| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, June 2008, p. 4116-4128, Vol. 28, No. 12
0270-7306/08/$08.00+0 doi:10.1128/MCB.02210-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Laboratory of Molecular Gerontology, National Institute on Aging, NIH, 5600 Nathan Shock Drive, Baltimore, Maryland 21224,1 National Institute of Advanced Industrial Science and Technology, Tokyo 135-0064, Japan2
Received 13 December 2007/ Returned for modification 11 February 2008/ Accepted 7 April 2008
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
, and this interaction is required for the correction of the ICL response in FA-J cells (32). The activation of FANCJ helicase activity is required for timely progression through S phase of the cell cycle (20); however, the precise functions of the FANCJ helicase in S-phase progression remain to be understood. Although a role for FANCJ in DNA replication has been proposed previously, definitive evidence for a role of the FANCJ helicase in preventing genomic instability is lacking. One source of genomic instability is alternate DNA structures that may impede the replication fork. Guanine-rich nucleic acids have the potential to form G-quadruplex (G4) DNA stabilized by Hoogsteen hydrogen bonding between guanine residues, and G4 DNA influences gene expression and genomic stability (for a review, see reference 26). In the human genome, the number of distinct sites with the potential to form G4 DNA is estimated to be more than 300,000 (9). Key cellular processes are identified with repetitive G-rich chromosomal regions, where the regulated formation of G4 DNA may contribute to biological functions such as immunoglobulin gene rearrangement (21), promoter activation (38), and telomere maintenance (29, 49).
Interestingly, evidence suggests that a helicase-like protein with sequence similarity to the FANCJ helicase domain in nematodes has a role in guanine-rich-DNA metabolism. Nematodes with mutations in dog-1 (deletions of guanine-rich DNA) show germ line as well as somatic deletions in genes containing guanine-rich DNA (4). It was proposed previously that the putative DOG-1 helicase has a role in the resolution of alternate G4 DNA structures that impede replication. Recent genetic evidence indicates that DOG-1 is the Caenorhabditis elegans FANCJ homologue, based on the sensitivity of dog-1 mutants to ICL agents and the epistatic relationship of dog-1 to fcd-1 (encoding C. elegans FANCD2 [CeFANCD2]) (47).
To better understand the roles of FANCJ in DNA metabolism, we have investigated the potential ability of FANCJ to unwind G4 DNA substrates. Purified FANCJ helicase was found to efficiently unwind a variety of G4 DNA structures in a reaction that was dependent on intrinsic FANCJ ATP hydrolysis and regulated by DNA repair factors through distinct mechanisms. The naturally occurring molecule telomestatin (TMS), which selectively binds G4 structures and interferes with normal telomere metabolism, potently inhibited FANCJ G4 unwinding activity. TMS inhibited proliferation and induced DNA damage, accompanied by apoptosis, to a significantly greater extent among FANCJ-depleted cells than among control cells, providing further evidence that FANCJ is likely to have an important role in unwinding G4 DNA structures that potentially impede replication and cause chromosomal instability.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA substrates. Polyacrylamide gel electrophoresis-purified oligonucleotides used for the preparation of DNA substrates were purchased from Loftstrand Labs (Gaithersburg, MD) and are listed in Table 1. The forked-duplex DNA substrate was prepared from the DC26 and TSTEM25 oligonucleotides as described previously (5). G4 DNA and G2' DNA substrates were prepared from the oligonucleotides indicated in Table 1 as described previously (28, 43, 46).
|
G4 DNA binding ligands. N-Methyl mesoporphyrin IX (NMM) and meso-tetra(N-methyl-4-pyridyl) porphine tetratosylate (T4) were from Frontier Scientific, Inc. (Logan, UT). TMS was purified as described previously (37). Compounds were dissolved in dimethyl sulfoxide.
Cell lines. HeLa, U2OS, and FA-A (PD220) fibroblasts were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, and 1% L-glutamine at 37°C in 5% CO2. FA-D2 (PD20) fibroblasts were grown in RPMI 1640 (Invitrogen, Carlsbad, CA) supplemented with 15% fetal bovine serum, 1% penicillin-streptomycin, and 1% L-glutamine at 37°C in 5% CO2.
FANCJ silencing in HeLa and U2OS cells. The sequence of FANCJ small interfering RNA (siRNA) was 5' GUACAGUACCCCACCUUAU 3' (25), and that of the control siRNA was 5' AGUUACUCAGCCAAGAACGA 3' (20). siRNA transfections were done using Lipofectamine 2000 according to the protocol of the manufacturer (Invitrogen). Cells were plated to 40% confluence in 10-cm dishes 24 h prior to transfection. siRNA (0.6 nmol) was mixed with 30 µl of Lipofectamine 2000 in 3 ml of Opti-MEM (Invitrogen). The mixture was added to cells which were subsequently incubated for 6 h. After 24 h, a second transfection was performed similarly. Seventy-two hours after the initial transfection, cells were harvested or treated as indicated below. Cell lysate preparation and Western blot analyses were performed as described previously (15).
Cell proliferation studies. Seventy-two hours after the first siRNA transfection, cells were treated with TMS (5 µM) or left untreated for 2 h and subsequently washed with phosphate-buffered saline (PBS). To analyze relative growth rates, 5 x 104 cells were seeded in triplicate into a 12-well plate and the total cell numbers at the times indicated in a figure were determined using a Coulter counter (Beckman, Fullerton, CA). The effect of TMS on cellular metabolic activity was determined by a WST-1 assay (Roche). Cells were plated onto 96-well plates at a density of 5 x 103 per well. Ten microliters of WST-1 per well was added to the cells, and the plates were incubated at 37°C for 2 h. The absorbance at 450 nm at the times indicated in a figure was measured using a microplate reader (Bio-Rad). For the quantitative determination of the DNA synthesis rate, mitogenic activity was determined by measuring bromodeoxyuridine (BrdU) incorporation by a BrdU cell proliferation enzyme-linked immunosorbent assay (ELISA; Roche). Cells (5 x 103) were seeded in quadruplicate into 96-well plates and allowed to adhere for 16 h. Cells were then labeled for 3 h with BrdU, and DNA synthesis was measured with the ELISA BrdU assay according to the manufacturer's instructions. Absorbance values correlate directly to the amount of newly synthesized DNA and the number of proliferating cells in the culture. The absorbance at 370 nm and 450 nm was measured with a microplate reader (Bio-Rad). All cell proliferation assays were performed at least four times.
Analysis of cellular apoptosis. HeLa or U2OS cells were treated with either the control or FANCJ siRNA duplexes for 72 h as described above. To assay apoptosis induction after TMS treatment, equal numbers of siRNA-treated cells were subcultured in complete medium containing 5 µM TMS or no drug for 2 h and then allowed a recovery period in complete medium for 12 h. Subsequently, the cytoplasmic histone-associated DNA fragments, which are indicative of ongoing apoptosis, were quantitatively measured using the cell death detection ELISAPLUS photometric enzyme immunoassay (Roche).
Immunofluorescence studies.
Cells were treated with siRNA as described above. For drug treatments, TMS (5 µM) was added to the cells for 2 h and the cells were washed twice with PBS, returned to complete medium for 2 h, washed, and fixed with paraformaldehyde (3.7%) at room temperature for 15 min. Fixed cells were washed four times with PBS and treated with 0.5% Triton solution (Sigma) at room temperature for 3 min. Cells were then washed four times with PBS and blocked with 10% goat serum (Sigma) overnight at 4°C. Indirect immunostaining was performed by first incubating cells with a mouse anti-
-H2AX monoclonal antibody (1:500; Upstate) for 1 h at 37°C. Following four washes in PBS containing 0.1% Tween 20, cells were incubated with Alexa Fluor 488-conjugated goat anti-mouse immunoglobulin G (1:400; Invitrogen) for 1 h at 37°C. Cells were washed four times with PBS containing 0.1% Tween 20 and coated with Prolong Gold antifade reagent containing DAPI (4',6'-diamidino-2-phenylindole; Invitrogen). Coverslips were placed on chamber slides, and cells were cured at room temperature in the dark for 24 h. Immunofluorescence analyses were performed with a Zeiss LSM 510 META inverted Axiovert 200 M laser scan microscope with a Plan-Apochromat 63x 1.4-numerical-aperature oil immersion differential interference contrast objective lens. Images were captured with a charge-coupled device camera and analyzed using the LSM Browser software package.
| RESULTS |
|---|
|
|
|---|
S (lane 5), indicating that FANCJ G4 unwinding requires the hydrolysis of nucleoside triphosphate. FANCJ bound the G4 substrate in the presence of ATP
S or in the absence of a nucleotide (data not shown), indicating that G4 binding by FANCJ is not nucleotide dependent.
|
Naturally occurring mutations (P47A and M299I) in the conserved helicase domain of FANCJ previously identified in breast cancer patients lacking BRCA1 or BRCA2 mutations (3) were evaluated for their effects on FANCJ G4 unwinding activity. The P47A mutant protein, which has a 12-fold reduction in the kcat for DNA-dependent ATP hydrolysis and an 80-fold reduction in helicase activity on a forked, 19-bp duplex substrate compared to wild-type FANCJ (13), unwound only 5% of the G4 substrate compared to the 100% unwound by wild-type FANCJ at a 4.8 nM protein concentration (Fig. 1C, lane 3 versus lane 2). The M299I mutant protein (lane 4) retained a level of G4 helicase activity similar to that of wild-type FANCJ, a result that is consistent with the ability of FANCJ to unwind duplex DNA substrates efficiently (13). Kinetic analyses of the G4-unwinding reactions confirmed that the wild-type and M299I FANCJ proteins unwound the TP-G4 substrate in a time-dependent manner but that the P47A mutant protein displayed a 50-fold reduction in the rate of unwinding of the G4 substrate compared to the rate of wild-type FANCJ (Fig. 1D).
We next examined G4 helicase activity as a function of FANCJ concentration. FANCJ unwound the G4 DNA and forked-duplex substrates (0.5 nM) in a protein concentration-dependent manner (see Fig. S2A and B in the supplemental material). Comparable percentages of the 19-bp forked-duplex and G4 substrates were unwound by FANCJ protein concentrations up to 0.3 nM; however, FANCJ concentrations of 0.6 nM and greater unwound significantly more of the G4 substrate than of the forked duplex (see Fig. S2C in the supplemental material).
In addition to FANCJ, two other superfamily 2 (SF2) helicases, Werner syndrome protein (WRN) and BLM, were reported previously to unwind a variety of G4 DNA structures, including the TP-G4 substrate (10, 43). To determine if G4 DNA-unwinding activity is a general property of all SF2 helicases, we tested human RECQ1 helicase, an enzyme that we have previously shown to unwind a variety of duplex DNA structures, including a 3' ssDNA substrate, a forked duplex, a three-stranded D loop, and a four-stranded synthetic Holliday junction (35). RECQ1 was unable to unwind all tetraplex DNA substrates tested, including TP-G4 and a G4 substrate derived from the human telomeric sequence, as well as G4 substrates with a 15- or 25-nucleotide (nt) 3' tail, under conditions in which the enzyme efficiently unwound a forked-duplex substrate (see Fig. S3 in the supplemental material). These results suggest that G4 DNA unwinding by FANCJ is specific and not a general feature of SF2 DNA helicases, including a member of the RecQ helicase family.
FANCJ unwinds a two-stranded G2' tetraplex. An alternative form of G-G-paired DNA, designated G2', can form when hairpin dimers of two antiparallel strands form Hoogsteen hydrogen bonds (42). We examined the ability of FANCJ to unwind G2' tetraplex structures formed by double T4G4 repeats derived from the Oxytricha telomeric sequence. FANCJ unwound the 5'-tailed G2' tetraplex (OX-1-G2') in a protein concentration-dependent manner (Fig. 2A). The percentages of the substrate unwound at given FANCJ protein concentrations were comparable for the two-stranded G2' tetraplex substrate (Fig. 2B) and the four-stranded parallel TP-G4 tetraplex (see Fig. S2C in the supplemental material).
|
|
(MSH2/MSH6) binds with high affinity to G4 DNA formed upon the transcription of the switch regions and that the interaction of MutS
with the switch regions in switching B cells promotes DNA synapsis and recombination (21). We performed experiments to determine if MutS
regulates FANCJ G4 unwinding. MSH2/MSH6 inhibited FANCJ unwinding of the TP-G4 substrate in a protein concentration-dependent manner (Fig. 4A and B). At 5 nM MSH2/MSH6, FANCJ G4 helicase activity was reduced by
30%. Higher MSH2/MSH6 concentrations (10 and 20 nM) further reduced G4 unwinding by 60 and 80%, respectively. MSH2/MSH6 inhibition of FANCJ helicase activity was restricted to G4 structures, since no inhibition of FANCJ unwinding of a forked-duplex substrate by MSH2/MSH6 was observed (Fig. 4C and D). MSH2/MSH6 was able to stably bind the G4 substrate under previously described conditions (21), as evidenced by the results of a gel shift analysis (data not shown), suggesting that MSH2/MSH6 interfered with FANCJ G4 helicase activity by preferentially binding the G4 substrate over a forked substrate with a homoduplex region.
|
FANCJ unwinds human telomeric G4 structures.
For the human telomeric sequence, we tested FANCJ unwinding of four-stranded parallel G4 substrates with either a 15-nt 5' ssDNA tail (5'-15ntTeR2-G4) or an 8-nt 5' ssDNA tail (5'-8ntTeR2-G4). This testing was done to determine if the length of the 5' ssDNA tail may affect the ability of FANCJ to unwind the telomeric G4 structure, since a previous study demonstrated that FANCJ unwinding of substrates with simple 5' tails or forked duplexes is significantly increased when the 5' tail lengths are increased from 5 to 20 nt (14). As shown in Fig. 5, FANCJ unwound the two telomeric G4 substrates in a protein concentration-dependent manner; however, the G4 substrate with a 15-nt 5' tail was unwound much more efficiently by FANCJ than the substrate with an 8-nt 5' tail. For example, at 1.2 nM FANCJ,
90% of the 5'-15ntTeR2-G4 substrate was unwound, compared with <10% of the 5'-8ntTeR2-G4 substrate. At the highest FANCJ concentration tested (4.8 nM),
55% of the 5'-8ntTeR2-G4 substrate was unwound. These results demonstrate that the length of the 5' ssDNA tail adjacent to the G4 structure dramatically affected the ability of FANCJ to unwind the human telomeric G4 substrate.
|
|
|
The ability of TMS to potently inhibit FANCJ G4 helicase raised the question of whether other G4-interactive compounds might similarly affect FANCJ activity. Previously, the porphyrin compound NMM was reported to be a specific inhibitor of G4 DNA unwinding by BLM and the Saccharomyces cerevisiae RecQ helicase Sgs1 (16), and the cationic porphyrin T4 was found to inhibit BLM and WRN helicase activities on both G4 and duplex DNA substrates (24). We therefore tested the abilities of NMM and T4 to inhibit FANCJ unwinding of G4 and duplex DNA substrates. NMM inhibited FANCJ unwinding of the TP-G4 substrate in a dose-dependent manner (see Fig. S5A in the supplemental material); however, significantly higher concentrations of NMM (IC50,
25,000 nM) than of TMS (IC50,
6 nM) were required (see Table S1 in the supplemental material). Moreover, NMM also inhibited FANCJ unwinding of the forked-duplex substrate at high concentrations (see Fig. S5A and Table S1 in the supplemental material), indicating that the effect was not specific to G4 DNA. T4 inhibited FANCJ unwinding of both the G4 and duplex DNA substrates (see Fig. S5B in the supplemental material), resulting in IC50s of 100 and 160 nM, respectively (see Table S1 in the supplemental material). Thus, T4 or NMM inhibition of FANCJ helicase activity was neither substrate specific nor potent compared to the effect of TMS.
FANCJ depletion sensitizes cells to the antiproliferative effects of TMS.
To investigate a potential role of FANCJ in cellular G4 DNA metabolism, we asked if FANCJ-depleted cells were sensitive to the G4-stabilizing compound TMS. Telomerase-positive (HeLa) and telomerase-negative (U2OS) human cell lines were evaluated for TMS sensitivity as a function of FANCJ status. siRNA depletion of FANCJ in HeLa cells resulted in decreases of FANCJ expression by
90% (days 1 and 2), 84% (day 3), and 75% (day 4) compared to that in the control cells, as observed by Western blotting (Fig. 8A). In U2OS cells treated with FANCJ siRNA, FANCJ levels were decreased by
98% (days 1 and 2), 86% (day 3), and 74% (day 4) (Fig. 8A). To determine the proliferative survival of FANCJ-depleted cells, equivalent numbers of cells either untreated or exposed to 5 µM TMS for 2 h were plated and the cells were counted sequentially for 4 days by using a Coulter counter. TMS-treated HeLa cells that had been transfected with FANCJ siRNA displayed approximately twofold reductions in numbers compared to those of the siRNA control cells on days 3 and 4 (Fig. 8B). TMS-treated U2OS cells depleted of FANCJ also displayed reduced growth, with a fivefold difference compared to siRNA control cells on days 3 and 4 (Fig. 8B). Only a marginal difference in growth between FANCJ-depleted HeLa or U2OS cells and siRNA control cells in the absence of TMS treatment was observed (data not shown). TMS significantly impaired the proliferation of FANCJ-depleted HeLa and U2OS cells (Fig. 8C), whereas there was little to no difference in metabolic activity between untreated FANCJ-depleted and control cells, as observed using the WST-1 assay (data not shown). The measured decrease in the metabolic activity of FANCJ-depleted cells treated with TMS is consistent with the decrease in cell number determined by the Coulter counter. HeLa or U2OS cells depleted of FANCJ were sensitive to the ICL agent mitomycin C (MMC) (see Fig. S6A in the supplemental material). The cotreatment of HeLa cells with 1 µM MMC and 5 µM TMS resulted in an additive inhibition of cell growth (see Fig. S6B in the supplemental material). An additive effect of MMC and TMS on cell growth was also observed for U2OS cells (data not shown).
|
To test the effect of TMS on the mitogenic efficiency of FANCJ-depleted cells, we evaluated BrdU incorporation as a measure of DNA synthesis. The results from these experiments, shown in Fig. 8D, demonstrate that FANCJ-depleted HeLa cells or U2OS cells exposed to TMS were impaired in their ability to synthesize DNA compared to control siRNA-treated cells. Little reduction in DNA synthesis was observed for the FANCJ-depleted HeLa or U2OS cells in the absence of TMS treatment. Collectively, these results demonstrate that FANCJ depletion sensitizes telomerase-positive and telomerase-negative cells to the cytotoxic effects of TMS.
Effect of FANCJ depletion on TMS-induced apoptosis. Programmed cell death by the apoptotic pathway is an important component of the cellular response to stress or DNA damage. The negative effect of FANCJ depletion on cellular proliferation upon TMS exposure raised the possibility that the FANCJ status may affect apoptotic potential. As shown quantitatively in Fig. 8E, FANCJ-depleted HeLa or U2OS cells exposed to 5 µM TMS displayed a significantly (>2-fold) greater level of apoptosis after TMS exposure than siRNA control cells, as measured by cytoplasmic mono- and oligonucleosomes. No difference in apoptosis between untreated control and FANCJ siRNA-treated cells was observed (data not shown). These results suggest that the cellular depletion of FANCJ renders both telomerase-positive and telomerase-negative cells more prone to apoptosis upon TMS exposure.
The depletion of FANCJ elevates TMS-induced DNA damage.
We next asked if FANCJ depletion affected the cellular ability to cope with replicational stress induced by the G4-stabilizing compound TMS. Stalled replication forks can lead to fork collapse and double-strand breaks. A well-known marker for double-strand breaks is
-H2AX. To assess the importance of FANCJ in preventing or reducing the number of double-strand breaks that arise from TMS treatment, we analyzed
-H2AX focus formation in control or FANCJ siRNA-transfected cells. In the absence of TMS treatment, FANCJ depletion had no detectable effect on
-H2AX focus formation (Fig. 9), a result that is consistent with the data in a previous report (31). However, the
-H2AX foci were significantly more intense in TMS-treated FANCJ-depleted cells than in control siRNA cells (Fig. 9), a result that was confirmed using MCID Core software (InterFocus Imaging Ltd., Cambridge, United Kingdom) to analyze and compare
-H2AX foci in the two cell lines exposed to TMS. The increased
-H2AX staining in FANCJ-depleted U2OS cells compared to that in undepleted cells, also observed for HeLa cells (see Fig. S8 in the supplemental material), suggests that FANCJ alleviates the replicative stress induced by TMS, thereby decreasing the extent of double-strand breaks.
|
| DISCUSSION |
|---|
|
|
|---|
To probe the functional importance of FANCJ in G4 metabolism in vivo, we examined the effects of TMS, a selective quadruplex binding agent, on cell proliferation and
-H2AX focus formation as a marker of DNA damage in FANCJ-depleted versus control cells. Although TMS was originally identified as a potent telomerase inhibitor by virtue of its ability to stabilize telomeric quadruplex DNA and inhibit the polymerase reaction (37), results from a number of recent studies suggest that TMS can interfere with telomere capping by additional mechanisms and may also exert cytotoxic effects through its action on nontelomere G4 targets (6, 11, 12, 44). Based on the ability of FANCJ to unwind G4 DNA, we hypothesized that FANCJ-depleted cells would be hypersensitive to the biological effects of TMS. Indeed, this turned out to be the case. TMS was observed to significantly impair cell proliferation and growth and induce an elevated level of apoptosis in FANCJ-depleted cells. The antiproliferative and apoptotic effects of TMS were observed in both telomerase-positive and telomerase-negative cells depleted of FANCJ, suggesting that FANCJ plays an important role in G4 metabolism that is not dependent on the telomerase status. Results from cellular immunofluorescence assays demonstrated that TMS induced significantly more intense
-H2AX foci in the FANCJ-depleted cells than in the siRNA control cells. Five percent of the
-H2AX foci colocalized with TRF2, suggesting that the double-strand breaks that occurred after TMS treatment were present in extratelomeric regions and, to a lesser extent, in the telomeres (data not shown). The lack of
-H2AX foci in untreated FANCJ siRNA-transfected cells suggests that transient G4 structures not stabilized by TMS do not impose strong blocks to replication that would result in double-strand breaks. Thus, the G4-stabilizing effect of TMS adversely affected proliferation and DNA damage accumulation among FANCJ-depleted cells to a greater extent than among the control cells. TMS-stabilized G4 structures that presumably accumulate in FANCJ-depleted cells may lead to stalled replication forks that are repaired by homologous recombination, as evidenced for C. elegans dog-1 mutants (48).
Collectively, the molecular and cellular evidence suggests that G4 DNA represents a physiological substrate acted upon by FANCJ to facilitate replication and/or DNA repair. Consistent with a role of FANCJ in the metabolism of G4 structures stabilized by TMS, endogenous FANCJ is phosphorylated in response to cellular exposure to TMS (data not shown). FANCJ phosphorylation was also observed when cells were subjected to UV (31), suggesting a mechanism for the modulation of FANCJ function during the DNA damage response. The phosphorylation state of FANCJ is also important for functions other than the response to exogenous DNA damage, since FANCJ is silenced during the G1 phase of the cell cycle and is activated through a dephosphorylation event as cells enter S phase (20). In the future, it will be important to assess the importance of FANCJ phosphorylation and other posttranslational modifications in modulating the molecular functions of FANCJ during replication or DNA repair. In addition, the cross talk of FANCJ and other DNA repair factors such as RPA and MSH2/MSH6 plays an important role in regulating FANCJ helicase function. The strong colocalization of FANCJ and RPA in response to nucleotide depletion by hydroxyurea (15) suggests that the two proteins collaborate in situations of replicational stress, a condition that arises when the replication fork is impeded by a G4 structure. The observation that the stimulation of FANCJ G4 helicase activity by RPA is specific suggests that the physical interaction between FANCJ and RPA (15) plays a role in the functional interaction. The critical importance of helicase-RPA physical interaction for the stimulation of DNA unwinding was demonstrated previously for the WRN and BLM helicases on duplex DNA substrates (8).
Several reports have provided evidence that small molecules which stabilize G4 structures cause replicative senescence after long-term exposure to tumor cell cultures (18, 33). Among them, the natural product TMS is one of the most potent and selective telomeric G4 ligands. TMS impairs the conformation and length of the telomeric G overhang, an effect that is thought to be more relevant than double-stranded telomere erosion as a marker for TMS cellular activity (44). TMS treatment of human cancer cell lines results in the dissociation of TRF2 from telomeres, impairs cell proliferation, and results in telomere dysfunction, leading to anaphase bridge formation and apoptosis (44). TMS also inhibits POT1 binding to the telomeric G overhang in vitro and induces POT1 dissociation from telomeres in telomerase-positive cells (11). The pleiotropic effects of TMS on telomere dynamics are proposed to revolve around its stabilizing effect on the G4 structure at the telomeric end. Although there is no evidence for a direct role of FANCJ in telomere biology, it is plausible that FANCJ G4 helicase activity is important in telomere maintenance. The potent and specific inhibition of the unwinding of G4 DNA by FANCJ or a related helicase (e.g., BLM or WRN) by TMS may be an underlying cause of the cytotoxic effects of TMS. In this regard, it will be of interest to determine the molecular basis of genomic instability in organisms with deficiencies in genes (rtel, chl1, and Ddx11) that encode proteins with sequence similarity in the helicase core to FANCJ. Rtel (Regulator of telomere length) knockout mice die between days 10 and 11.5, and embryonic stem cells from these knockout mice show telomere loss and display many chromosome breaks and fusions upon differentiation (7), suggesting a role of RTEL in the maintenance of telomere length or capping. The sister chromatid cohesion defects in Saccharomyces cerevisiae chl1 mutants (27, 40), Ddx11 mutant mice (17), and ChlR1-depleted human cells (30), as well as the telomere shortening in human cells containing a mutation in the DDX11 gene encoding ChlR1 (45), may be a consequence of aberrant mitotic chromosome structures due to genomic sequences that form alternate DNA arrangements such as G4 structures. Our results suggest that FANCJ preserves genomic stability by directly unwinding DNA roadblocks such as G4 structures that destabilize or impede the replication fork.
| ACKNOWLEDGMENTS |
|---|
We acknowledge S. Cantor (University of Massachusetts Medical Center, Worcester, MA) for the FANCJ baculovirus and L. Wu and I. Hickson (Cancer Research UK Laboratories) for generously providing recombinant BLM. We thank M. Kenny (Albert Einstein Cancer Center, Bronx, NY) for the human RPA and T. Wilson (University of Maryland, Baltimore, MD) for the purified MSH2/MSH6 complex. We thank Ming Lei (University of Michigan, Ann Arbor, MI) for kindly providing the recombinant POT1. We are grateful to N. Maizels's group (University of Washington, Seattle, WA) for technical advice on G4 DNA substrate preparation. We acknowledge the Fanconi Anemia Research Fund for FA-A and FA-D2 cell lines.
| FOOTNOTES |
|---|
Published ahead of print on 21 April 2008. ![]()
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Cantor, S., R. Drapkin, F. Zhang, Y. Lin, J. Han, S. Pamidi, and D. M. Livingston. 2004. The BRCA1-associated protein BACH1 is a DNA helicase targeted by clinically relevant inactivating mutations. Proc. Natl. Acad. Sci. USA 101:2357-2362.
3. Cantor, S. B., D. W. Bell, S. Ganesan, E. M. Kass, R. Drapkin, S. Grossman, D. C. Wahrer, D. C. Sgroi, W. S. Lane, D. A. Haber, and D. M. Livingston. 2001. BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 105:149-160.[CrossRef][Medline]
4. Cheung, I., M. Schertzer, A. Rose, and P. M. Lansdorp. 2002. Disruption of dog-1 in Caenorhabditis elegans triggers deletions upstream of guanine-rich DNA. Nat. Genet. 31:405-409.[Medline]
5. Choudhary, S., J. A. Sommers, and R. M. Brosh, Jr. 2004. Biochemical and kinetic characterization of the DNA helicase and exonuclease activities of Werner syndrome protein. J. Biol. Chem. 279:34603-34613.
6. De Cian, A., G. Cristofari, P. Reichenbach, E. De Lemos, D. Monchaud, M. P. Teulade-Fichou, K. Shin-ya, L. Lacroix, J. Lingner, and J. L. Mergny. 2007. Reevaluation of telomerase inhibition by quadruplex ligands and their mechanisms of action. Proc. Natl. Acad. Sci. USA 104:17347-17352.
7. Ding, H., M. Schertzer, X. Wu, M. Gertsenstein, S. Selig, M. Kammori, R. Pourvali, S. Poon, I. Vulto, E. Chavez, P. P. Tam, A. Nagy, and P. M. Lansdorp. 2004. Regulation of murine telomere length by Rtel: an essential gene encoding a helicase-like protein. Cell 117:873-886.[CrossRef][Medline]
8. Doherty, K. M., J. A. Sommers, M. D. Gray, J. W. Lee, C. von Kobbe, N. H. Thoma, R. P. Kureekattil, M. K. Kenny, and R. M. Brosh, Jr. 2005. Physical and functional mapping of the replication protein A interaction domain of the Werner and Bloom syndrome helicases. J. Biol. Chem. 280:29494-29505.
9. Eddy, J., and N. Maizels. 2006. Gene function correlates with potential for G4 DNA formation in the human genome. Nucleic Acids Res. 34:3887-3896.
10. Fry, M., and L. A. Loeb. 1999. Human Werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. J. Biol. Chem. 274:12797-12802.
11. Gomez, D., M. F. O'Donohue, T. Wenner, C. Douarre, J. Macadre, P. Koebel, M. J. Giraud-Panis, H. Kaplan, A. Kolkes, K. Shin-ya, and J. F. Riou. 2006. The G-quadruplex ligand telomestatin inhibits POT1 binding to telomeric sequences in vitro and induces GFP-POT1 dissociation from telomeres in human cells. Cancer Res. 66:6908-6912.
12. Gomez, D., T. Wenner, B. Brassart, C. Douarre, M. F. O'Donohue, K. El, V. K. Shin-ya, H. Morjani, C. Trentesaux, and J. F. Riou. 2006. Telomestatin-induced telomere uncapping is modulated by POT1 through G-overhang extension in HT1080 human tumor cells. J. Biol. Chem. 281:38721-38729.
13. Gupta, R., S. Sharma, K. M. Doherty, J. A. Sommers, S. B. Cantor, and R. M. Brosh, Jr. 2006. Inhibition of BACH1 (FANCJ) helicase by backbone discontinuity is overcome by increased motor ATPase or length of loading strand. Nucleic Acids Res. 34:6673-6683.
14. Gupta, R., S. Sharma, J. A. Sommers, Z. Jin, S. B. Cantor, and R. M. Brosh, Jr. 2005. Analysis of the DNA substrate specificity of the human BACH1 helicase associated with breast cancer. J. Biol. Chem. 280:25450-25460.
15. Gupta, R., S. Sharma, J. A. Sommers, M. K. Kenny, S. B. Cantor, and R. M. Brosh, Jr. 2007. FANCJ (BACH1) helicase forms DNA damage inducible foci with replication protein A and interacts physically and functionally with the single-stranded DNA binding protein. Blood 110:2390-2398.
16. Huber, M. D., D. C. Lee, and N. Maizels. 2002. G4 DNA unwinding by BLM and Sgs1p: substrate specificity and substrate-specific inhibition. Nucleic Acids Res. 30:3954-3961.
17. Inoue, A., T. Li, S. K. Roby, M. B. Valentine, M. Inoue, K. Boyd, V. J. Kidd, and J. M. Lahti. 2007. Loss of ChlR1 helicase in mouse causes lethality due to the accumulation of aneuploid cells generated by cohesion defects and placental malformation. Cell Cycle 6:1646-1654.[Medline]
18. Izbicka, E., R. T. Wheelhouse, E. Raymond, K. K. Davidson, R. A. Lawrence, D. Sun, B. E. Windle, L. H. Hurley, and D. D. Von Hoff. 1999. Effects of cationic porphyrins as G-quadruplex interactive agents in human tumor cells. Cancer Res. 59:639-644.
19. Kim, M. Y., H. Vankayalapati, K. Shin-ya, K. Wierzba, and L. H. Hurley. 2002. Telomestatin, a potent telomerase inhibitor that interacts quite specifically with the human telomeric intramolecular G-quadruplex. J. Am. Chem. Soc. 124:2098-2099.[CrossRef][Medline]
20. Kumaraswamy, E., and R. Shiekhattar. 2007. Activation of BRCA1/BRCA2-associated helicase BACH1 is required for timely progression through S phase. Mol. Cell. Biol. 27:6733-6741.
21. Larson, E. D., M. L. Duquette, W. J. Cummings, R. J. Streiff, and N. Maizels. 2005. MutS
binds to and promotes synapsis of transcriptionally activated immunoglobulin switch regions. Curr. Biol. 15:470-474.[CrossRef][Medline]
22. Levitus, M., Q. Waisfisz, B. C. Godthelp, Y. de Vries, S. Hussain, W. W. Wiegant, E. Elghalbzouri-Maghrani, J. Steltenpool, M. A. Rooimans, G. Pals, F. Arwert, C. G. Mathew, M. Z. Zdzienicka, K. Hiom, J. P. de Winter, and H. Joenje. 2005. The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat. Genet. 37:934-935.[CrossRef]
23. Levran, O., C. Attwooll, R. T. Henry, K. L. Milton, K. Neveling, P. Rio, S. D. Batish, R. Kalb, E. Velleuer, S. Barral, J. Ott, J. Petrini, D. Schindler, H. Hanenberg, and A. D. Auerbach. 2005. The BRCA1-interacting helicase BRIP1 is deficient in Fanconi anemia. Nat. Genet. 37:931-933.[CrossRef][Medline]
24. Li, J. L., R. J. Harrison, A. P. Reszka, R. M. Brosh, Jr., V. A. Bohr, S. Neidle, and I. D. Hickson. 2001. Inhibition of the Bloom's and Werner's syndrome helicases by G-quadruplex interacting ligands. Biochemistry 40:15194-15202.[CrossRef][Medline]
25. Litman, R., M. Peng, Z. Jin, F. Zhang, J. Zhang, S. Powell, P. R. Andreassen, and S. B. Cantor. 2005. BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell 8:255-265.[CrossRef][Medline]
26. Maizels, N. 2006. Dynamic roles for G4 DNA in the biology of eukaryotic cells. Nat. Struct. Mol. Biol. 13:1055-1059.[CrossRef][Medline]
27. Mayer, M. L., I. Pot, M. Chang, H. Xu, V. Aneliunas, T. Kwok, R. Newitt, R. Aebersold, C. Boone, G. W. Brown, and P. Hieter. 2004. Identification of protein complexes required for efficient sister chromatid cohesion. Mol. Biol. Cell 15:1736-1745.
28. Mohaghegh, P., J. K. Karow, J. R. Brosh, Jr., V. A. Bohr, and I. D. Hickson. 2001. The Bloom's and Werner's syndrome proteins are DNA structure-specific helicases. Nucleic Acids Res. 29:2843-2849.
29. Oganesian, L., I. K. Moon, T. M. Bryan, and M. B. Jarstfer. 2006. Extension of G-quadruplex DNA by ciliate telomerase. EMBO J. 25:1148-1159.[CrossRef][Medline]
30. Parish, J. L., J. Rosa, X. Wang, J. M. Lahti, S. J. Doxsey, and E. J. Androphy. 2006. The DNA helicase ChlR1 is required for sister chromatid cohesion in mammalian cells. J. Cell Sci. 119:4857-4865.
31. Peng, M., R. Litman, Z. Jin, G. Fong, and S. B. Cantor. 2006. BACH1 is a DNA repair protein supporting BRCA1 damage response. Oncogene 25:2245-2253.[CrossRef][Medline]
32. Peng, M., R. Litman, J. Xie, S. Sharma, R. M. Brosh, Jr., and S. B. Cantor. 2007. The FANCJ/MutL
interaction is required for correction of the cross-link response in FA-J. cells. EMBO J. 26:3238-3249.[CrossRef][Medline]
33. Riou, J. F., L. Guittat, P. Mailliet, A. Laoui, E. Renou, O. Petitgenet, F. Megnin-Chanet, C. Helene, and J. L. Mergny. 2002. Cell senescence and telomere shortening induced by a new series of specific G-quadruplex DNA ligands. Proc. Natl. Acad. Sci. USA 99:2672-2677.
34. Seal, S., D. Thompson, A. Renwick, A. Elliott, P. Kelly, R. Barfoot, T. Chagtai, H. Jayatilake, M. Ahmed, K. Spanova, B. North, L. McGuffog, D. G. Evans, D. Eccles, D. F. Easton, M. R. Stratton, and N. Rahman. 2006. Truncating mutations in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat. Genet. 38:1239-1241.[CrossRef][Medline]
35. Sharma, S., J. A. Sommers, S. Choudhary, J. K. Faulkner, S. Cui, L. Andreoli, L. Muzzolini, A. Vindigni, and R. M. Brosh, Jr. 2005. Biochemical analysis of the DNA unwinding and strand annealing activities catalyzed by human RECQ1. J. Biol. Chem. 280:28072-28084.
36. Shin-ya, K. 2004. Telomerase inhibitor, telomestatin, a specific mechanism to interact with telomere structure. Nippon Rinsho 62:1277-1282. (In Japanese.)[Medline]
37. Shin-ya, K., K. Wierzba, K. Matsuo, T. Ohtani, Y. Yamada, K. Furihata, Y. Hayakawa, and H. Seto. 2001. Telomestatin, a novel telomerase inhibitor from Streptomyces anulatus. J. Am. Chem. Soc. 123:1262-1263.[CrossRef][Medline]
38. Siddiqui-Jain, A., C. L. Grand, D. J. Bearss, and L. H. Hurley. 2002. Direct evidence for a G-quadruplex in a promoter region and its targeting with a small molecule to repress c-MYC transcription. Proc. Natl. Acad. Sci. USA 99:11593-11598.
39. Simonsson, T. 2001. G-quadruplex DNA structures: variations on a theme. Biol. Chem. 382:621-628.[CrossRef][Medline]
40. Skibbens, R. V. 2004. Chl1p, a DNA helicase-like protein in budding yeast, functions in sister-chromatid cohesion. Genetics 166:33-42.
41. Sobeck, A., S. Stone, V. Costanzo, B. de Graaf, T. Reuter, J. de Winter, M. Wallisch, Y. Akkari, S. Olson, W. Wang, H. Joenje, J. L. Christian, P. J. Lupardus, K. A. Cimprich, J. Gautier, and M. E. Hoatlin. 2006. Fanconi anemia proteins are required to prevent accumulation of replication-associated DNA double-strand breaks. Mol. Cell. Biol. 26:425-437.
42. Sun, H., R. J. Bennett, and N. Maizels. 1999. The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. Nucleic Acids Res. 27:1978-1984.
43. Sun, H., J. K. Karow, I. D. Hickson, and N. Maizels. 1998. The Bloom's syndrome helicase unwinds G4 DNA. J. Biol. Chem. 273:27587-27592.
44. Tahara, H., K. Shin-ya, H. Seimiya, H. Yamada, T. Tsuruo, and T. Ide. 2006. G-Quadruplex stabilization by telomestatin induces TRF2 protein dissociation from telomeres and anaphase bridge formation accompanied by loss of the 3' telomeric overhang in cancer cells. Oncogene 25:1955-1966.[CrossRef][Medline]
45. Vasa-Nicotera, M., S. Brouilette, M. Mangino, J. R. Thompson, P. Braund, J. R. Clemitson, A. Mason, C. L. Bodycote, S. M. Raleigh, E. Louis, and N. J. Samani. 2005. Mapping of a major locus that determines telomere length in humans. Am. J. Hum. Genet. 76:147-151.[CrossRef][Medline]
46. Vaughn, J. P., S. D. Creacy, E. D. Routh, C. Joyner-Butt, G. S. Jenkins, S. Pauli, Y. Nagamine, and S. A. Akman. 2005. The DEXH protein product of the DHX36 gene is the major source of tetramolecular quadruplex G4-DNA resolving activity in HeLa cell lysates. J. Biol. Chem. 280:38117-38120.
47. Youds, J. L., L. J. Barber, J. D. Ward, S. J. Collis, N. J. O'Neil, S. J. Boulton, and A. M. Rose. 2008. DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair. Mol. Cell. Biol. 28:1470-1479.
48. Youds, J. L., N. J. O'Neil, and A. M. Rose. 2006. Homologous recombination is required for genome stability in the absence of DOG-1 in Caenorhabditis elegans. Genetics 173:697-708.
49. Zahler, A. M., J. R. Williamson, T. R. Cech, and D. M. Prescott. 1991. Inhibition of telomerase by G-quartet DNA structures. Nature 350:718-720.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||