interference. This model posits that SIR is permissive to activator binding, yet transcription is abolished because of a failure to recruit RNA polymerase. In support of this, at several SIR-silenced URA3 transgenes as well as at both the HML and HMR mating loci, Pol II, along with the general initiation factors TFIIB and TFIIE, could not be detected (8).

Here, we use chromatin immunoprecipitation (ChIP) to quantitatively measure the abundance of initiation, capping, and elongation factors at the naturally silenced HMRa1 and HML1/HML2 promoters. We employ two genetic backgrounds and rigorous controls for both nonspecific immunoprecipitation (IP) and spurious PCR amplification. We find, consistent with predictions of the downstream inhibition model, that three components of the PIC, namely, TBP, Pol II, and TFIIH, are present within the silent HMR and HML promoters. Furthermore, Pol II is efficiently phosphorylated at Ser5 within its CTD, indicating that polymerase is not only present but also has initiated transcription. In striking contrast, the occupancy of 5'-capping enzymes and elongation factors is virtually eliminated, and the recruitment of Mediator is restricted. Our results pinpoint the transition between Pol II initiation and elongation as the step targeted by SIR and provide important insight into how silent chromatin can abrogate gene expression.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Yeast strains. Strains used in this study are derived from the S288C and SLY101 genetic backgrounds (Table 1). SLY101 is congenic to W303 (35). MAT strains of the SLY101 background used here bear hsp82 alleles flanked by HMR-E silencers (57). sir2 strains were generated using one-step transplacement of the SIR2 open reading frame (ORF) with a PCR-amplified DNA fragment bearing the KANMX marker and gene-specific flanking sequences (21) and were confirmed by genomic PCR in conjunction with mating-type assays (cells bearing sir2 lose the ability to mate with cells of the opposite identity). To excise the KANMX marker, cells were transformed with the plasmid pSH47 that bears a URA3⁺ marker and a Cre recombinase regulated under a GAL1 promoter (21) and then were induced in 2% galactose for 2.5 h, followed by screening for kanamycin-sensitive colonies that then were cured of the plasmid on medium containing 5-fluoorotic acid. Strains with an HM locus deletion were obtained from the parental sir2 or sir4 strain by replacing the corresponding mating-type gene with the KANMX marker and were further confirmed by genomic PCR as well as mating type assays (cells bearing the deletion of either SIR2 or SIR4 combined with a single HM locus deletion regain the ability to mate with cells of the opposite identity). Tandem affinity purification (TAP)-tagged strains were obtained from Open Biosystems, and each tagged allele was confirmed by genomic PCR. To C-terminally tag the chromosomal KIN28 gene with the 9-Myc epitope, we performed a one-step gene transplacement of strains EAS2001, EAS2011, and LG1101 (Table 1). The transforming DNA was PCR amplified using the plasmid pWZV87 as the template (30). The proper targeting of the KIN28-9Myc-KlTRP1 fragment was confirmed by genomic PCR.

ChIP. ChIP was performed essentially as described previously (56). Fifty-milliliter cultures were cross-linked with 1% formaldehyde and then converted to spheroplasts with lyticase (4 mg/ml; ICN Biomedicals or Sigma) and lysed using 1 volume of 0.5-mm glass beads for 30 min at 4°C on an Eppendorf 5432 mixer. Chromatin was sheared to a mean size of 0.5 to 0.7 kb with a Branson 250 sonifier equipped with a microtip that used three 25-s pulses at constant power and an output setting of 22 W. The clarified supernatant (final volume, 3.0 ml) was used in IPs as described below. The sources of antibodies were the following: Cet1 and Abd1, Steve Buratowski (Harvard Medical School); Sir3, Rohinton Kamakaka (University of California—Santa Cruz); yTBP, Michael Green (University of Massachusetts Medical Center); Ser5-phosphorylated CTD (monoclonal antibody H14; Covance); Myc (monoclonal antibody 9E10; Santa Cruz Biotech); and mouse Pol II CTD (raised in rabbits immunized with glutathione S-transferase-CTD [expression vector obtained from David Bentley, University of Colorado Health Sciences Center]).

IPs typically were achieved by adding 5 µl antiserum to 300 µl of chromatin lysate, followed by mixing the solution on a nutator at 4°C overnight. Pansorbin cells (40 µl; Calbiochem) then were added, and the incubation was continued for an additional 3 h. For the Ser5-P-CTD ChIPs, chromatin was isolated in the presence of a phosphatase inhibitor cocktail (10 mM each of NaF, NaN₃, pNPP, NaPPi, and β-glycerophosphate). Chromatin lysate (150 µl) was preincubated with 2.5 µl of a 50% slurry of anti-mouse immunoglobulin M (IgM)-agarose beads (Sigma) preblocked with 1 mg/ml bovine serum albumin and 0.3 mg/ml of salmon sperm DNA for 3 h at 4°C. H14 antibody (2.5 µl) then was added to the clarified supernatant and permitted to incubate overnight at 4°C. A total of 2.5 µl of fresh preblocked anti-mouse IgM-agarose beads then was added, and the mixture was incubated at 4°C for 3 h. Beads then were washed as previously described (56). All TAP ChIPs were performed as described previously (28) using IgG-agarose beads (Sigma) and no antibody.

Following washing and the reversal of formaldehyde-induced cross-links, DNA was ethanol precipitated and dissolved in 30 µl Tris-EDTA (TE). For input samples, 200 µl of soluble chromatin was ethanol precipitated and dissolved in TE, and cross-links were reversed. The chromatin was reprecipitated, and DNA was purified and dissolved in 50 µl TE. Generally, DNA representing 0.02 to 0.4% of the total chromatin sample (input) or 6 to 12% of the IP was amplified. In addition to template DNA, the 50-µl reaction mixtures contained 2.5 mM MgCl₂; 400 µM each of dCTP, dGTP, dTTP, and dATP; and 1 µCi of [-³²P]dATP (6,000 Ci/mmol). After 2 min of denaturation at 93°C and the addition of 1.25 U Taq DNA polymerase, the temperature was lowered to 60°C for 1 min, followed by 32 s at 72°C. Samples then were subjected to a program of 25 cycles, each consisting of 1 min at 93°C, 1 min at 60°C, and 32 s at 72°C. PCR products were precipitated, electrophoresed on 8% Tris-borate-EDTA polyacrylamide gels, dried, exposed to a Phosphor screen, and quantified on a Storm 860 PhosphorImager (Molecular Dynamics) using ImageQuant 5.2 software.

The following gene-specific primers were employed: HML1/HML2 promoter (251-bp PCR product), GCCCACTTCTAAGCTGATTTCAATCTCTCC and GGCTTCGAAGTAAACATATTGTGAATGTCG; HML1 3' untranslated region (3'-UTR) (240 bp), CCATTTAGTTTTTAGTACGATTGC and CCAAACTTACGATCTTTGGACC; HMRa1 promoter (139 bp), GTTCTTTCGGGGAAACTGTATAAAACTTCC and GTTAAACAGAGTTCTGTTTATGTTTTCCGCC; HMRa1 3'-UTR (170 bp), CCAACATTTTCGTATATGGCG and CTTGTGCAAATTCCAACTAAAGG; HMR-E (156 bp), CGAACGATCCCCGTCCAAGTTATGAGC and CAGGAGTACCTGCGCTTATTCTCAAAC; ARS504 (73 bp), GTCAGACCTGTTCCTTTAAGAGG and CATACCCTCGGGTCAAACAC; PMA1 promoter (322 bp), GGTACCGCTTATGCTCCCCTCC and GATTTTCTTTAACTAGCTGGGG; HSP82 promoter (396 bp), CACCCCCCCTCTCTCAACACAGTAATCC and GGACTCTATTTTCTATCAGGTATGATTTCTTCAACTC; HSP82 ORF (198 bp), GTTCTACTCGGCTTTCTCCAAAAATATC and CAGCCTTTAGAGATTCACCAGTGATGTAG; and HSP82 3'-UTR (275 bp), GAGTTGACGAAGGTGGTGCTCAAGACAAG and CCTATTCAAGGCCATGATGTTCTACCTAATC. These primer pairs were used at the following concentrations: HML1/HML2 promoter (50 pmol), HML1 3'-UTR (50 pmol), HMRa1 promoter (25 pmol), HMRa1 3'-UTR (25 pmol), HMR-E (25 pmol), ARS504 (15 pmol), PMA1 promoter (50 pmol), HSP82 promoter (40 pmol), HSP82 ORF (12.5 pmol), and HSP82 3'-UTR (12.5 pmol).

Quantification of the data was done essentially as described before (74). To calculate the abundance of a given gene sequence (Q_gene) present in an IP, we used the following formula: Q_gene = IP_gene/input_gene. In this calculation, input is used solely for the purpose of normalizing the amplification efficiency of each genomic locus in the multiplex PCR; it is not used to normalize sample-to-sample variation in recovery. Instead, as described below, the coamplified ARS504 locus is used for this purpose. To eliminate any contribution of nonspecific IP, we subtracted the signal arising from a mock IP (Pansorbin cells or agarose beads only) in the TBP, Cet1, Abd1, and H14 ChIPs; the signal from chromatin immunoprecipitated from a nontagged strain for the Myc- and TAP-tagged ChIPs; or the signal obtained from preimmune serum for the CTD ChIPs prior to calculating Q_gene. The gel background value alone was subtracted from the ARS504 value, a nontranscribed locus that served as an internal recovery (nonspecific IP) control to which all Q_gene values were normalized. The Q_gene/Q_ARS504 quotient in the derepressed state was set at 1.0, to which all other values were normalized. For Sir3 ChIPs, the abundance of the gene sequence was quantified relative to that of HMRa1, with the Q_HMRa1/Q_ARS504 quotient for the SIR⁺ sample normalized to 1.0. To derive the P values listed in Table 2, a two-tailed t test was conducted using the TTEST function on Excel 2003, using two-sample equal variance as the parameter.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Pol II and TBP are efficiently recruited to hyperrepressed HM promoters. To investigate the mechanism by which Sir proteins silence transcription, we used ChIP to measure factor abundance at the HM mating-type loci, the relevant features of which are schematically illustrated in Fig. 2A. We analyzed SIR⁺ parental strains and isogenic sir2 or sir4 deletion strains in parallel, allowing a direct comparison between heterochromatic and euchromatic gene states. In SIR⁺ strains, Sir3 is recruited to both HM loci, yet it appears to be more abundant at HML than at HMR (Fig. 2B). This might reflect the presence of two functionally autonomous silencers at this locus (HML-E and HML-I) as opposed to HMR, which has only one, HMR-E (6, 50, 58). The efficiency of Sir2/3/4 recruitment has been shown to correlate with both the dosage and arrangement of silencers (56) (L. Gao and D. S. Gross, unpublished data). As expected, in either a sir2 or sir4 mutant, Sir3 recruitment is abolished (Fig. 2B). Concomitantly, the HM loci are transcriptionally derepressed (Fig. 2C, lanes 2 and 5). The exception to this is the 1 gene, which fails to express in either sir2 strain, as it is the target of Tup1 repression in sir mutants (22). The role played by Tup1 is further considered below.

View larger version (33K): [in this window] [in a new window]   FIG. 2. SIR extinguishes transcription at the HM loci yet is fully permissive to Pol II recruitment. (A) Physical maps of HML and HMRa. These loci are located near the left and right ends of chromosome III, respectively. Locations of mating-type genes, flanking silencer elements (termed E and I), and PCR amplicons (black rectangles) are shown. Coordinates are provided relative to the ATG codons (+1) of the HML1 and HMRa1 ORFs. Note that the HMRa2 promoter cannot be specifically amplified due to extensive sequence identity with both the promoter and ORF sequences of the HML2 gene. To validate the specificity of the hybridizations and PCRs, chromosomal deletions of HML (–1781 to +950) and HMRa (–1038 to +952) were engineered into selected strains (Table 1 and Fig. 2C and 5A). (B) Deletion of either SIR2 or SIR4 abolishes Sir3 association with the silent mating-type promoters. A summary of Sir3 ChIP assays in SIR+, sir2, and sir4 strains (SLY101 background) is shown. Sir3 abundance at each promoter is normalized relative to its abundance at HMRa1 in a SIR+ strain, which was arbitrarily set at 1. Depicted are the means ± standard deviations of two independent experiments. (C) Northern analysis of isogenic MAT and MATa strains (S288C background). Transcript abundance was quantified using a PhosphorImager and was normalized to that for ACT1. For each probe and strain combination, the signal of the derepressed HM gene was arbitrarily assigned a value of 100; the others are expressed relative to it. In the case of HML1, which is not derepressed in a sir2 mutant (see the text), the signal above the background was negligible in all three MATa strains. Values represent the means of two independent experiments. A plus sign signifies the presence of a gene or locus; a minus sign signifies its deletion. (D) In vivo cross-linking analysis of the large Pol II subunit (Rpb1) at the 1/2 and a1 promoters and a nontranscribed (ORF-less) locus, ARS504, in both S288C and SLY101 genetic backgrounds. On the left are representative gels containing multiplex PCRs of input and immunoprecipitated DNAs isolated from formaldehyde-cross-linked, sonicated chromatin (sheared to a mean size of 0.5 to 0.7 kb) isolated from MATa strains. Chromatin was immunoprecipitated with either preimmune serum (PI) or anti-CTD antiserum (IP), cross-links were reversed, and purified DNA was subjected to multiplex PCR in the presence of [-32P]dATP using primers specific for the regions indicated, followed by electrophoresis and detection by a PhosphorImager. Input samples, derived from the SIR+ parent strain, represent threefold serial dilutions (0.2, 0.067, and 0.022%) of soluble chromatin used in each IP. Black arrows indicate signals arising from silent HM loci; white arrows indicate signals arising from their derepressed counterparts (sir2 background). As these MATa strains bear two copies of the a1 promoter (one at MAT and the other at HMR), as indicated, unambiguous measurement of factor occupancy is possible only for HML1/HML2. The lower image is a two-part composite derived from the same gel. On the right are summaries of Rpb1 occupancy at the indicated promoters in SIR+, sir2, and sir4 cells based on ChIP assays such as those illustrated. In each pairwise comparison, Rpb1 occupancy of the sir mutant is set at 1.0, with its occupancy in the SIR+ strain normalized to that. Depicted are summaries of four (S288C) or two (SLY101) biological replicates (means ± standard errors of the means or ± standard deviations, respectively).

HML1/HML2

HML1

HML2

1/2

HML1/HML2

View larger version (39K): [in this window] [in a new window]   FIG. 5. SIR restricts the occupancy of capping enzymes at both HMR and HML. (A) On the left is an in vivo cross-linking analysis of Cet1 at the a1 and 1/2 promoters (prom) in isogenic S288C strains. "Input" represents 0.067% of soluble chromatin, derived from the S288C parental strain, used in each IP. Mock IP, sheared chromatin (derived from the S288C parental strain) precipitated with Pansorbin cells only. Note that lane 5 of each gel represents an analysis of strains deleted for both SIR2 and the indicated HM locus (see the legend to Fig. 2A). A summary of four independent experiments (means ± standard errors of the means) for each strain is provided on the right. (B) In vivo cross-linking analysis of Abd1 at the a1 and 1/2 promoters, conducted as described for panel A.

1/2

View larger version (30K): [in this window] [in a new window]   FIG. 3. Silent chromatin is permissive to the recruitment of both TBP and TFIIH. (A) TBP ChIP analysis of the a1 and 1/2 promoters in isogenic S288C and SLY101 strains ( or a mating type, as indicated). Assays were conducted as described in the legend to Fig. 2D. Shown are summaries of either four (S288C strains) or two (SLY101 strains) independent experiments (means ± standard errors of the means [SEM] or ± standard deviations, respectively). (B) In vivo cross-linking analysis of Kin28 (Myc tagged). On the left are representative ChIP gels, and on the right are summaries of three independent experiments (means ± SEM) of MAT and MATa strains (SLY101 background). KIN28-Myc is present at its native chromosomal locus and is the only copy of KIN28 in these strains; thus, the epitope-tagged version is functional. Black and white arrows indicate silent and derepressed states, respectively. Input samples are as described in the legend to Fig. 2D. (C) In vivo cross-linking analysis of the core TFIIH subunit, Tfb1 (TAP tagged). TFB1-TAP is present at its native chromosomal locus (S288C background). A representative gel is illustrated on the left (black and white arrows indicate silent and derepressed states, respectively), and the means ± SEM of three independent experiments are provided on the right.

HML1/HML2

HML1/HML2

1/2

Silent chromatin is permissive to Ser5 phosphorylation of the Pol II CTD, yet Pol II arrests at or near the promoter. A critical function of the TFIIH kinase is to phosphorylate the Pol II large subunit at Ser5 within the CTD heptad repeat (23). The Ser5-phosphorylated isoform of Pol II is characteristic of the polymerase that has initiated transcription (53). Therefore, a potential way that SIR could act is by inhibiting the phosphorylation of Ser5 residues within the Pol II CTD, thereby aborting transcriptional initiation. However, the Ser5-phosphorylated isoform of Pol II is present at the silent HM promoters, and its abundance is comparable to that seen in the sir2 euchromatic state (Fig. 4A). This result provides additional evidence for the presence of Pol II at the silent a1 and 1/2 genes and further suggests that Pol II has initiated transcription.

View larger version (34K): [in this window] [in a new window]   FIG. 4. Silent chromatin is permissive to the Ser5 phosphorylation of the CTD, yet Pol II fails to elongate through the gene coding region. (A) Pol IIoSer5 ChIP analysis of the a1, 1/2, and PMA1 promoters (prom) of the indicated S288C strains detected using the monoclonal antibody H14. M, mock IP (sheared chromatin precipitated with preblocked anti-IgM-agarose beads only). Black and white arrows indicate signals arising from silenced and derepressed states, respectively. In this experiment, the PMA1 promoter serves as a positive control for Ser5-phosphorylated Rpb1 occupancy; ARS504 serves as a negative control. On the right is a summary of four independent experiments (means ± standard errors of the means [SEM]). (B) In vivo cross-linking analysis of Pol II within the 3' flank of the HMRa2 gene in strain S288C (left). Also evaluated are the 1/2 promoter and ARS504, which serve as positive and negative ChIP controls, respectively. PI, immunoprecipitation with preimmune serum. On the right is a comparison of Pol II occupancy at the HMRa1 promoter region and the HMRa2 3' flank, obtained from independent PCRs of the same chromatin DNA templates (n = 3; results are given as means ± SEM). The occupancy for each locus is normalized to that seen in the sir2 strain, which is set at 1.0. (C) Pol II stalls at the SIR-silenced hsp82 promoter. The upper graphic is a schematic of the HMR-E silencer element, illustrating binding sites for ORC, Rap1, and Abf1, and the location of integrated silencers flanking the hsp82-2001 gene (silencers are symbolized by arrows) (57). Also illustrated are PCR amplicons (cross-hatched rectangles) centered at coordinates –170, +1400, and +2100 relative to the ATG (+1) of hsp82-2001. The lower graphic is a summary of Pol II occupancy at hsp82-2001 in SIR+ and sir4 strains (means ± SEM; n = 3). Note that although there is virtually no difference in Pol II promoter occupancy in SIR+ versus sir4 cells, there are significant differences in Pol II occupancy within the ORF and 3'-UTR (P < 0.05; two-tailed t test).

HML1

View larger version (25K): [in this window] [in a new window]   FIG. 8. The SIR-regulated YCL065W and YCR097W-A genes are fully permissive to Pol II and TBP recruitment and to Ser5 CTD phosphorylation, but they are restrictive to the recruitment of capping enzyme. (A) Physical maps of HML1/YCL065W and HMRa1/YCR097W-A showing the location and orientation of ORFs and the location of the HML-I and HMR-I silencers. Also shown are PCR amplicons used for this analysis (black rectangles). Coordinates are numbered relative to the ATG codons of the 1 and a1 ORFs. (B) Summary of Pol II CTD ChIP assays (S288C background) for YCL065W and YCR097W-A. ChIP analysis and the quantification of factor occupancy were performed as described in the legend to Fig. 2D. Bars represent means ± standard errors of the means (SEM) for four independent biological replicates. (C to E) TBP, Pol IIoSer5, and Cet1 abundance at YCL065W and YCR097W-A. ChIP analysis and quantification were performed as described above (depicted are means ± SEM; n = 4).

1/2

We next addressed whether the occupancy of the 5' mRNA cap methylase, Abd1, also is influenced by SIR. Abd1 binds the CTD independently of Cet1/Ceg1, and its interaction requires both Ser5 phosphorylation and the TFIIH kinase (54). Given this, it was possible that despite the absence of Cet1 at the silent a1 and 1/2 genes, Abd1 recruitment occurred unimpaired. However, as shown in Fig. 5B, the recruitment of Abd1, like that of Cet1, is highly restricted (10-fold). This restriction has important mechanistic implications, given that Abd1 has been functionally linked to subsequent elongation in both S. cerevisiae and the fission yeast Saccharomyces pombe (20, 55). Taken together, the data argue that silent chromatin is highly restrictive to the recruitment of capping machinery.

The absence of capping enzymes raises the possibility that SIR additionally restricts other factors whose association with the TEC takes place either concomitantly with or subsequent to that of capping enzymes. We focused on three elongation factors: Spt5, TFIIS, and the Paf1 complex (Paf1C). The essential elongation factor Spt5, as part of the Spt4/Spt5 complex, has been implicated in the control of early transcription (Fig. 1) and physically and functionally interacts with both Ceg1/Cet1 and Abd1 (37, 41). As shown in Fig. 6A, SIR reduces the recruitment of Spt5 to the silent 1/2 promoter to an undetectable level. The sir2 mutation alleviates this block, and Spt5 is efficiently recruited concomitantly with transcriptional activation.

View larger version (18K): [in this window] [in a new window]   FIG. 6. SIR strongly reduces the occupancy of elongation factors Spt5, TFIIS, and Paf1C and partially restricts the recruitment of Mediator. (A to D) In vivo cross-linking analysis of the indicated TAP-tagged factors at the HML/HML promoter in SIR+ and sir2 S288Ca derivatives, conducted as described for Fig. 3C (in all cases, means ± standard errors of the means are shown [n = 3]).

HML1/HML2

To investigate the effect of SIR silencing on Paf1C recruitment, we examined the occupancy of its Rtf1 subunit. Paf1C associates with Ser5-phosphorylated Pol II and genetically and physically interacts with the Spt4/Spt5 complex (61), as well as with Spt6, FACT, and Chd1. Moreover, Paf1C plays a critical role in regulating transcription-associated histone modifications, including H2B ubiquitylation and H3 K4 methylation, and does this through mediating the interaction between Pol II and the enzymes responsible for these modifications. As shown in Fig. 6C, SIR strongly impedes the binding of Rtf1 and, by extension, of Paf1C to the silent HML promoters, thereby providing a basis for the absence of activating histone modifications within silent chromatin (reviewed in references 15 and 46) as well as further evidence accounting for the failure of Pol II to escape from the gene's 5' end.

Efficiency of silencing inversely correlates with the presence of capping enzyme. To investigate the functional link between capping enzyme recruitment and transcriptional silencing in more detail, we employed silencer-flanked hsp82 transgenes. As discussed above, these consist of the native HSP82 heat shock gene flanked by chromosomally integrated HMR-E silencers. The efficiency of transcriptional silencing at these alleles correlates with Sir2 recruitment: hsp82-2001, flanked by four silencers, exhibits 95% of the level of Sir2 observed at HMR and is repressed >30-fold; hsp82-1001, flanked by two silencers and containing 80% of the level of Sir2, is repressed 5- to 10-fold; and hsp82-201, bearing tandem upstream silencers and containing 30% of Sir2, is silenced 2- to 4-fold (56, 57). If the reduction in recruitment of capping enzymes is linked to silencing, then the degree to which these factors are prevented from accessing the hsp82 transgenes should correlate with the degree to which they are silenced. This is in fact what is seen: despite Pol II being present at normal levels at the 5' ends of all three silenced hsp82 alleles, Cet1 recruitment is reduced by almost 10-fold at hsp82-2001, 5-fold at hsp82-1001, and 3-fold at hsp82-201 (Fig. 7). Therefore, restriction in Cet1 occupancy, unlike that of Pol II, directly correlates with SIR-mediated silencing.

View larger version (18K): [in this window] [in a new window]   FIG. 7. Efficiency of SIR-dependent silencing strongly correlates with a restriction in recruitment of the Cet1 capping enzyme. Illustrated is a summary of Cet1 and Pol II (Rpb1) occupancy of SIR-silenced hsp82 transgenes (top and bottom histograms). Factor occupancy at the euchromatic (derepressed) hsp82-1001 allele also is depicted (sir4 background). These transgenes differ in the dosage and arrangement of integrated silencers that flank the hsp82 promoter and coding region (symbolized by arrows; see the legend to Fig. 4C). Cet1 abundance is quantified for the promoter, ORF, and 3'-UTR (the location of amplicons and shading key are indicated at the top); Pol II abundance is quantified for the promoter only. For both analyses, bars represent means ± standard errors of the means of three biological replicates. A representative Northern analysis of each strain also is displayed, with hsp82 transcript levels, normalized to ACT1, indicated (values represent the means of two independent experiments).

Genes abutting HML1 and HMRa 1 are silenced by SIR but permissive to Pol II recruitment.

HML1

HML1/HML2

HML1/HML2

SIR partially restricts recruitment of Mediator. Finally, we examined the recruitment of Mediator, a transcriptional coregulator thought to bridge sequence-specific activators with RNA Pol II. Consistent with a general role in transcription, Mediator has been detected at the 5' ends of many, if not most, genes (3). In light of this, it has been proposed that Mediator should be considered a general transcription factor that is equivalent to components of the PIC (65). An alternative view is that Mediator primarily acts as a gene-specific coactivator (13). Mediator has been detected in holoenzyme preparations of Pol II (31) but is not corecruited with polymerase at certain genes (5, 10). As shown in Fig. 6D, the occupancy at HML1/HML2 of both head (Srb4) and tail (Gal11) Mediator subunits is reduced 50 to 75% by SIR. This observation argues that Mediator is recruited to HML independently of Pol II and that its access, unlike that of Pol II, is restricted.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
SIR is permissive to GTF recruitment and PIC assembly. Here, we have investigated the mechanism by which SIR regulates transcription in Saccharomyces cerevisiae. We demonstrate that at SIR-repressed genes, steps in the transcription cascade that occur upstream of PIC recruitment are fully permitted, while those occurring downstream are essentially abolished. This conclusion arises from a quantitative assessment of factor occupancy at two naturally silenced targets of SIR, HMRa1 and HML1/HML2, and in two distinct genetic backgrounds. At these genes transcription is extinguished, yet three GTFs—TBP, Pol II, and TFIIH—are present and abundant within their promoters. The presence of TFIIH, the last factor typically recruited to the PIC, implies that the initiation complex is fully assembled. Additionally, the presence of Ser5-phosphorylated Pol II suggests that Kin28 is functional and that Pol II has initiated transcription. Nonetheless, the recruitment of downstream factors involved in mRNA capping and transcript elongation is virtually abolished (considered more fully below). Importantly, PIC assembly in silent chromatin is not a peculiarity of the mating-type promoters. We observed that two other genes, YCL065W and YCR097W-A, are similarly regulated: Pol II and TBP are present at normal levels, and Pol II is Ser5 phosphorylated, yet there is no detectable transcription in a SIR⁺ background. Both, however, are expressed in a sir2 mutant.

Our detection of Pol II at silent HMRa1 and HML1/HML2 is at odds with a recent, quantitative ChIP analysis that gave rise to the PIC interference model (8). That study employed strains of the S288C background, as done here, and investigated the presence of Pol II at the silent HM promoters using both a CTD-specific antibody (8WG16) and a phospho-Ser5-CTD-specific antibody (H14, as employed here [Fig. 4A]). However, the authors of that study failed to detect the presence of Pol II using either antibody; likewise, they were unable to detect either TFIIB or TFIIE (8). While the reason for this is unclear, three lines of evidence argue against the PIC interference model. First, as discussed above, we detected TBP and TFIIH, in addition to Pol II, at the hyperrepressed promoters. Normal levels of Pol II are consistent with the unimpaired function of Kin28, given that Kin28 thermal inactivation strongly reduces Pol II promoter occupancy (42, 54). Second, the ChIP methodology we employed is sufficiently sensitive to detect differences in factor occupancy at these genes, as demonstrated by the fact that we observed large differences in the occupancy of downstream factors at euchromatic versus heterochromatic promoters. Third, a recent high-resolution genome-wide analysis of Pol II density supports the notion that Pol II is present at SIR-silenced promoters (62). In this ChIP-chip analysis, the Rpb3 subunit of Pol II was detected at genome-average levels within the HM loci as well as within the promoters of telomere-linked genes (62). In telling contrast, Pol II density was significantly reduced within the coding regions of telomeric genes, paralleling our observations at both native (HMRa2) and transgenic (hsp82-2001) targets, and as expected if SIR permits Pol II recruitment but prevents its productive elongation.

PIC recruitment, assembly, and normal function within the context of silent chromatin are all the more striking given that H3 K4 trimethylation, a mark that stabilizes TBP binding to nucleosomes in mammalian cells (69) and SAGA binding to nucleosomes in yeast (47), is greatly reduced at HMR and HML (44, 52), as are two other covalent marks of active chromatin, H3 K36 trimethylation and H2B K123 ubiquitylation (12, 67). Thus, silent chromatin is impoverished in all three marks that correlate with transcriptional activation in S. cerevisiae, methylation, ubiquitylation, and, as discussed above, acetylation, yet it is permissive to the binding, at core promoters, of critical components of the transcriptional machinery.

SIR imposes a 5' arrest on Pol II by restricting recruitment of capping and elongation factors. In contrast to the unhindered access of Pol II and GTFs to silent promoters, the occupancy of the capping enzymes Cet1/Ceg1 and Abd1 and elongation factors Spt5, TFIIS, and Paf1C is highly restricted. Of particular significance is the tight inverse correlation between silencing efficiency and Cet1 occupancy (Fig. 7). This suggests a mechanistic link between a block in capping enzyme recruitment and silencing. Abd1 harbors a transcription elongation activity independent of cap methylation, and the inactivation of this function reduces Pol II occupancy at the 5' end and/or Pol II processivity (55). Therefore, SIR, by impeding capping enzyme recruitment, may contribute to Pol II stalling. Such stalling takes place at or near the gene's 5' end, given that Pol II abundance is considerably reduced (relative to that of the sir2-derepressed state) at points downstream (Fig. 4B, C). We have tested for the presence of short 5' transcripts associated with the silenced hsp82-2001 gene. None could be found with primer extension assays (56). Therefore, the silencing of stably repressed loci such as HML, HMR, and hsp82-2001 is unlikely to involve posttranscriptional processing events, as recently shown for Sir2-regulated telomeric reporter genes and the nontranscribed spacer regions within the ribosomal DNA array (68).

Regarding the actual step targeted, our data are compatible with at least two possibilities. First, SIR may prevent the transition between initiation and promoter escape, a rate-limiting step for Pol II in vitro. Alternatively, SIR may permit early elongation yet increase the inherent tendency of the early elongation complex to pause. While arrested elongation complexes can be rescued by TFIIS (1), SIR prevents TFIIS recruitment. An interesting aspect of SIR-induced promoter-proximal pausing is that it must occur without the participation of the Spt4/Spt5 complex. We speculate that the Sir2/3/4 complex plays that role through its deacetylation and stable positioning of nucleosomes.

What underlies the differential accessibility of initiation and capping/elongation factors to silent chromatin? An important implication of our findings is that SIR-mediated silent chromatin is differentially accessible to initiation and capping/elongation factors. Although our work does not address how this might be achieved, there are several possibilities. One way is via molecular sieving. This idea is appealing, given the longstanding view that chromatin can repress gene expression by excluding factors from accessing their target DNA sequences (see Introduction). However, the proteins with the most severely restricted access, Cet1/Ceg1, Abd1, TFIIS, and Spt4/5, tend to be relatively small, with molecular masses of 115, 50, 35, and 127 kDa, respectively. In contrast, the accessible factors Pol II and TFIIH have respective masses of 550 and 438 kDa. As TBP occupancy may signify the presence of TFIID, with a mass of 1.2 MDa, it is unlikely that SIR-silenced chromatin acts by molecular sieving.

Alternatively, SIR may prevent polymerase elongation as a consequence of the structural features of silent chromatin itself. Hypoacetylated nucleosomes are very stable, with adjacent nucleosomes possessing the potential to interact with each other through ionic bonding (39) and arrays of H4 K16 hypoacetylated nucleosomes capable of forming 30-nm-like fibers (59). Thus, Pol II, although able to gain access to silent promoters, may be unable to elongate through hypoacetylated nucleosomes complexed with Sir2/3/4. The inability of polymerase to elongate through stabilized silent nucleosomes may prevent the stable association of capping and elongation factors with the TEC. Additionally, it is possible that Sir2 inhibits the recruitment of one or more capping/elongation factors by virtue of its intrinsic lysine deacetylase activity. This could occur by direct deacetylation of an elongation factor or via the deacetylation of H4 AcK16, which may serve as a binding site for one or more downstream factors. Although our data indicate that at least five factors are excluded from silent chromatin, it is conceivable that a subset of them, or an as-yet-unidentified factor, actually is targeted, abrogating subsequent steps in the transcriptional cascade.

Importantly, our data appear to rule out a third mechanism, elongational arrest via the proteolysis of stalled Pol II complexes. Inappropriately stalled Pol II is targeted for proteasome-mediated degradation by Rsp5-dependent ubiquitylation (4). However, Ser5 phosphorylation, a signature of SIR repression, strongly inhibits Pol II ubiquitylation (60). A schematic summarizing our findings at SIR-repressed HML1/HML2 is illustrated in Fig. 9A.

View larger version (34K): [in this window] [in a new window]   FIG. 9. Schematic summary of factor occupancy at SIR-repressed, Tup1/Ssn6-repressed, and transcriptionally derepressed HML promoters. (A) SIR permits the access of TBP, Pol II, and TFIIH to the silent HML1/HML2 promoters (this study) and, by analogy with other SIR-regulated loci, a gene-specific activator(s) (8, 56, 57). Ser5 phosphorylation of the Pol II CTD also is permitted, yet Pol II is stalled at the genes' 5' ends. In contrast to GTFs, access of the Cet1/Ceg1 and Abd1 capping enzymes and the Spt5, TFIIS, and Paf1C elongation factors is strongly inhibited. The access of Mediator also is restricted, although not as severely. (B) Tup1/Ssn6, recruited to the HML1 promoter by the a1/2 repressor in sir2 mutants, aborts the assembly of the PIC, as suggested by occupancy data presented here (summarized in Table 2) and by analogy with other Tup1-regulated promoters (34, 73). Mediator participates in Tup1 repression (17); thus, although it was not specifically tested here, it could be present. In the same cell, the HML2 promoter is transcriptionally derepressed; consequently, GTFs, Mediator, and downstream factors are abundant.

Tup1/Ssn6 represses the 1 promoter by interfering with PIC recruitment. Our results indicate that TBP, Pol II, Kin28, and Pol IIo^Ser5 occupancy at the HML1/HML2 promoters paradoxically is more abundant in the context of SIR silencing than in the euchromatic (sir2 or sir4), derepressed state. This contrasts with the essentially equivalent occupancy of the same factors at the HMRa1 promoter and provides a stark contrast to the null occupancy of capping/elongation factors at either HML or HMR (summarized in Table 2). A probable explanation is that the 1 promoter is subject to a second form of negative regulation, conferred by the a1/2 haploid gene-specific repressor (22), present in sir haploids and wild-type diploids. This repressor negatively regulates the transcription of linked promoters by the recruitment of the Tup1/Ssn6 corepressor, which in turn recruits type I and type II histone deacetylases (reviewed in references 11 and 40). Previous studies have demonstrated that Tup1 prevents the recruitment of TBP and Pol II to the promoters it regulates (34, 73). Therefore, our data, in combination with these previous observations, suggest that at the HML1 promoter, Tup1 and SIR use distinct mechanisms to repress transcription. Tup1 blocks the recruitment of TBP, Pol II, and TFIIH, thereby aborting PIC assembly (illustrated in Fig. 9B), while the Sir2/3/4 complex permits the recruitment of these factors but abrogates transcription by restricting the access of capping and elongation factors, resulting in the irreversible stalling of Pol II at the gene's 5' end.

	ACKNOWLEDGMENTS

 
We thank Kelly Tatchell for yeast strains and helpful discussions; Sebastian Chavez for sharing unpublished data; Steve Buratowski, Michael Green, and Rohinton Kamakaka for generous gifts of antibodies; David Bentley for the glutathione S-transferase-CTD construct; and members of our laboratory for their critical comments on an earlier version of the manuscript.

This work was supported by grants awarded to D.S.G. from the National Science Foundation (MCB-0450419; MCB-0747227).

	FOOTNOTES

 
* Corresponding author. Mailing address: Department of Biochemistry and Molecular Biology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932. Phone: (318) 675-5027. Fax: (318) 675-5180. E-mail: dgross{at}lsuhsc.edu

Published ahead of print on 7 April 2008.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
1. Adelman, K., M. T. Marr, J. Werner, A. Saunders, Z. Ni, E. D. Andrulis, and J. T. Lis. 2005. Efficient release from promoter-proximal stall sites requires transcript cleavage factor TFIIS. Mol. Cell 17:103-112.[CrossRef][Medline]

2. Agalioti, T., S. Lomvardas, B. Parekh, J. Yie, T. Maniatis, and D. Thanos. 2000. Ordered recruitment of chromatin modifying and general transcription factors to the IFN-β promoter. Cell 103:667-678.[CrossRef][Medline]

3. Andrau, J. C., L. van de Pasch, P. Lijnzaad, T. Bijma, M. G. Koerkamp, J. van de Peppel, M. Werner, and F. C. Holstege. 2006. Genome-wide location of the coactivator Mediator: binding without activation and transient Cdk8 interaction on DNA. Mol. Cell 22:179-192.[CrossRef][Medline]

4. Beaudenon, S. L., M. R. Huacani, G. Wang, D. P. McDonnell, and J. M. Huibregtse. 1999. Rsp5 ubiquitin-protein ligase mediates DNA damage-induced degradation of the large subunit of RNA polymerase II in Saccharomyces cerevisiae. Mol. Cell. Biol. 19:6972-6979.[Abstract/Free Full Text]

5. Bhoite, L. T., Y. Yu, and D. J. Stillman. 2001. The Swi5 activator recruits the Mediator complex to the HO promoter without RNA polymerase II. Genes Dev. 15:2457-2469.[Abstract/Free Full Text]

6. Brand, A. H., L. Breeden, J. Abraham, R. Sternglanz, and K. Nasmyth. 1985. Characterization of a "silencer" in yeast: a DNA sequence with properties opposite to those of a transcriptional enhancer. Cell 41:41-48.[CrossRef][Medline]

7. Braunstein, M., A. B. Rose, S. G. Holmes, C. D. Allis, and J. R. Broach. 1993. Transcriptional silencing in yeast is associated with reduced nucleosome acetylation. Genes Dev. 7:592-604.[Abstract/Free Full Text]

8. Chen, L., and J. Widom. 2005. Mechanism of transcriptional silencing in yeast. Cell 120:37-48.[CrossRef][Medline]

9. Cheng, T.-H., and M. R. Gartenberg. 2000. Yeast heterochromatin is a dynamic structure that requires silencers continuously. Genes Dev. 14:452-463.[Abstract/Free Full Text]

10. Cosma, M. P., S. Panizza, and K. Nasmyth. 2001. Cdk1 triggers association of RNA polymerase to cell cycle promoters only after recruitment of the mediator by SBF. Mol. Cell 7:1213-1220.[CrossRef][Medline]

11. Courey, A. J., and S. Jia. 2001. Transcriptional repression: the long and the short of it. Genes Dev. 15:2786-2796.[Free Full Text]

12. Emre, N. C., K. Ingvarsdottir, A. Wyce, A. Wood, N. J. Krogan, K. W. Henry, K. Li, R. Marmorstein, J. F. Greenblatt, A. Shilatifard, and S. L. Berger. 2005. Maintenance of low histone ubiquitylation by Ubp10 correlates with telomere-proximal Sir2 association and gene silencing. Mol. Cell 17:585-594.[CrossRef][Medline]

13. Fan, X., D. M. Chou, and K. Struhl. 2006. Activator-specific recruitment of Mediator in vivo. Nat. Struct. Mol. Biol. 13:117-120.[CrossRef][Medline]

14. Fox, C. A., and K. H. McConnell. 2005. Toward biochemical understanding of a transcriptionally silenced chromosomal domain in Saccharomyces cerevisiae. J. Biol. Chem. 280:8629-8632.[Free Full Text]

15. Gao, L., and D. S. Gross. 2006. Using genomics and proteomics to investigate mechanisms of transcriptional silencing in Saccharomyces cerevisiae. Brief. Funct. Genomics Proteomics 5:280-288.[Abstract/Free Full Text]

16. Grewal, S. I., and S. Jia. 2007. Heterochromatin revisited. Nat. Rev. Genet. 8:35-46.[CrossRef][Medline]

17. Gromöller, A., and N. Lehming. 2000. Srb7p is a physical and physiological target of Tup1p. EMBO J. 19:6845-6852.[CrossRef][Medline]

18. Gross, D. S. 2001. Sir proteins as transcriptional repressors. Trends Biochem. Sci. 26:685-686.[CrossRef][Medline]

19. Guenther, M. G., S. S. Levine, L. A. Boyer, R. Jaenisch, and R. A. Young. 2007. A chromatin landmark and transcription initiation at most promoters in human cells. Cell 130:77-88.[CrossRef][Medline]

20. Guiguen, A., J. Soutourina, M. Dewez, L. Tafforeau, M. Dieu, M. Raes, J. Vandenhaute, M. Werner, and D. Hermand. 2007. Recruitment of P-TEFb (Cdk9-Pch1) to chromatin by the cap-methyl transferase Pcm1 in fission yeast. EMBO J. 26:1552-1559.[CrossRef][Medline]

21. Güldener, U., S. Heck, T. Fiedler, J. Beinhauer, and J. H. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519-2524.[Abstract/Free Full Text]

22. Harashima, S., A. M. Miller, K. Tanaka, K. Kusumoto, Y. Mukai, K. Nasmyth, and Y. Oshima. 1989. Mating-type control in Saccharomyces cerevisiae: isolation and characterization of mutants defective in repression by a1-2. Mol. Cell. Biol. 9:4523-4530.[Abstract/Free Full Text]

23. Hengartner, C. J., V. E. Myer, S.-M. Liao, C. J. Wilson, S. S. Koh, and R. A. Young. 1998. Temporal regulation of RNA polymerase II by Srb10 and Kin28 cyclin-dependent kinases. Mol. Cell 2:43-53.[CrossRef][Medline]

24. Holmes, S. G., and J. R. Broach. 1996. Silencers are required for inheritance of the repressed state in yeast. Genes Dev. 10:1021-1032.