Skip to main page content

• HOME
• Current Issue
• Archive
• Alerts
• About ASM
• Contact us
• Tech Support
• Journals.ASM.org

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barrientos, K. S. Articles by Counter, C. M. Search for Related Content PubMed PubMed Citation Articles by Barrientos, K. S. Articles by Counter, C. M.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, September 2008, p. 5251-5264, Vol. 28, No. 17
0270-7306/08/$08.00+0     doi:10.1128/MCB.00048-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Distinct Functions of POT1 at Telomeres ^,

Katharine S. Barrientos, Megan F. Kendellen, Brian D. Freibaum, Blaine N. Armbruster, Katherine T. Etheridge, and Christopher M. Counter^*

Department of Pharmacology and Cancer Biology, Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina

Received 10 January 2008/ Returned for modification 13 March 2008/ Accepted 20 May 2008

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The mammalian protein POT1 binds to telomeric single-stranded DNA (ssDNA), protecting chromosome ends from being detected as sites of DNA damage. POT1 is composed of an N-terminal ssDNA-binding domain and a C-terminal protein interaction domain. With regard to the latter, POT1 heterodimerizes with the protein TPP1 to foster binding to telomeric ssDNA in vitro and binds the telomeric double-stranded-DNA-binding protein TRF2. We sought to determine which of these functions—ssDNA, TPP1, or TRF2 binding—was required to protect chromosome ends from being detected as DNA damage. Using separation-of-function POT1 mutants deficient in one of these three activities, we found that binding to TRF2 is dispensable for protecting telomeres but fosters robust loading of POT1 onto telomeric chromatin. Furthermore, we found that the telomeric ssDNA-binding activity and binding to TPP1 are required in cis for POT1 to protect telomeres. Mechanistically, binding of POT1 to telomeric ssDNA and association with TPP1 inhibit the localization of RPA, which can function as a DNA damage sensor, to telomeres.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Telomeres are DNA-protein complexes that protect the ends of linear eukaryotic chromosomes from illegitimate recombination, degradation, and recognition as DNA double-strand breaks. The DNA portion of human telomeres is composed of tandem arrays of the short G-rich repetitive sequence TTAGGG in which the G-rich strand extends beyond the C-rich strand, forming a 3' single-stranded DNA (ssDNA) overhang. Electron microscopic analysis suggests that the 3' overhang can loop back and invade telomeric double-stranded DNA (dsDNA) to form a large lariat structure, effectively hiding the end of the telomere (16). The protein portion of telomeres is composed of two telomeric dsDNA-binding proteins, TRF1 and TRF2 (6, 25, 42, 46, 47), and one telomeric ssDNA-binding protein, POT1 (4, 5), which form a large complex, mediated by proteins such as TIN2 and TPP1 (24, 26, 28, 30, 31, 39, 56, 57), that maintains chromosome end stability (21, 22, 43, 48).

POT1 is a 634-amino-acid protein comprised of an N-terminal evolutionarily conserved pair of oligonucleotide/oligosaccharide (OB) folds responsible for telomeric ssDNA binding (4, 5, 33), with the remaining C terminus serving to bind TPP1 (31, 57) and TRF2 (55). With regard to TPP1, both recombinant (49) and purified (52) human TPP1 proteins form a heterodimer with POT1 in vitro, which enhances the association of POT1 with a G-strand telomere oligonucleotide. Moreover, in the lower eukaryote Oxytricha nova, the POT1 and TPP1 homologues TEBP (4, 5) and TEBPβ (49, 52) form a ternary complex with ssDNA (12, 23) that protects chromosome ends (15). Heterodimerization of POT1 with TPP1 thus appears to enhance POT1 function at telomeric ssDNA. With regard to TRF2, POT1 coimmunoprecipitates with TRF2 (55) and has been isolated by gel filtration in several protein subcomplexes containing TRF2 (27, 30, 39). POT1 thus interacts directly with telomeric ssDNA, in association with TPP1, and presumably indirectly with telomeric dsDNA, through binding of TRF2.

Knockdown of human POT1 expression in a variety of human cells (22, 48, 55) or genetic ablation or conditional knockout of the POT1a gene in mouse fibroblasts (20, 51) or the cPot1 gene in chicken cells (10) results in the colocalization of the early DNA damage response protein -H2AX (or 53BP1) with TRF1. Such foci are termed telomere dysfunction-induced foci (TIFs) and are indicative of the telomere being recognized as a site of DNA damage (43). Moreover, loss of POT1 proteins in all three organisms leads to an accumulation of cytogenetic abnormalities and a decrease in cell proliferation, by either increased senescence or increased apoptosis (10, 19, 20, 48, 51, 55). Thus, POT1 protects the ends of eukaryotic chromosomes from being recognized as DNA damage and from genetic instability.

The understanding of how POT1 protects chromosome ends is incomplete. Specifically, it remains to be determined which of the three known activities of POT1—telomeric ssDNA binding, heterodimerization with TPP1, or interaction with TRF2—are required for protecting chromosome ends. Deciphering which of these three activities are required to protect telomeres has been hampered by the fact that disrupting telomeric proteins often unravels the telomeric protein complex and leads to a DNA damage response. Specifically, knockdown of POT1, TPP1, or TRF2 elicits TIF formation (17, 21, 22, 26, 43, 52). Additionally, reduction of either TIN2 or TPP1 disrupts assembly of the telomeric protein complex (39). For Saccharomyces cerevisiae, separation-of-function mutants have been used successfully to dissect the different functions of the POT1 homologue Cdc13 (14, 38). Capitalizing on this approach, we generated separation-of-function mutants of POT1 defective in one or more of these three activities and tested them for the ability to overcome a DNA damage response at telomeres, as measured by TIF formation induced by the knockdown of endogenous POT1, as well as the ability to localize to telomeres, as measured by immunofluorescence and chromatin immunoprecipitation (ChIP). We found that binding to TRF2 was dispensable for protecting telomeres from a DNA damage response but did foster robust loading of POT1 onto telomeric chromatin. Conversely, the telomeric ssDNA- and TPP1-binding activities were both required in cis for POT1 to protect telomeres from a DNA damage response. Lastly, knockdown of POT1 increased both a DNA damage response at telomeres and telomere association of the ssDNA-binding complex RPA, which can serve as a sensor of DNA damage. Moreover, both phenotypes were rescued by expression of wild-type POT1 but not a TPP1-binding mutant of POT1. Taking these data collectively, we speculate that POT1 is loaded onto telomeres via association with TRF2 and once bound to telomeric ssDNA as a heterodimer with TPP1 may prevent binding of RPA and possibly even a DNA damage response.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Plasmids. N-terminally FLAG epitope-tagged human POT1 (F-POT1) cDNA (3) was used as a template for PCRs to generate N-terminally FLAG-tagged POT1 fragments spanning amino acids 2 to 350 (F-POT1^2OB) and 127 to 634 (F-POT1^OB). NAAIRS substitution mutants of F-POT1 were generated as previously described (1), using site-directed mutagenesis (QuikChange; Stratagene), to create a panel of 49 individual tandem NAAIRS substitution mutants of every six amino acids spanning amino acids 311 to 629 (with the exception of amino acids 419, 431, 443, 497, and 503), with the first amino acid of POT1 replaced by the NAAIRS sequence used to identify each mutant. RNA interference (RNAi)-resistant versions of F-POT1, F-POT1^OB, F-POT1^TPP1, F-POT1^TRF2-1, F-POT1^TRF2-2, and F-POT1^TPP1TRF2-2 (including NAAIRS substitutions 317, 545, 599, and 317 plus 599) were generated by site-directed mutagenesis to introduce the silent mutations A₄₀₃₃CCT, A₄₀₃₆G, A₄₀₃₉G, C₄₀₄₂G, and C₄₀₄₈G. All cDNAs were confirmed by direct sequencing and subcloned into pBABE-neo, pBABE-puro (36), pCI-neo (Invitrogen), and pEYFP-C1 (Clontech). myc-tagged TIN2 cDNA (a kind gift from Judith Campisi) was subcloned into pCI-neo, myc-TPP1 cDNA generated by reverse transcription-PCR (RT-PCR) from HeLa cell total RNA with a primer encoding the c-myc epitope was subcloned into pEYFP-C1, and myc-TRF2 (2) was subcloned into pDsRed2-C1 (Clontech). The irrelevant FLAG epitope-tagged Ras^17N protein was expressed from a pcDNA3 plasmid. A POT1 short hairpin RNA (shRNA) carried in pSUPER-Retro-puro-POT1 shRNA (48) was subcloned into pSUPER-Retro-neo. The sequence for TRF2 small hairpin RNA (53) was subcloned into pSUPER-Retro-puro.

Cell lines. Human embryonic kidney 293T cells were stably infected with retroviruses derived from pBABE-puro carrying no transgene (vector) or encoding F-POT1, F-POT1 NAAIRS mutants, or F-POT1 truncation mutants, as previously described (40), and polyclonal populations were selected with puromycin (Sigma). In one case, IMR-90 human skin fibroblasts (ATCC) were similarly infected with retroviruses derived from pBABE-neo carrying no transgene (vector) or encoding RNAi-resistant forms of F-POT1, F-POT1^OB, F-POT1^2OB, or F-POT1^2OB+OB; polyclonal populations were selected with Geneticin (Gibco), after which the cells were again stably infected with retroviruses derived from pSUPER-Retro-puro carrying no transgene (vector) or POT1 shRNA (48); and again polyclonal populations were selected with puromycin (Sigma). In a second case, IMR-90 cells were stably infected with retroviruses derived from pBABE-puro carrying no transgene (vector) or encoding RNAi-resistant forms of F-POT1^TPP1, F-POT1^TRF2-1, F-POT1^TRF2-2, or F-POT1^TPP1TRF2-2, selected with puromycin, and then again stably infected with retroviruses derived from pSUPER-Retro-neo carrying no sequence (vector) or POT1 shRNA (48), and again polyclonal populations were selected with Geneticin (Gibco).

G-strand DNA-binding assay. ³⁵S-labeled proteins were synthesized in vitro by use of a T7 quick-coupled TNT system (Promega), using the plasmids pCI-neo-F-POT1, -F-POT1^2OB, -F-POT1^OB, -F-POT1^TPP1, -F-POT1^TRF2-1, and -F-POT1^TRF2-2 following the manufacturer's instructions. One-fifth of the reaction mixture was used as an input control, and the remaining reaction mixture was diluted in 1x phosphate-buffered saline (PBS) supplemented with 0.1 mM phenylmethylsulfonyl fluoride and incubated with anti-FLAG M2 agarose affinity resin (Sigma) for 1 h at room temperature. The resin was washed three times with 1x PBS for 5 min, and one-third of the immunoprecipitate was incubated for 30 min in binding buffer (50 mM NaCl, 25 mM HEPES, pH 7.4, 1 mM EDTA, pH 8.0, 100 ng/ml bovine serum albumin) containing 2.5 mM of the pBoli109 primer (5'CCGTAAGCATTTCATTATTGGAATTCGAGCTCGTTTTCGA) (4) and 10 nM of the G-strand oligonucleotide [(T₂AG₃)₅] ³²P end labeled with T4 polynucleotide kinase (Invitrogen) and purified with G-25 gel filtration mini spin columns (Promega) according to the manufacturer's protocol. Unbound G-strand oligonucleotide was removed by washing of the anti-FLAG M2 resin three times in 1x PBS for 5 min and then resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), after which the gel was fixed in 40% methanol-7% acetic acid-10% glycerol and dried and products were visualized by exposure to a phosphorimager screen.

Immunofluorescence. To determine if F-POT1 or mutants thereof colocalized with TRF1, 293T cells seeded on coverslips were transiently cotransfected with 0.2 µg of pEYFP, encoding yellow fluorescent protein (YFP) fused in frame with F-POT1 or mutants thereof, and 0.2 µg of pDsRed2-CI-TRF2, using FuGENE 6 (Roche) per the manufacturer's protocol. Forty-eight hours later, cells were fixed, permeabilized, and blocked as previously described (2), mounted in Faramount aqueous mounting medium (DakoCytomation), and examined at a magnification of x1,000 on an Olympus IX70 confocal fluorescence microscope.

To assess whether F-POT1 and mutants thereof rescued the induction of TIFs by POT1 shRNA, the above-described IMR-90 cells stably expressing F-POT1 or mutants thereof were seeded on coverslips and, 48 h later, were fixed, permeabilized, and blocked as previously described (2). Endogenous -H2AX was detected with anti--H2AX mouse monoclonal antibody (clone JBW301; Upstate) at a 1:300 dilution, and endogenous TRF1 was detected with an anti-TRF1 rabbit polyclonal antibody (a kind gift from Dominique Broccoli, Fox Chase Cancer Center) at a 1:200 dilution in phosphate-buffered gelatin (PBG) for 1 h. Following three 5-min washes, the cells were incubated for 1 h with donkey anti-mouse antibody conjugated with rhodamine RedX (Jackson ImmunoResearch) and donkey anti-rabbit antibody conjugated with fluorescein isothiocyanate (FITC; Jackson ImmunoResearch), both diluted 1:200 in PBG. Following three 5-min washes with PBG and two 5-min washes with 1x PBS, coverslips were mounted in Faramount aqueous mounting medium (DakoCytomation), and cells were examined as described above.

To assess the localization of RPA in cells expressing vector or a retrovirus encoding POT1 shRNA, the above-described IMR-90 cells stably expressing F-POT1 or mutants thereof were seeded on coverslips and, 48 h later, were fixed, permeabilized, and blocked as previously described (2). Endogenous RPA was detected with anti-RPA p34 mouse monoclonal antibody (NeoMarkers/Lab Vision Corporation) at a 1:200 dilution, and endogenous TRF1 was detected as described above. Following three 5-min washes in PBG, the cells were incubated for 1 h with donkey anti-rabbit antibody conjugated with rhodamine RedX (Jackson ImmunoResearch) and donkey anti-mouse antibody conjugated with FITC (Jackson ImmunoResearch), both diluted 1:200 in PBG. Following three 5-min washes in PBG, the cells were incubated for 45 min with goat anti-FITC-Alexa 488 antibody diluted 1:200 in PBG. Cells were then washed, mounted, and examined as described above.

Each experiment was repeated at least twice by observing at least 150 cells in each trial for the TIF assay and at least 125 cells in each trial for the assay of costaining of telomeres and RPA (STAR). The percentages of TIF- and STAR-positive cells and standard errors were then calculated and graphed.

ChIP. ChIP assays were performed as described previously (9), with the following modifications. A Branson sonifier microtip (Branson Ultrasonics) was used for sonification (output 3; duty cycle, 30%; five 10-s bursts), insoluble material was then pelleted by microcentrifugation (13,000 x g for 5 min at 4°C), and the remaining lysate was diluted in lysis buffer (1:2) precleared by the addition of 30 µl of a 50% slurry of GammaBind G-Sepharose (Amersham Biosciences) and incubation at 4°C for 1 h, transferred to new tubes, and incubated overnight with anti-FLAG M2 agarose affinity gel (Sigma) at 4°C. Dot blots were performed with a ³²P-labeled oligonucleotide telomeric probe [(T₂AG₃)₄] or, as a control, an ALU repeat probe, as previously described (7). Hybridization of the probes was confirmed with 10 µg of total genomic DNA blotted on each membrane.

Crystal violet staining. The first confluent plates of the above-described IMR-90 cells stably expressing pBABE-neo carrying no transgene (vector) or encoding F-POT1, F-POT1^2OB, or F-POT^OB and pSUPER-Retro-puro carrying no sequence or the sequence for POT1 shRNA were plated at 100,000 cells per 6-cm plate. The first confluent plate was arbitrarily assigned to be population doubling (pd) 0. Cells were passaged continually, and when the greatest difference in growth was observed (pd 8), they were split 1:8 and plated onto a well of a six-well plate. One week later, cells were fixed and stained with crystal violet, as previously described (48), to monitor plating efficiency.

Immunoprecipitation and immunoblotting. 293T cells stably expressing F-POT1 or mutants thereof were transiently transfected with 8 µg of pCI-neo-mycTIN2 (myc-TIN2) or pEYFP-C1-TPP1 (GFP-TPP1), using FuGENE 6 (Roche) following the manufacturer's protocol. Forty-eight hours later, cells were lysed as previously described (1). One-tenth of the lysate was immunoblotted to assess protein input levels, using mouse monoclonal anti-green fluorescent protein (anti-GFP; 1:1,000) (Roche), mouse monoclonal anti-myc (1:3,000) (Invitrogen), or mouse monoclonal anti-FLAG M2 (1:1,200) (Sigma) antibody. The remaining lysate was incubated with 4 µg mouse monoclonal anti-GFP (Roche) or mouse monoclonal anti-myc (Invitrogen) antibody for 1 h at 4°C and then incubated with 60 µl of 50% G-Sepharose beads (Amersham Biosciences) for 3 h at 4°C. Samples were washed twice for 10 min each in lysis buffer with rocking at 4°C, resolved by SDS-PAGE, immunoblotted with primary mouse monoclonal anti-FLAG M2 antibody (Sigma) and either anti-GFP mouse monoclonal (Roche) or anti-myc mouse monoclonal (Invitrogen) antibody followed by secondary antibodies as previously described (1). To assay for coimmunoprecipitation of F-POT1 and NAAIRS mutants thereof with endogenous TRF2, lysates were similarly prepared from 293T cells stably expressing F-POT1 or mutants thereof, and F-POT1 proteins were immunoprecipitated with 25 µl of a 50% slurry of anti-FLAG M2 agarose affinity resin (Sigma) at 4°C for 2 h and eluted with 2.4 µg FLAG peptide (Sigma). The resultant eluate was resolved by SDS-PAGE and immunoblotted with primary anti-FLAG M2 antibody (1:1,200) (Sigma) and anti-human TRF2 monoclonal antibody (1:250) (Imgenex) and with secondary antibodies as described above. Lastly, F-POT1, F-POT1^2OB, F-POT1^OB, or F-POT1^2OB+OB stably expressed in IMR-90 cells was detected by similarly immunoprecipitating the protein with anti-FLAG M2 agarose affinity resin (Sigma), followed by immunoblotting with either primary anti-FLAG M2 (1:1,200) (Sigma) or endogenous rabbit polyclonal anti-POT1 982 (1:3,000) (48) antibody and with secondary antibodies as described above. In the figures, vertical dotted lines indicate samples run in the same gel, separated by irrelevant samples that have been excluded.

RT-PCR. Total RNA was reverse transcribed and PCR amplified with primers 5'-AGCCTGTGAAAGCGAACAAT-3' (targeted to the 5' untranslated region not found in the plasmid encoding POT1) and 5'-CAGCTGTTTTGCAGATTGGA-3' or 5'-GAAGGTGAAGGTCGGAGACAA-3' and 5'-GCAGAGGGGGCAGAGATGAT-3' to detect endogenous POT1 or, as a control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), respectively, as previously described (18). The PCR cycle number varied between 25 and 33 cycles, depending on cell type and transcript.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Truncation mutants encoding ssDNA-binding or protein interaction activity of POT1. As a first step to identify the functions of POT1 required to protect telomere ends from being detected as DNA damage, we tested whether telomeric ssDNA-binding activity, protein interaction activity, or both avtivities of POT1 could suppress TIFs induced by knockdown of endogenous POT1 in human cells. To this end, FLAG-tagged truncation mutants of human POT1 were generated, consisting of either the minimal telomeric ssDNA-binding region of POT1 (amino acids 0 to 350) (45), termed F-POT1^2OB, or the C-terminal protein interaction domain (amino acids 127 to 634) (3, 32), termed F-POT1^OB (Fig. 1A). F-POT1^2OB encompasses the known telomeric ssDNA-binding region of POT1, as detailed by crystallography (29). Binding to a model telomeric ssDNA substrate was assessed in vitro for each F-POT1 mutant. Specifically, recombinant ³⁵S-labeled FLAG-tagged wild-type POT1 (F-POT1), F-POT1^2OB, and F-POT1^OB were incubated with ³²P-labeled oligonucleotide model telomeric G-strand substrate (T₂AG₃)₃, immunoprecipitated by virtue of the FLAG epitope tag, and resolved by SDS-PAGE. Consistent with the mapping of the ssDNA-binding activity of POT1 to its N-terminal OB folds (33), F-POT1 and F-POT1^2OB coimmunoprecipitated with telomeric ssDNA, whereas F-POT1^OB did not (Fig. 1B). Thus, F-POT1^2OB encompasses the in vitro telomeric ssDNA-binding activity of POT1, whereas F-POT1^OB, which retains only the C-terminal protein interaction domain, lacks this activity.

View larger version (51K): [in this window] [in a new window]

FIG. 1. POT1 truncation mutants. (A) Diagrams of indicated POT1 proteins. OB1 and OB2, oligonucleotide/oligosaccharide DNA-binding domains; FLAG, FLAG epitope tag. Numbers give amino acid numbers. (B) In vitro immunoprecipitation of the indicated 35S-labeled F-POT1 proteins with a 32P-labeled telomeric ssDNA oligonucleotide. (C and D) Immunoprecipitation (IP) of GFP-tagged TPP1 (GFP-TPP1) (C) or myc-tagged TIN2 (myc-TIN2) (D) followed by immunoblotting (IB) to detect whether the indicated F-POT1 proteins coimmunoprecipitated with GFP-TPP1 (C) or myc-TIN2 (D) in 293T cells. Inputs were 1/10 of the total immunoprecipitation lysates. F-POT1OB (C) and F-POT1 (D) are difficult to see as inputs but are clearly visible as coimmunoprecipitates with GFP-TPP1 and myc-TIN2. (E) Visualization by direct fluorescence of the indicated YFP-FLAG-tagged POT1 (YFP-F-POT1) proteins (green channel) and RFP-TRF2 proteins (red channel) in 293T cells. (F) ChIP analysis of the indicated proteins expressed in 293T cells immunoprecipitated with an anti-FLAG antibody and Southern hybridized with the indicated probes in the absence or presence of cross-linking. Total genomic DNA served as a loading control. All images are representative of duplicate experiments, except for panels C and D, which are representative of triplicate experiments.

To confirm that the C-terminal fragment of POT1 includes the region critical for protein interaction activity, 293T cells stably expressing vector as a negative control, F-POT1 as a positive control, F-POT1^2OB, or F-POT1^OB were transiently transfected with GFP-tagged TPP1 (GFP-TPP1), which associates directly with POT1 (31), or myc-tagged TIN2 (myc-TIN2), which is thought to associate with POT1 as part of a larger protein complex (30, 39). Ectopic GFP-TPP1 or myc-TIN2 was immunoprecipitated using an anti-GFP or anti-myc antibody, respectively, and immunoblotted with an anti-FLAG antibody to detect whether the ectopic F-POT1 proteins coimmunoprecipitated with GFP-TPP1 or myc-TIN2. Consistent with the mapping of the protein interaction activity of POT1 to the C terminus (31), both F-POT1 and F-POT1^OB coimmunoprecipitated with ectopic GFP-TPP1 and myc-TIN2, whereas F-POT1^2OB, which includes only the telomeric ssDNA-binding domain, did not (Fig. 1C and D). Thus, F-POT1^OB retains the functional protein interaction activity of POT1, whereas F-POT1^2OB lacks this activity.

To explore which domain of POT1 facilitates association with telomeric chromatin in vivo, F-POT1, F-POT1^2OB, and F-POT1^OB fused in frame with YFP, or the YFP vector alone as a negative control, were transiently coexpressed in 293T cells with TRF2 in frame with red fluorescent protein (RFP-TRF2) as a marker of telomeres. YFP alone showed pan-nuclear staining. As previously reported (5, 31, 32), direct fluorescence revealed a nuclear punctate pattern of YFP-F-POT1 that colocalized with RFP-TRF2, indicating that YFP-F-POT1 localized to telomeres (Fig. 1E). Similar punctate staining and colocalization with RFP-TRF2 were also observed for YFP-F-POT1^OB, indicating that the protein interaction region of POT1 is sufficient to localize POT1 to telomeres in vivo, as previously described (31). YFP-F-POT1^2OB did not display punctate nuclear staining or colocalization with RFP-TRF2 (Fig. 1E). Because F-POT1^2OB binds telomeric ssDNA in vitro and ssDNA comprises a minuscule portion of telomeres, we suggest that F-POT1^2OB may yet bind telomeric ssDNA but that this association is beyond the level of detection of direct fluorescence.

These subcellular localization patterns were independently validated using ChIP, which measures the amount and type of genomic DNA associated with proteins. Specifically, 293T cells were transiently transfected with F-POT1^OB, F-POT1^2OB, F-POT1 as a positive control, or an irrelevant FLAG-tagged protein (F-Ras^17N) as a negative control. The ectopic proteins were immunoprecipitated by virtue of the FLAG epitope tag, and associated telomeric DNA was detected by Southern hybridization with a telomere-specific probe. Consistent with the fluorescence data, F-POT1^2OB coimmunoprecipitated with telomeric DNA slightly more than the irrelevant protein Ras^17N did but clearly less than wild-type F-POT1 did. Telomeric DNA was coimmunoprecipitated with both F-POT1 and F-POT1^OB. This association was specific for telomeric DNA, as neither F-POT1 protein associated with other repetitive DNA (ALU probe), nor did these proteins immunoprecipitate with telomeric DNA in the absence of cross-linking (Fig. 1F; see Fig. S1 in the supplemental material). Taken together, these data suggest that F-POT1^OB is abundantly loaded onto telomeric chromatin via association with telomeric proteins in cells but does not associate directly with telomeric ssDNA, at least as assayed in vitro. Conversely, F-POT1^2OB does not associate with known POT1-binding proteins but does bind telomeric ssDNA in vitro, although this association was difficult to capture in vivo. We thus generated mutants of POT1 that separate the telomeric ssDNA-binding and protein interaction activities.

Both ssDNA-binding and protein interaction activities of POT1 are required for telomere protection. We next tested which of the generated POT1 truncation mutants could protect telomeres from being detected as DNA damage when cells were treated with POT1 shRNA. This shRNA was previously validated to reduce both mRNA and protein levels of POT1 (48). A DNA damage response at telomeres was measured by colocalization of TRF1 with -H2AX, in foci termed TIFs (43). First, F-POT1 and F-POT1^OB were made RNAi resistant by the introduction of silent mutations in the bases targeted by shRNA. F-POT1^2OB does not include the targeted bases, and thus no mutations were necessary for RNAi resistance. Next, normal human IMR-90 skin fibroblasts were engineered to stably express vector as a negative control, RNAi-resistant F-POT1 as a positive control, F-POT1^2OB, RNAi-resistant F-POT1^OB, or both of the truncation mutants (termed F-POT1^2OB+OB) in trans. The expression of these constructs was confirmed by immunoprecipitation and immunoblotting with an anti-FLAG antibody (Fig. 2A). The five cell lines were then stably infected with a retrovirus carrying vector or POT1 shRNA to assess whether any of the proteins could substitute for endogenous POT1 in protecting telomere ends. Appropriate knockdown of endogenous POT1 mRNA was validated by RT-PCR (Fig. 2B; see Fig. S2A in the supplemental material).

View larger version (55K): [in this window] [in a new window]

FIG. 2. ssDNA-binding and protein interaction activities of POT1 are required to protect telomere ends. (A) Detection of the indicated F-POT1 proteins expressed in IMR-90 cells by immunoprecipitation (IP) followed by immunoblotting (IB) with an anti-FLAG antibody. (B) Detection of endogenous POT1 mRNA, or GAPDH mRNA as a loading control, by RT-PCR in the indicated IMR-90 cells. (C and D) Detection of endogenous TRF1 (green channel) and -H2AX (red channel) by indirect immunofluorescence, whereby colocalization indicates TIFs, quantitated from >150 cells (C) or as representative images (D) of the indicated IMR-90 cells. Images are representative of duplicate experiments. Error bars represent standard errors. (E) Crystal violet-stained IMR-90 cells expressing the indicated transgenes 1 week after being seeded at low density.

At least 150 cells from each of the 10 cell lines were assayed by indirect immunofluorescence for the formation of TIFs as a measurement of telomere dysfunction. Cells displaying more than 10 colocalizations between endogenous TRF1 and -H2AX were counted as TIF positive, and the percentage of TIF-positive cells was calculated and graphed (Fig. 2C and D). In the absence of POT1 shRNA, cells expressing F-POT1, F-POT1^OB, F-POT1^2OB, or F-POT1^2OB+OB exhibited TIFs at a similar level to the vector background, indicating that expression of these proteins alone did not induce a DNA damage response. As expected and previously shown (22), knockdown of endogenous POT1 induced TIFs in vector control cells. This effect was suppressed in cells expressing RNAi-resistant F-POT1 (Fig. 2C and D; see Fig. S3 in the supplemental material). Importantly, none of the F-POT1 truncation mutants, alone or in combination, suppressed TIFs induced upon knockdown of endogenous POT1 (Fig. 2C and D; see Fig. S3 in the supplemental material). We thus concluded that the telomeric ssDNA-binding and protein interaction domains of POT1 are both required in cis to protect telomere ends.

We validated these results in a more biological assay of telomere damage. In addition to the formation of TIFs, disruption of POT1 in normal cells induces growth arrest (22, 48). Therefore, IMR-90 cells expressing vector, F-POT1, F-POT1^OB, or F-POT1^2OB were seeded at a low density at regular intervals and, 1 week later, were stained with crystal violet to detect adherent cells. By pd 8, vector cells treated with POT1 shRNA were less confluent than vector control cells with normal levels of endogenous POT1. This growth defect was abrogated by expression of RNAi-resistant F-POT1 (Fig. 2E; see Fig. S4 in the supplemental material). Consistent with TIF analysis (Fig. 2C and D), cells expressing RNAi-resistant F-POT1^OB or F-POT1^2OB failed to rescue this phenotype, despite the fact that cells expressing these proteins had normal cell growth in the presence of endogenous POT1 (Fig. 2E; see Fig. S4 in the supplemental material). Thus, we concluded that both the telomeric ssDNA-binding and protein interaction activities of POT1 are required in cis to protect telomeres from being detected as DNA damage and cells from undergoing growth arrest.

POT1 separation-of-function mutants. Since telomeric ssDNA binding alone was insufficient for POT1 to protect telomeres, we sought to identify the proteins that, in conjunction with telomeric ssDNA binding, are needed for POT1 to protect telomeres from being detected as DNA damage. As discussed previously, POT1 binds TPP1 and TRF2 (31, 55). Knockdown of both TPP1 and TRF2 induces TIFs, suggesting that either or both may potentially mediate telomere protection through POT1 (17, 21, 22, 31, 43). However, inhibition of a single telomere-binding protein can disrupt the entire telomeric protein complex (39), which complicates the interpretation of these results. Thus, to determine which proteins mediate the capping function of POT1, we sought to create POT1 separation-of-function mutants that disrupted the binding of POT1 with either TPP1 or TRF2 while retaining telomeric ssDNA-binding activity.

To identify POT1 separation-of-function mutants, a panel of 49 substitution mutants was generated, spanning the C terminus of POT1, which contains all known protein interaction domains (31). Specifically, nearly every six amino acids in this region were tandemly substituted with the NAAIRS sequence. Because this sequence can adopt multiple secondary conformations (50) and protein size is not altered by substitution mutagenesis, NAAIRS substitutions have been used to disrupt protein interactions while minimizing gross alterations to protein structure (1, 37, 41). Using this approach, we identified two classes of POT1 separation-of-function mutants.

First, we identified one mutant, termed F-POT1^TPP1, containing a NAAIRS substitution beginning at amino acid 317, that retained the ability to associate with TRF2 but lost the ability to interact with TPP1. Specifically, 293T cells stably expressing F-POT1 as a positive control, F-POT1^2OB as a negative control, or F-POT1^TPP1 were transiently transfected with GFP-TPP1. Subsequently, GFP-TPP1 was immunoprecipitated using an anti-GFP antibody, and associated F-POT1 proteins were identified by immunoblotting with an anti-FLAG antibody. As expected, the F-POT1 positive control, but not the F-POT1^2OB negative control, coimmunoprecipitated with GFP-TPP1. Like F-POT1^2OB, F-POT1^TPP1 did not coimmunoprecipitate with GFP-TPP1 (Fig. 3A). To ascertain whether this mutant retained the ability to bind TRF2, stably expressed F-POT1, F-POT1^2OB, and F-POT1^TPP1 were immunoprecipitated from 293T cells by use of anti-FLAG antibody and immunoblotted to detect endogenous TRF2. The F-POT1^2OB negative control did not coimmunoprecipitate with TRF2, whereas both F-POT1^TPP1 and the F-POT1 positive control associated with relatively equal levels of TRF2 (Fig. 3B). Thus, F-POT1^TPP1 lost the ability to bind TPP1 but retained the ability to associate with TRF2.

View larger version (49K): [in this window] [in a new window]

FIG. 3. Separation-of-function mutants of POT1. (A) Immunoprecipitation (IP) of GFP-tagged TPP1 (GFP-TPP1) followed by immunoblotting (IB) to detect whether the indicated F-POT1 proteins coimmunoprecipitated with GFP-TPP1 in 293T cells. (B) Immunoprecipitation (IP) of the indicated F-POT1 proteins followed by immunoblotting (IB) to detect whether endogenous TRF2 coimmunoprecipitated with the indicated F-POT1 proteins in 293T cells. Inputs were 1/10 of the total immunoprecipitation lysates. Images are representative of triplicate experiments.

Second, we identified two mutants, termed F-POT1^TRF2-1 and F-POT1^TRF2-2, with NAAIRS substitutions beginning at amino acids 545 and 599, respectively, which retained the ability to associate with TPP1 but lost the ability to interact with TRF2. Specifically, F-POT1^TRF2-1 and F-POT1^TRF2-2 stably expressed in 293T cells coimmunoprecipitated with transiently expressed GFP-TPP1, similar to the F-POT1 positive control (Fig. 3A). These mutants failed to coimmunoprecipitate endogenous TRF2, despite the fact that the F-POT1 positive control associated with TRF2 (Fig. 3B). Thus, F-POT1^TRF2-1 and F-POT1^TRF2-2 lost the ability to bind TRF2 but retained the ability to associate with TPP1. Immunoprecipitation followed by immunoblotting with an anti-FLAG antibody demonstrated relatively similar protein expression levels of these F-POT1 NAAIRS mutants (see Fig. 5A and Fig. S5 in the supplemental material). Interestingly, F-POT1^TRF2-2 overlaps with a mutant previously demonstrated to reduce TPP1 binding to a truncated glutathione S-transferase-POT1 fusion construct in vitro (31). However, when the mutation was introduced into full-length POT1 that was expressed in cells, this mutation only modestly reduced binding to GFP-TPP1, while F-POT1^TRF2-2 was confirmed to robustly interact with GFP-TPP1 (see Fig. S6 in the supplemental material) but not with TRF2 (Fig. 3B).

View larger version (40K): [in this window] [in a new window]

FIG. 5. TPP1-POT1 interaction protects telomeres from being detected as DNA damage. (A) Detection of the indicated F-POT1 proteins by immunoprecipitation (IP) followed by immunoblotting (IB) in IMR-90 cells. (B) Detection of endogenous POT1 mRNA, or GAPDH mRNA as a loading control, by RT-PCR with the indicated IMR-90 cells. (C and D) IP of GFP-tagged TPP1 (GFP-TPP1) (C) or myc-tagged TIN2 (myc-TIN2) (D) followed by IB to detect whether the indicated F-POT1 proteins coimmunoprecipitated with GFP-TPP1 or myc-TIN2 in 293T cells. (E) IP of the indicated F-POT1 proteins followed by IB to detect whether endogenous TRF2 coimmunoprecipitated with the indicated F-POT1 proteins in 293T cells. (F and G) Detection of endogenous TRF1 (green channel) and -H2AX (red channel) by indirect immunofluorescence, whereby colocalization indicates TIFs, quantitated from >150 cells (E) or as representative images (F) of the indicated IMR-90 cells. Error bars represent standard errors. In panels C to E, inputs were 1/10 of the total immunoprecipitation lysates. Images in panels C to G are representative of duplicate experiments.

POT1 association with TRF2 facilitates telomere localization of POT1. We next assessed the telomeric localization of the F-POT1 NAAIRS mutants in cells. 293T cells were transiently cotransfected with RFP-TRF2 to demark telomeres and with YFP-F-POT1^TPP1, YFP-F-POT1^TRF2-1, or YFP-F-POT1^TRF2-2, and colocalization was assessed by direct fluorescence. While YFP-F-POT1^TPP1 exhibited a punctate nuclear pattern that colocalized with RFP-TRF2, indicative of association with telomeres, neither YFP-F-POT1^TRF2-1 nor YFP-F-POT1^TRF2-2 appeared to localize robustly to telomeres (Fig. 4A). These results were confirmed by ChIP. F-POT1 and F-POT1^TPP1, but not F-POT1^TRF2-1 and F-POT1^TRF2-2, stably expressed in 293T cells readily immunoprecipitated with telomeric chromatin by ChIP in a manner specific for telomeric DNA and dependent upon cross-linking (Fig. 4B; see Fig. S4 in the supplemental material). These data suggest that TRF2 promotes POT1 binding to telomeric chromatin. In agreement, knockdown of TRF2 reduces localization of POT1 on telomeres (55), with the caveat that knockdown of TRF2 could disrupt the telomeric protein complex (39). Loss of TPP1 binding did not overtly reduce POT1 association with telomeres, although knockdown of TPP1 has been shown to reduce POT1 binding on telomeres (31). This discrepancy could reflect either a disruption of a higher-order telomeric protein complex assembly (39) upon knockdown of TPP1 or that a reduction in telomeric ssDNA binding in cells is not detected with overexpressed F-POT1^TPP1 protein.

View larger version (47K): [in this window] [in a new window]

FIG. 4. TRF2-POT1 interaction promotes telomeric localization of POT1. (A) Visualization by direct fluorescence of the indicated YFP-F-POT1 (green channel) and RFP-TRF2 (red channel) proteins in 293T cells. (B) ChIP analysis of the indicated F-POT1 proteins expressed in 293T cells, immunoprecipitated with an anti-FLAG antibody, and Southern hybridized with the indicated probes in the absence or presence of cross-linking. Total genomic DNA served as a loading control. (C) In vitro immunoprecipitation of the indicated 35S-labeled F-POT1 proteins with a 32P-labeled telomeric ssDNA oligonucleotide. (D and E) Immunoprecipitation (IP) of myc-tagged TIN2 (myc-TIN2) followed by immunoblotting (IB) to detect whether the indicated F-POT1 proteins coimmunoprecipitated with myc-TIN2 in 293T cells with normal levels of endogenous TRF2 (D) or in 293T cells expressing TRF2 shRNA (E). (F) Immunoblot (IB) of endogenous TRF2 levels in 293T parental cells and in 293T cells transiently transfected with TRF2 shRNA. In panels D and E, inputs were 1/10 of the total immunoprecipitation lysates. All images are representative of duplicate experiments, except for panel D, which is representative of triplicate experiments.

To further explore the role of TRF2 in mediating POT1 association with telomeric chromatin, we tested whether a loss of TRF2 binding disrupts the intrinsic telomeric ssDNA-binding activity of POT1 in vitro, thereby reducing POT1 association with telomeres. As previously shown (Fig. 1B), in vitro-generated F-POT1 and the ssDNA-binding fragment F-POT1^2OB coimmunoprecipitated with ³²P-labeled telomere oligonucleotide, whereas the negative control protein interaction fragment F-POT1^OB did not (Fig. 4C). Similarly, F-POT1^TRF2-1, F-POT1^TRF2-2, and F-POT1^TPP1 all coimmunoprecipitated with the telomeric oligonucleotide (Fig. 4C). Thus, a loss of TRF2 binding did not reduce the intrinsic telomeric ssDNA-binding activity of POT1 in vitro.

TRF2 promotes the localization of POT1 to telomeres in cells (Fig. 4A and B). Additionally, TRF2 directly interacts with TIN2 (26, 56), and TIN2 was recently shown to enhance POT1 nuclear localization (8), although TIN2 does not bind POT1 directly (57). We thus speculated that TRF2 promotes the binding of POT1 to telomeric chromatin through association with TIN2. To test this hypothesis, we first analyzed whether TIN2 binding to POT1 mutants correlated with TRF2 binding. Specifically, 293T cells stably expressing F-POT1 as a positive control, F-POT1^2OB as a negative control, F-POT1^TPP1, F-POT1^TRF2-1, or F-POT1^TRF2-2 were transiently transfected with myc-TIN2. Subsequently, myc-TIN2 was immunoprecipitated using an anti-myc antibody, and associated F-POT1 proteins were identified by immunoblotting with an anti-FLAG antibody. While F-POT1^TPP1 and the F-POT1 positive control both coimmunoprecipitated with myc-TIN2, this interaction was not detected with F-POT1^TRF2-1, F-POT1^TRF2-2, or the F-POT1^2OB negative control (Fig. 4D). Thus, the ability of POT1 to robustly associate with telomeric chromatin (Fig. 4A and B) was lost upon disruption of TRF2 and TIN2 association. We next investigated whether the association of TIN2 with POT1 depended upon TRF2. Specifically, 293T cells stably expressing F-POT1 or F-POT1^2OB, as a negative control (Fig. 4E), were transiently cotransfected with myc-TIN2 and TRF2 shRNA, which reduced endogenous TRF2 levels 80%, as assessed by immunoblotting (Fig. 4F). myc-TIN2 was then immunoprecipitated using an anti-myc antibody, and association with F-POT1 proteins was assessed by immunoblotting with an anti-FLAG antibody. While myc-TIN2 coimmunoprecipitated with F-POT1 in vector control cells, this association was reduced to almost the level of the F-POT1^2OB negative control in cells transfected with TRF2 shRNA (Fig. 4E). This suggests either that POT1 associates with TIN2 through TRF2 or that the loss of TRF2 reduces POT1 at telomeres (55) and consequently reduces the association with TIN2. In sum, we speculate that the association of POT1 with TRF2 and TIN2 facilitates robust loading of POT1 onto telomeric chromatin, perhaps reflecting the abundance of TRF2 on telomeric dsDNA.

TPP1-POT1 interaction is required to prevent DNA damage responses at the telomere. As mentioned previously, telomeric ssDNA binding alone was insufficient for POT1 to protect telomeres (Fig. 2), and hence, separation-of-function mutants were created that retained ssDNA-binding activity but were defective in binding to either TPP1 (F-POT1^TPP1) or TRF2 (F-POT1^TRF2-1 or F-POT1^TRF2-2) (Fig. 3 and 4D). To determine which protein interaction was required with telomeric ssDNA binding to protect telomeres, we tested whether expression of either of these types of mutants could inhibit TIF formation induced upon knockdown of endogenous POT1. IMR-90 normal human skin fibroblasts were first stably infected with a retrovirus encoding vector as a negative control, RNAi-resistant wild-type F-POT1 as a positive control, RNAi-resistant F-POT1^TPP1, F-POT1^TRF2-1, or F-POT1^TRF2-2. Appropriate expression of F-POT1 or derived NAAIRS mutants was demonstrated by immunoprecipitation with an anti-FLAG antibody followed by immunoblotting with an anti-POT1 antibody (Fig. 5A). As an additional negative control, IMR-90 cells were also stably infected with a retrovirus encoding F-POT1^TPP1TRF2-2, in which the NAAIRS substitution mutations of F-POT1^TPP1 and F-POT1^TRF2-2 were both introduced into RNAi-resistant F-POT1. As expected, F-POT1^TPP1TRF2-2 stably expressed in 293T cells did not coimmunoprecipitate with GFP-TPP1, endogenous TRF2, or myc-TIN2, despite the positive control F-POT1 coimmunoprecipitating with these proteins (Fig. 5C to E). Expression of F-POT1^TPP1TRF2-2 in IMR-90 cells was also confirmed (Fig. 5A). These lines were then stably infected with a retrovirus carrying either shRNA directed against POT1 or vector as a negative control. Appropriate knockdown of endogenous POT1 was verified by RT-PCR for the resultant 12 cell lines (Fig. 2B and 5B; see Fig. S2B in the supplemental material).

Indirect immunofluorescence was performed on all 12 cell lines to assess TIF formation by the colocalization of endogenous TRF1 and -H2AX in at least 150 cells of each line. As previously described (22), TIFs were induced in vector cells expressing POT1 shRNA (Fig. 2C and D and 5F and G). Moreover, this effect was rescued by expressing an RNAi-resistant F-POT1 protein (Fig. 5F and G). Consistent with the observation that F-POT1^2OB did not reduce TIFs upon knockdown of POT1 (Fig. 2C and D), cells expressing F-POT1^TPP1TRF2-2 exhibited a similar percentage of TIF-positive cells to that for vector cells expressing POT1 shRNA (Fig. 5F and G). F-POT1^TRF2-1 and F-POT1^TRF2-2 (Fig. 3 and 4D) did not induce TIFs in IMR-90 cells in the absence of POT1 shRNA (Fig. 5F and G). Like F-POT1, F-POT1^TRF2-1 or F-POT1^TRF2-2 suppressed the formation of TIFs when endogenous POT1 was knocked down (Fig. 5F and G). Although it was difficult to capture the binding of F-POT1^TRF2 mutants to telomeres in cells, the abilities of these mutants to bind telomeric DNA in vitro and to suppress TIFs induced by POT1 shRNA suggest that they retain the ability to bind telomeric ssDNA. On the other hand, losing binding to TPP1 actually induced TIFs, even in the absence of POT1 shRNA. Specifically, IMR-90 cells expressing F-POT1^TPP1 exhibited more TIFs than did POT1 shRNA-treated cells (Fig. 5F and G) and growth arrested, precluding the testing of TIFs in the presence of POT1 shRNA. We speculate that F-POT1^TPP1 may be bound preferentially to dsDNA of telomeres, perhaps acting in a dominant-negative fashion to titrate proteins away from the endogenous POT1 bound to the single-stranded portion of telomeres. It is notable that expression of TPP1 containing a 92-amino-acid deletion that disrupts POT1 binding also induces TIFs (17). We thus concluded that the telomeric ssDNA and TPP1 binding activities of POT1, but not TRF2 binding, are required to prevent telomeres from being detected as DNA damage.

POT1 inhibits RPA localization to telomeres. Both the ssDNA-binding domain of POT1 and the association with TPP1, which enhances POT1 binding to ssDNA (49, 52), are required to protect telomeres from being detected as DNA damage. Conversely, the association of POT1 with TRF2 is dispensable for this protection. This suggests that binding of telomeric ssDNA by POT1 may prevent a DNA damage response at telomeres. As such, we speculated that POT1 inhibits the binding of a protein involved in a DNA damage response that recognizes ssDNA. In this regard, it has been noted that (i) loss of POT1 proteins activates ATR (11, 17) and ATR activation requires RPA, which binds ssDNA (58); (ii) the second OB fold of the p70 subunit of human RPA has significant homology to the OB folds of POT1 (35, 44); and (iii) two subunits of RPA in S. cerevisiae bind weakly to telomeric DNA (13). As such, POT1 may prevent a DNA damage response by blocking RPA binding to telomeres.

To determine if POT1 competes with RPA for telomere binding, the localization of RPA at the telomere was examined by immunofluorescence in the absence or presence of POT1 shRNA. Specifically, the amount of colocalization of endogenous RPA, detected with two different antibodies, and endogenous TRF1 or TRF2, to demark telomeres, was assessed in at least 125 IMR-90 cells expressing a POT1 shRNA or vector as a negative control. The colocalization of RPA and TRF1 or TRF2 in this assay was termed costaining of telomeres and RPA (STAR), and cells displaying more than 15 STARs were counted as STAR positive. Vector control cell populations had very few STAR-positive cells (4%, on average). Knockdown of POT1 in IMR-90 cells induced an approximately fivefold increase in the number of STAR-positive cells (Fig. 6A and B; see Fig. S7 in the supplemental material). Furthermore, expression of RNAi-resistant F-POT1 in POT1 knockdown cells suppressed the formation of STARs (Fig. 6A and B). Thus, RPA is localized to telomeres in the absence of POT1. Because knockdown of POT1 does not induce an S phase arrest (22) (see Fig. S8 in the supplemental material), we favor the idea that it is the exposure of telomeric ssDNA, rather than stalled replication forks, that accounts for the increase of RPA at telomeres upon knockdown of POT1. As in the case of a DNA damage response at telomeres, binding of POT1 to TPP1 was also required to inhibit the localization of RPA to telomeres. Specifically, expression of F-POT1^TRF2-2 repressed the accumulation of STARs in the presence of POT1 shRNA, whereas F-POT1^TPP1 induced an approximately ninefold increase in the number of STAR-positive cells in the absence of POT1 shRNA. Collectively, we speculate that the POT1-TPP1 heterodimer may protect telomere ends from being detected as DNA damage by excluding RPA from binding telomeric ssDNA.

View larger version (31K): [in this window] [in a new window]

FIG. 6. POT1 inhibits RPA association with telomeres. Visualization by indirect immunofluorescence was performed to show endogenous TRF1 (red channel) and RPA (green channel) in IMR-90 cells expressing the indicated F-POT1 proteins or POT1 shRNA, as representative images (A) and quantitated from two experiments with >75 cells each (B). Error bars represent standard errors.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
POT1 has three known activities, namely, telomeric ssDNA binding (4, 22, 33), TPP1 binding (24, 31, 57), and TRF2 binding (55). Using POT1 truncation mutants that retain only telomeric ssDNA-binding or protein interaction activity, we found that both these activities are required in cis to prevent telomeres from being detected as DNA damage and to prevent growth arrest following knockdown of endogenous POT1. Furthermore, using separation-of-function POT1 mutants that retain telomeric ssDNA-binding activity but that differentially bind TPP1 or TRF2, we demonstrated that F-POT1^TRF2 mutants defective in TRF2 binding but not TPP1 binding exhibit a reduction of telomere localization. This argues that the interaction with the abundant telomeric dsDNA via TRF2 promotes robust localization of POT1 to telomeric chromatin, as modeled in Fig. 7A and C. F-POT1^TRF2 mutants could still associate indirectly with telomeric dsDNA through TPP1 (24, 31, 57), and given that the F-POT1^TPP1 mutant prevented a DNA damage response, there may be an important connection, admittedly indirect, to proteins that bind telomeric dsDNA through TPP1 (Fig. 7C). Binding to TRF2 also correlated with binding to TIN2. TIN2 has been shown to promote the nuclear localization of POT1 or to prevent its nuclear export (8), suggesting further tiers of regulation of POT1 telomeric localization. Taken together, we hypothesize that POT1 binding to TRF2 may be required to recruit POT1 to telomeric chromatin and, furthermore, that binding to TRF2 may link POT1 to TIN2, potentially promoting the retention of POT1 in the nucleus and/or on telomeric chromatin (Fig. 7A and C). Since TPP1 was previously suggested to mediate POT1 localization to telomeres (31), we further speculate that this interaction may be important for POT1 association with telomeric ssDNA in cells.

View larger version (23K): [in this window] [in a new window]

FIG. 7. Models of distinct functions of POT1 separation-of-function mutants at telomeres. (A) Wild-type POT1 functions in a telomeric dsDNA subcomplex via direct interaction with TRF2, which enhances localization to telomeric chromatin, and in a telomeric ssDNA subcomplex via a direct interaction with TPP1 that protects telomere ends from detection as DNA damage by excluding RPA, which can act as a DNA damage sensor, from telomeric ssDNA. (B) POT1TPP1 can still localize to telomeric chromatin via direct interaction with TRF2 but allows RPA access to telomeric ssDNA and thus fails to protect chromosome ends from being detected as DNA damage. (C) POT1TRF2 fails to localize to telomeric chromatin but excludes RPA from telomeric ssDNA and thus protects telomeres from being detected as DNA damage. Solid lines indicate a strong interaction, while dotted lines indicate a weakened interaction.

On the other hand, the interaction between POT1 and TPP1 is important in protecting telomeres from being recognized as DNA damage, as F-POT1^TRF2 mutants rescued TIFs induced by POT1 knockdown, whereas the F-POT1^TPP1 mutant actually induced TIFs in the presence of endogenous POT1. In agreement, TIFs are reduced in murine fibroblasts in which both POT1 genes are disrupted upon expression of human POT1 and TPP1 (21), overexpression of a truncated TPP1 protein defective in POT1 binding (TPP1^RD) can induce TIFs (17), and lastly, knockdown of the v5 splice version of POT1 that does not interact with TPP1 induced fewer DNA damage foci than did knockdown of the predominant splice form that binds TPP1 (54). Mechanistically, we show that knockdown of POT1 results in an accumulation of RPA at telomeres, as evidenced by an increased number of STAR-positive cells. Moreover, while the F-POT1^TRF2 mutants rescued STARs in the absence of endogenous POT1, overexpression of the F-POT1^TPP1 mutant induced an even greater percentage of STAR-positive cells, indicating that more RPA is localized to telomeres when the POT1-TPP1 heterodimer is disrupted. Since TPP1 enhances binding of POT1 to telomeric ssDNA, at least in vitro (49, 52), and F-POT1^TRF2 mutants that retain both TPP1 and telomeric ssDNA binding rescue TIFs and STARs, we hypothesize that POT1 acts in a heterodimer with TPP1 to exclude RPA from telomeric ssDNA (Fig. 7B). Since knockdown of POT1 activates ATR (11, 17), results in an accumulation of RPA at telomeres, and induces TIFs and since RPA is known to act upstream of ATR (58), it is tempting to speculate that the binding of RPA to telomeres in the absence of POT1 promotes a DNA damage response at telomeres.

In conclusion, using separation-of-function mutagenesis, we defined specific activities of POT1 mediated by interactions with telomeric ssDNA and dsDNA protein subcomplexes, with dsDNA subcomplexes fostering loading of POT1 onto telomeric chromatin and ssDNA subcomplexes serving to protect telomeres from being detected as DNA damage.

 
We thank D. Broccoli for generously sharing reagents, J. Campisi for TIN2 cDNA, and members of the Counter lab for helpful discussions.

This research was supported by NIH grant CA082481 and the Werner and Elaine Dannheisser Fund for Research in the Biology of Aging from the Lymphoma Foundation. C.M.C. is a Leukemia and Lymphoma Society Scholar.

 
* Corresponding author. Mailing address: Department of Pharmacology and Cancer Biology, Department of Radiation Oncology, Duke University Medical Center, Durham, NC 27710. Phone: (919) 684-9890. Fax: (919) 684-8958. E-mail: count004{at}mc.duke.edu

Published ahead of print on 2 June 2008.

Supplemental material for this article may be found at http://mcb.asm.org/.

K. S. Barrientos and M. F. Kendellen contributed equally to this work.

Present address: Millipore Corporation, St. Charles, MO.

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1
1. Armbruster, B. N., S. S. Banik, C. Guo, A. C. Smith, and C. M. Counter. 2001. N-terminal domains of the human telomerase catalytic subunit required for enzyme activity in vivo. Mol. Cell. Biol. 21:7775-7786.[Abstract/Free Full Text]
2
2. Armbruster, B. N., K. T. Etheridge, D. Broccoli, and C. M. Counter. 2003. Putative telomere-recruiting domain in the catalytic subunit of human telomerase. Mol. Cell. Biol. 23:3237-3246.[Abstract/Free Full Text]
3
3. Armbruster, B. N., C. M. Linardic, T. Veldman, N. P. Bansal, D. L. Downie, and C. M. Counter. 2004. Rescue of an hTERT mutant defective in telomere elongation by fusion with hPot1. Mol. Cell. Biol. 24:3552-3561.[Abstract/Free Full Text]
4
4. Baumann, P., and T. R. Cech. 2001. Pot1, the putative telomere end-binding protein in fission yeast and humans. Science 292:1171-1175.[Abstract/Free Full Text]
5
5. Baumann, P., E. Podell, and T. R. Cech. 2002. Human Pot1 (protection of telomeres) protein: cytolocalization, gene structure, and alternative splicing. Mol. Cell. Biol. 22:8079-8087.[Abstract/Free Full Text]
6
6. Broccoli, D., A. Smogorzewska, L. Chong, and T. de Lange. 1997. Human telomeres contain two distinct Myb-related proteins, TRF1 and TRF2. Nat. Genet. 17:231-235.[CrossRef][Medline]
7
7. Chai, W., J. W. Shay, and W. E. Wright. 2005. Human telomeres maintain their overhang length at senescence. Mol. Cell. Biol. 25:2158-2168.[Abstract/Free Full Text]
8
8. Chen, L. Y., D. Liu, and Z. Songyang. 2007. Telomere maintenance through spatial control of telomeric proteins. Mol. Cell. Biol. 27:5898-5909.[Abstract/Free Full Text]
9
9. Cheung, P., K. G. Tanner, W. L. Cheung, P. Sassone-Corsi, J. M. Denu, and C. D. Allis. 2000. Synergistic coupling of histone H3 phosphorylation and acetylation in response to epidermal growth factor stimulation. Mol. Cell 5:905-915.[CrossRef][Medline]
10
10. Churikov, D., C. Wei, and C. M. Price. 2006. Vertebrate POT1 restricts G-overhang length and prevents activation of a telomeric DNA damage checkpoint but is dispensable for overhang protection. Mol. Cell. Biol. 26:6971-6982.[Abstract/Free Full Text]
11
11. Denchi, E. L., and T. de Lange. 2007. Protection of telomeres through independent control of ATM and ATR by TRF2 and POT1. Nature 448:1068-1071.[CrossRef][Medline]
12
12. Fang, G., and T. R. Cech. 1993. Oxytricha telomere-binding protein: DNA-dependent dimerization of the alpha and beta subunits. Proc. Natl. Acad. Sci. USA 90:6056-6060.[Abstract/Free Full Text]
13
13. Gao, H., R. B. Cervantes, E. K. Mandell, J. H. Otero, and V. Lundblad. 2007. RPA-like proteins mediate yeast telomere function. Nat. Struct. Mol. Biol. 14:208-214.[CrossRef][Medline]
14
14. Garvik, B., M. Carson, and L. Hartwell. 1995. Single-stranded DNA arising at telomeres in cdc13 mutants may constitute a specific signal for the RAD9 checkpoint. Mol. Cell. Biol. 15:6128-6138.[Abstract]
15
15. Gray, J. T., D. W. Celander, C. M. Price, and T. R. Cech. 1991. Cloning and expression of genes for the Oxytricha telomere-binding protein: specific subunit interactions in the telomeric complex. Cell 67:807-814.[CrossRef][Medline]
16
16. Griffith, J. D., L. Comeau, S. Rosenfield, R. M. Stansel, A. Bianchi, H. Moss, and T. de Lange. 1999. Mammalian telomeres end in a large duplex loop. Cell 97:503-514.[CrossRef][Medline]
17
17. Guo, X., Y. Deng, Y. Lin, W. Cosme-Blanco, S. Chan, H. He, G. Yuan, E. J. Brown, and S. Chang. 2007. Dysfunctional telomeres activate an ATM-ATR-dependent DNA damage response to suppress tumorigenesis. EMBO J. 26:4709-4719.[CrossRef][Medline]
18
18. Hamad, N. M., J. H. Elconin, A. E. Karnoub, W. Bai, J. N. Rich, R. T. Abraham, C. J. Der, and C. M. Counter. 2002. Distinct requirements for Ras oncogenesis in human versus mouse cells. Genes Dev. 16:2045-2057.[Abstract/Free Full Text]
19
19. He, H., A. S. Multani, W. Cosme-Blanco, H. Tahara, J. Ma, S. Pathak, Y. Deng, and S. Chang. 2006. POT1b protects telomeres from end-to-end chromosomal fusions and aberrant homologous recombination. EMBO J. 25:5180-5190.[CrossRef][Medline]
20
20. Hockemeyer, D., J. P. Daniels, H. Takai, and T. de Lange. 2006. Recent expansion of the telomeric complex in rodents: two distinct POT1 proteins protect mouse telomeres. Cell 126:63-77.[CrossRef][Medline]
21
21. Hockemeyer, D., W. Palm, T. Else, J. P. Daniels, K. K. Takai, J. Z. Ye, C. E. Keegan, T. de Lange, and G. D. Hammer. 2007. Telomere protection by mammalian Pot1 requires interaction with Tpp1. Nat. Struct. Mol. Biol. 14:754-761.[CrossRef][Medline]
22
22. Hockemeyer, D., A. J. Sfeir, J. W. Shay, W. E. Wright, and T. de Lange. 2005. POT1 protects telomeres from a transient DNA damage response and determines how human chromosomes end. EMBO J. 24:2667-2678.[CrossRef][Medline]
23
23. Horvath, M. P., V. L. Schweiker, J. M. Bevilacqua, J. A. Ruggles, and S. C. Schultz. 1998. Crystal structure of the Oxytricha nova telomere end binding protein complexed with single strand DNA. Cell 95:963-974.[CrossRef][Medline]
24
24. Houghtaling, B. R., L. Cuttonaro, W. Chang, and S. Smith. 2004. A dynamic molecular link between the telomere length regulator TRF1 and the chromosome end protector TRF2. Curr. Biol. 14:1621-1631.[CrossRef][Medline]
25
25. Karlseder, J., D. Broccoli, Y. Dai, S. Hardy, and T. de Lange. 1999. p53- and ATM-dependent apoptosis induced by telomeres lacking TRF2. Science 283:1321-1325.[Abstract/Free Full Text]
26
26. Kim, S. H., C. Beausejour, A. R. Davalos, P. Kaminker, S. J. Heo, and J. Campisi. 2004. TIN2 mediates functions of TRF2 at human telomeres. J. Biol. Chem. 279:43799-43804.[Abstract/Free Full Text]
27
27. Kim, S. H., A. R. Davalos, S. J. Heo, F. Rodier, Y. Zou, C. Beausejour, P. Kaminker, S. M. Yannone, and J. Campisi. 2008. Telomere dysfunction and cell survival: roles for distinct TIN2-containing complexes. J. Cell Biol. 181:447-460.[Abstract/Free Full Text]
28
28. Kim, S. H., P. Kaminker, and J. Campisi. 1999. TIN2, a new regulator of telomere length in human cells. Nat. Genet. 23:405-412.[CrossRef][Medline]
29
29. Lei, M., E. R. Podell, and T. R. Cech. 2004. Structure of human POT1 bound to telomeric single-stranded DNA provides a model for chromosome end-protection. Nat. Struct. Mol. Biol. 11:1223-1229.[CrossRef][Medline]
30
30. Liu, D., M. S. O'Connor, J. Qin, and Z. Songyang. 2004. Telosome, a mammalian telomere-associated complex formed by multiple telomeric proteins. J. Biol. Chem. 279:51338-51342.[Abstract/Free Full Text]
31
31. Liu, D., A. Safari, M. S. O'Connor, D. W. Chan, A. Laegeler, J. Qin, and Z. Songyang. 2004. PTOP interacts with POT1 and regulates its localization to telomeres. Nat. Cell Biol. 6:673-680.[CrossRef][Medline]
32
32. Loayza, D., and T. De Lange. 2003. POT1 as a terminal transducer of TRF1 telomere length control. Nature 423:1013-1018.[CrossRef][Medline]
33
33. Loayza, D., H. Parsons, J. Donigian, K. Hoke, and T. de Lange. 2004. DNA binding features of human POT1: a nonamer 5'-TAGGGTTAG-3' minimal binding site, sequence specificity, and internal binding to multimeric sites. J. Biol. Chem. 279:13241-13248.[Abstract/Free Full Text]
34
34. Makarov, V. L., Y. Hirose, and J. P. Langmore. 1997. Long G tails at both ends of human chromosomes suggest a C strand degradation mechanism for telomere shortening. Cell 88:657-666.[CrossRef][Medline]
35
35. Martin, V., L. L. Du, S. Rozenzhak, and P. Russell. 2007. Protection of telomeres by a conserved Stn1-Ten1 complex. Proc. Natl. Acad. Sci. USA 104:14038-14043.[Abstract/Free Full Text]
36
36. Morgenstern, J. P., and H. Land. 1990. A series of mammalian expression vectors and characterisation of their expression of a reporter gene in stably and transiently transfected cells. Nucleic Acids Res. 18:1068.[Free Full Text]
37
37. Mosher, R. A., W. E. Durrant, D. Wang, J. Song, and X. Dong. 2006. A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. Plant Cell 18:1750-1765.[Abstract/Free Full Text]
38
38. Nugent, C. I., T. R. Hughes, N. F. Lue, and V. Lundblad. 1996. Cdc13p: a single-strand telomeric DNA-binding protein with a dual role in yeast telomere maintenance. Science 274:249-252.[Abstract/Free Full Text]
39
39. O'Connor, M. S., A. Safari, H. Xin, D. Liu, and Z. Songyang. 2006. A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc. Natl. Acad. Sci. USA 103:11874-11879.[Abstract/Free Full Text]
40
40. O'Hayer, K. M., and C. M. Counter. 2005. A genetically defined normal human somatic cell system to study ras oncogenesis in vivo and in vitro. Methods Enzymol. 407:637-647.
41
41. Sellers, W. R., B. G. Novitch, S. Miyake, A. Heith, G. A. Otterson, F. J. Kaye, A. B. Lassar, and W. G. Kaelin, Jr. 1998. Stable binding to E2F is not required for the retinoblastoma protein to activate transcription, promote differentiation, and suppress tumor cell growth. Genes Dev. 12:95-106.[Abstract/Free Full Text]
42
42. Smogorzewska, A., B. van Steensel, A. Bianchi, S. Oelmann, M. R. Schaefer, G. Schnapp, and T. de Lange. 2000. Control of human telomere length by TRF1 and TRF2. Mol. Cell. Biol. 20:1659-1668.[Abstract/Free Full Text]
43
43. Takai, H., A. Smogorzewska, and T. de Lange. 2003. DNA damage foci at dysfunctional telomeres. Curr. Biol. 13:1549-1556.[CrossRef][Medline]
44
44. Theobald, D. L., R. B. Cervantes, V. Lundblad, and D. S. Wuttke. 2003. Homology among telomeric end-protection proteins. Structure 11:1049-1050.[Medline]
45
45. Trujillo, K. M., J. T. Bunch, and P. Baumann. 2005. Extended DNA binding site in Pot1 broadens sequence specificity to allow recognition of heterogeneous fission yeast telomeres. J. Biol. Chem. 280:9119-9128.[Abstract/Free Full Text]
46
46. van Steensel, B., and T. de Lange. 1997. Control of telomere length by the human telomeric protein TRF1. Nature 385:740-743.[CrossRef][Medline]
47
47. van Steensel, B., A. Smogorzewska, and T. de Lange. 1998. TRF2 protects human telomeres from end-to-end fusions. Cell 92:401-413.[CrossRef][Medline]
48
48. Veldman, T., K. T. Etheridge, and C. M. Counter. 2004. Loss of hPot1 function leads to telomere instability and a cut-like phenotype. Curr. Biol. 14:2264-2270.[CrossRef][Medline]
49
49. Wang, F., E. R. Podell, A. J. Zaug, Y. Yang, P. Baciu, T. R. Cech, and M. Lei. 2007. The POT1-TPP1 telomere complex is a telomerase processivity factor. Nature 445:506-510.[CrossRef][Medline]
50
50. Wilson, I. A., D. H. Haft, E. D. Getzoff, J. A. Tainer, R. A. Lerner, and S. Brenner. 1985. Identical short peptide sequences in unrelated proteins can have different conformations: a testing ground for theories of immune recognition. Proc. Natl. Acad. Sci. USA 82:5255-5259.[Abstract/Free Full Text]
51
51. Wu, L., A. S. Multani, H. He, W. Cosme-Blanco, Y. Deng, J. M. Deng, O. Bachilo, S. Pathak, H. Tahara, S. M. Bailey, Y. Deng, R. R. Behringer, and S. Chang. 2006. Pot1 deficiency initiates DNA damage checkpoint activation and aberrant homologous recombination at telomeres. Cell 126:49-62.[CrossRef][Medline]
52
52. Xin, H., D. Liu, M. Wan, A. Safari, H. Kim, W. Sun, M. S. O'Connor, and Z. Songyang. 2007. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature 445:559-562.[CrossRef][Medline]
53
53. Xu, L., and E. H. Blackburn. 2004. Human Rif1 protein binds aberrant telomeres and aligns along anaphase midzone microtubules. J. Cell Biol. 167:819-830.[Abstract/Free Full Text]
54
54. Yang, Q., R. Zhang, I. Horikawa, K. Fujita, Y. Afshar, A. Kokko, P. Laiho, L. A. Aaltonen, and C. C. Harris. 2007. Functional diversity of human protection of telomeres 1 isoforms in telomere protection and cellular senescence. Cancer Res. 67:11677-11686.[Abstract/Free Full Text]
55
55. Yang, Q., Y. L. Zheng, and C. C. Harris. 2005. POT1 and TRF2 cooperate to maintain telomeric integrity. Mol. Cell. Biol. 25:1070-1080.[Abstract/Free Full Text]
56
56. Ye, J. Z., J. R. Donigian, M. van Overbeek, D. Loayza, Y. Luo, A. N. Krutchinsky, B. T. Chait, and T. de Lange. 2004. TIN2 binds TRF1 and TRF2 simultaneously and stabilizes the TRF2 complex on telomeres. J. Biol. Chem. 279:47264-47271.[Abstract/Free Full Text]
57
57. Ye, J. Z., D. Hockemeyer, A. N. Krutchinsky, D. Loayza, S. M. Hooper, B. T. Chait, and T. de Lange. 2004. POT1-interacting protein PIP1: a telomere length regulator that recruits POT1 to the TIN2/TRF1 complex. Genes Dev. 18:1649-1654.[Abstract/Free Full Text]
58
58. Zou, L., and S. J. Elledge. 2003. Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes. Science 300:1542-1548.[Abstract/Free Full Text]

---

Molecular and Cellular Biology, September 2008, p. 5251-5264, Vol. 28, No. 17
0270-7306/08/$08.00+0     doi:10.1128/MCB.00048-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

This article has been cited by other articles:

• Kendellen, M. F., Barrientos, K. S., Counter, C. M. (2009). POT1 Association with TRF2 Regulates Telomere Length. Mol. Cell. Biol. 29: 5611-5619 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF) Supplemental material Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Reprints and Permissions Copyright Information Books from ASM Press MicrobeWorld Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Barrientos, K. S. Articles by Counter, C. M. Search for Related Content PubMed PubMed Citation Articles by Barrientos, K. S. Articles by Counter, C. M.