Previous Article | Next Article ![]()
Molecular and Cellular Biology, September 2008, p. 5698-5709, Vol. 28, No. 18
0270-7306/08/$08.00+0 doi:10.1128/MCB.01833-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Vasco Liberal,
Björn Grünenfelder,
Susana R. Chaves,
Charles H. Spruck,
and
Steven I. Reed*
Department of Molecular Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037
Received 8 October 2007/ Returned for modification 28 November 2007/ Accepted 4 July 2008
|
|
|---|
|
|
|---|
Cks proteins are evolutionarily conserved in eukaryotes. Yeasts contain only one Cks protein-encoding gene (CKS1 in budding yeast and suc1+ in fission yeast), whereas vertebrates have two paralogs, CKS1 and CKS2 (55), whose protein products are 81% identical in both humans and mice. Both genes have previously been disrupted in the mouse, and animals nullizygous for either gene are viable (59, 60). Mice nullizygous for CKS1 are smaller than wild-type littermates but appear otherwise normal (59). This phenotype has been traced to a direct role for Cks1 as a cofactor for the protein-ubiquitin ligase SCFSkp2, resulting in a deficiency in the degradation of the Cdk inhibitors p27Kip1, p21Cip1, and p130 in CKS1–/– animals (16, 19, 59). This function is specific for Cks1, since SCFSkp2 activity is not affected in CKS2–/– mice. The only reported phenotype associated with these animals is sterility of both males and females due to failure of germ cells to progress past the first meiotic metaphase (60). Interestingly, the sterility phenotype can be attributed to the germ line exclusion of CKS1 expression because the metaphase I arrest of CKS2–/– oocytes can be rescued by microinjection of CKS1 mRNA (60). This result suggests that the Cks1 and Cks2 proteins share one or more redundant functions, which is supported by the observation that both human CKS1 and CKS2 can complement a disruption of the single CKS1 gene in budding yeast (55).
We have undertaken two approaches to determine if Cks1 and Cks2 share a redundant function in mammalian cells. We have investigated the phenotype of CKS1–/– CKS2–/– doubly nullizygous mice and depleted mouse and human cell lines of Cks1 and Cks2 protein by small interfering RNA (siRNA)-mediated gene silencing. Doubly nullizygous mice die before implantation at the morula stage, suggesting a critical role at an extremely early point in embryogenesis. Consistent with an essential and fundamental role for Cks proteins in mammalian cells, cell lines depleted of Cks1 and Cks2 by RNA interference (RNAi) cease proliferation.
|
|
|---|
Genotyping. Genomic DNA was isolated from tail clips of E13.5 and E8.5 embryos (12), and the CKS1 and CKS2 genotypes were determined by PCR as described previously (59, 60). Blastocysts and morulae were washed three times in threefold-concentrated PCR buffer and digested with 45 µg/ml proteinase K for 90 min. After heat inactivation of proteinase K at 94°C for 30 min, the early embryos were genotyped by a nested PCR approach using primers BG47 (CTGTGGTTTCCAAATGTGTCA), BG71 (ATTCAAATCCAGAGCGTTGGGC), and BG72 (CCCGCAACACTACACAAAGCAA) in the first reaction. A fraction (1/25) of the first PCR mixture was added to the second PCR mixture, which was run with either primers BG48 (GTACTCGTAGTGCTCATCGAA) and BG49 (TTGGCCTCATTCGAGTCGTT) to amplify the CKS2 wild-type sequence or primers BG65 (CAAATGTGTCAGTTTCATAGC) and BG67 (TCATTCGAGTCGTTGCGTCGG) to amplify the CKS2 deletion construct.
Cells and culture conditions. CKS1–/– CKS2+/– and CKS1+/– CKS2–/– mouse embryonic fibroblasts (MEFs) were cultured from E13.5 embryos and immortalized by infection with an ecotropic retroviral vector expressing the human papillomavirus E6 oncoprotein (6). The retroviral particles were generated using the 293T-derived packaging cell line Phoenix-Eco (30). MEFs, HeLa cells, and HEK293A cells were grown in DMEM supplemented with 10% newborn calf serum (Gemini Bioproducts), 2 mM L-glutamine, 100 U/ml penicillin, and 100 U/ml streptomycin (Invitrogen) in a humidified incubator with 5% CO2-95% air mixture at 37°C.
RNAi and cyclin B1 expression. siRNA duplexes were synthesized by Dharmacon. To silence mouse or human Cks1 mRNA or Cks2 mRNA, Dharmacon SMARTpools were used. siRNA designed to target GFP mRNA (CAAGCUGACCCUGAAGUUC) was used as a control. Cells were transfected using Lipofectamine 2000 (Invitrogen Corporation) according to the protocol provided by the manufacturer. A final concentration of 42 nM was used for MEFs and 10.5 nM for HeLa cells. Cells were transfected 3 days and 1 day before being assayed. In some HeLa cell silencing experiments, short hairpin RNA (shRNA)-expressing adenoviruses based on a Mir30 microRNA backbone (46) were used instead of siRNAs. The cyclin B-expressing adenovirus utilized a tetracycline-regulated promoter, and therefore expression required a second adenovirus expressing the tetracycline transactivator (tTA) (27). For cyclin B1 bypass experiments, HeLa cells were split and 60,000 cells per plate were seeded in 6-cm petri dishes. On day 0 one triplicate set of plates was trypsinized and counted. The remaining cells were transduced with the following sets of adenoviruses: (i) empty vector control and tTA-expressing adenoviruses; (ii) empty vector control and tetracycline operator-cyclin B1- and tTA-expressing adenoviruses; (iii) empty vector control and tTA-, shRNA targeting Cks1 (shCks1)-, and shCks2-expressing adenoviruses; or (iv) tetracycline-cyclin B1-, tTA-, shCks1-, and shCks2-expressing adenoviruses. Transductions was carried out in DMEM supplemented with L-glutamine and antibiotics but without serum. After 2 hours DMEM with L-glutamine, antibiotics, and 20% newborn calf serum was added to achieve a final serum concentration of 10%. Total numbers of virus particles were normalized for every transduction using the empty vector. On day 1, one set of triplicates for each virus combination was counted and the remaining cells were transduced a second time as described above. On both day 2 and day 3 one set of triplicates was counted for each of the virus combinations. Relative cell numbers were normalized to the control-shCks population (set iii above), which was set at a value of 1.0 throughout the time course. This adjustment was necessary because, after two consecutive days of adenoviral transduction, it became impossible to trypsinize and count the cells without a systematic loss due their fragility, particularly on day 3, when we could easily observe cell number increases on plates, prior to harvesting, which were not adequately reflected in the postharvest counts. This was reflected in all populations independently of which viruses they received. The same result was obtained in three independent experiments.
Real-time PCR.
Total RNA was extracted from cells using RNeasy columns (Qiagen) according to the manufacturer's instructions. Total RNA (5 µg/ml) was reverse transcribed, amplified, and quantified using iQ Sybr green Supermix (Bio-Rad) and a Chromo4 real-time PCR detector (Bio-Rad). Each sample was run at least in triplicate. Primers used for amplification of all mRNAs can be obtained upon request. The expression levels of all analyzed mRNAs were determined relative to that of a control mRNA, using the formula 2CT(control mRNA) – CT(mRNA of interest)·10,000, where CT is the threshold cycle. β-Actin,
-actin, or GAPDH (glyceraldehyde-3-phosphate dehydrogenase) mRNAs were used as control mRNAs. Standard deviations (SD) of the relative expression values were calculated taking error propagation into account with the formula {[2–CT(mRNA of interest)·ln 2·2CT(control mRNA)]2·SDCT(control mRNA)2 + [2CT(control mRNA)·ln 2·2–CT(mRNA of interest)]2·SDCT(mRNA of interest)2}1/2·10,000.
Fluorescence imaging. For semiquantitative analysis of the DAPI (4',6-diamidino-2-phenylindole) staining, image data of the stained cells were collected using an Axioskop 2 microscope mounted with an AxioCam MRm monochrome charge-coupled device camera (both from Zeiss) coupled to a computer with AxioVision software (Zeiss). A mercury lamp, conventional microscope optics, and selective wavelength filters were used. A Zeiss Plan-Neofluar 63x/1.30-numerical-aperture oil immersion lens was employed to visualize the cells. Images at the DAPI wavelength were captured and analyzed using the AxioVision software. Nuclear segmentation was performed by hand, and the fluorescence intensity and area were measured using the software. For the control sample, cells with normal-size nuclei were imaged and the average of the total fluorescence intensity of the nuclei was normalized. For cells treated with Cks1 or cyclin B1 siRNA, cells judged as having normal-size nuclei and large nuclei, respectively, were imaged and the average intensity of the large nuclei was normalized to the average intensity of the normal-size nuclei (assuming they are equal to the normal-size nuclei of the control sample) to estimate the relative amount of DNA in the large nuclei. Ten to 20 cell nuclei were analyzed for each sample (i.e., 10 to 20 for normal-size nuclei and 10 to 20 for large-size nuclei).
Immunological procedures and reagents. Cell lysates were prepared using a Tris-HCl lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 10 mM Na PPi, 50 mM NaF, 50 mM Na3VO4, 1 mg/ml leupeptin, 1 mg/ml pepstatin, and 2 mg/ml aprotinin), and protein concentrations were determined using the Bradford protein assay (Bio-Rad). One hundred sixty to 200 µg denatured protein lysates was separated on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, transferred onto a polyvinylidene difluoride membrane (Immobilon P; Millipore), and immunoblotted with the following antibodies: a monoclonal antibody against cyclin B1 (GNS-1; BD Biosciences Pharmingen), a monoclonal antibody against Cdk sequence PSTAIRE (71), a polyclonal antibody against cyclin A2 (22), a polyclonal antibody against cyclin D3 and a monoclonal antibody against cyclin D1 (C-16 and D11; Santa Cruz Biotechnology Inc.), a polyclonal antibody against cyclin E1 (14), and a polyclonal antibody against β-actin (NB 600-503; Novus Biologicals).
Laser-scanning cytometry (LSC). Cells were grown to 50 to 80% confluence on 10-well immunofluorescence slides (Polysciences Inc.), fixed in –20°C methanol overnight, permeabilized in phosphate-buffered saline (PBS) containing 0.05% Triton X-100, and incubated with propidium iodide (PI) staining solution (0.2 mg/ml RNase A, 0.2 mg/ml PI, and 0.1% Triton X-100 in PBS) at 37°C for 45 min. After being mounted in antifading reagent (ProLong Gold; Molecular Probes), the PI-stained cells were analyzed using a CompuCyte laser-scanning cytometer equipped with a 20-mW argon ion air-cooled laser, a 5-mW He-Ne laser, and a DP11 digital camera (Olympus). Scanning was done using the 20x objective, and the PI fluorescence was used as the contouring parameter. DNA histograms were generated based on the DNA content measured in these cells.
Cell fractionation. 293A cells cross-linked for 1 minute in 0.5% formaldehyde were resuspended in 200 µl of ice-cold CSK-TX100 (20 mM HEPES, pH 7.5, 100 mM NaCl, 3 mM MgCl2, 300 mM sucrose, and 0.5% Triton X-100 plus protease and phosphatase inhibitors), incubated on ice for 15 min, and spun at 6,000 rpm for 5 min at 4°C. Supernatant was the soluble fraction. Pellets were washed once in 500 µl of ice-cold CSK-TX100, resuspended in 70 to 100 µl of ice-cold CSK-TX100, sonicated for 10 s using a Braun-Sonic tip sonicator, and centrifuged at 12,000 rpm for 10 min at 4°C. This supernatant was the soluble chromatin fraction.
Chromatin immunoprecipitation. 293A cells expressing Flag-tagged Cks2, as well as nontagged control cells, were grown asynchronously prior to harvest or were treated with thymidine (2 mM) for 24 h. Cells were harvested (S phase) or released from the thymidine block for 8 h and then harvested (G2). Enrichment in S phase or G2 was confirmed by fluorescence-activated cell sorter (FACS) analysis. After being harvested, cells were cross-linked by addition of formaldehyde to a final concentration of 0.5% for 10 min at room temperature. Glycine was then added to a final concentration of 125 mM for 5 min at room temperature. Cells were washed twice with ice-cold PBS, and pellets were snap-frozen in liquid nitrogen. Thawed cells were resuspended in 500 µl lysis buffer (50 mM HEPES, pH 7.5, 140 mM NaCl, 1% Triton X-100, 1 mM EDTA, and protease inhibitors), incubated on ice for 15 min, and sonicated 20 times for 30 s each with a Cup-Horn Sonicator 3000, with 2-min intervals between pulses. After centrifugation, lysates were incubated overnight at 4°C with agarose-coupled Flag antibody (Sigma) or RNA polymerase II C-terminal domain repeat antibody (8WG16; Abcam), followed by a 2-h incubation with protein A-coupled Dynabeads. Beads were washed twice with lysis buffer, twice with lysis buffer containing 0.5 M NaCl, twice with wash buffer (10 mM Tris, pH 8.0, 250 mM LiCl, 0.75% NP-40, 0.75% Triton X-100, 1 mM EDTA, and protease inhibitors), and once with TE (10 mM Tris, pH 7.5, 1 mM EDTA). Bound proteins were eluted with 100 µl elution buffer (50 mM Tris, pH 8.0, 10 mM EDTA, 1% sodium dodecyl sulfate) for 30 min at 65°C. DNA-protein cross-links were reversed by overnight incubation at 65°C, and DNA was purified using a QIAquick PCR purification kit (Qiagen), in accordance with the manufacturer's instructions. Real-time PCRs were performed using 1/25 of the immunoprecipitation fraction or 1/500 of the input fraction as the template. Primer sequences are available upon request. The control primers amplify a nontranscribed region on human chromosome 19 (62). The amount of DNA immunoprecipitated as related to the amount of input DNA was calculated for the different genomic regions and then normalized to that for the control region.
|
|
|---|
|
View this table: [in a new window] |
TABLE 1. Genotypes and numbers of progeny of Cks1–/– Cks2+/– intercrosses at different developmental stages
|
![]() View larger version (106K): [in a new window] |
FIG. 1. Micrographs of morulae of each genotype obtained from CKS1–/– CKS2+/– intercrosses. The genotype represented in each row is shown on the left.
|
![]() View larger version (19K): [in a new window] |
FIG. 2. Depletion of Cks proteins leads to a cessation of proliferation. (a) Cks1 and Cks2 silencing. CKS2–/– CKS1+/– (left) or CKS1–/– CKS2+/– (right) MEFs were transfected with either Cks1-specific siRNA or Cks2-specific siRNA, respectively, or control (GFP) siRNA. Cells were transfected twice at 48-hour intervals, and then RNA was prepared for real-time PCR 24 h after the second transfection. Bars indicate the levels of Cks1 mRNA (left) and Cks2 mRNA (right). (b) CKS2–/– CKS1+/– MEFs transfected as in panel a were counted beginning 24 h after the second transfection. The asterisks mark a third transfection 96 h after the second transfection. (c) Control for off-target effects of Cks1-specific siRNA transfection. CKS1–/– CKS2+/– MEFs were transfected with Cks1-specific siRNA, and cells were counted as for panel b. (d) Simultaneous Cks1 and Cks2 silencing in HeLa cells. Cells were transfected and real-time PCR analysis was carried out as for panel a. (e) HeLa cells silenced for Cks1 and Cks2 were counted beginning after the second transfection.
|
In parallel, simultaneous siRNA-mediated depletion of Cks1 and Cks2 was carried out in HeLa cells (Fig. 2d). As was the case with MEFs, HeLa cells significantly depleted of Cks1 and Cks2 ceased proliferation (Fig. 2e). However, unlike MEFs silenced for Cks1 and Cks2, a significant level of apoptosis was detected based both on TUNEL and FACS analysis (data not shown).
Depletion of Cks protein in MEFs leads to G2 arrest and polyploidy.
Since Cks-depleted cells ceased proliferation, we sought to determine whether this was due to a block at a particular cell cycle phase. CKS2–/– CKS1+/– MEFs silenced for Cks1 were analyzed for distribution within the cell cycle by LSC. Whereas the control population did not change its cell cycle distribution over the 4-day time course, the Cks-depleted populations showed a consistent and progressive increase in 4C and >4C regions of their distributions (Fig. 3a). Concomitantly, a complementary decrease in the 2C (G1) region was observed. These data are consistent with depletion of Cks protein conferring arrest in G2 or M phase followed by rereplication without division, leading to polyploidy. As there was no observed accumulation of rounded mitotic cells (data not shown), it can be inferred that depletion of Cks proteins in MEFs leads to cell cycle arrest in G2. Over time, these G2-arrested cells appear to be capable of undergoing an additional round of DNA replication, becoming tetraploid. The LSC data indicating polyploidy are consistent with microscopic observation of increasing numbers of cells with very large nuclei in the Cks-depleted populations (Fig. 3b). When the enlarged nuclei were counted manually, the level was found to be significantly larger (60%) than that determined by LSC (Fig. 3c). To confirm that the scoring of nuclei as "large" corresponded to an increased DNA content, images of nuclei were quantitated by determining the area of the optical section and the average DAPI staining intensity. Compared to typical nuclei in the control population or nuclei scored as "not large" in the Cks-depleted population, the nuclei scored as large had an average increase in cross-sectional DNA content of approximately 5.5-fold (Fig. 3d). This is likely an underestimate of the increase in nuclear DNA content due to the two-dimensional nature of the analysis. Another indicator of polyploidy occurring by failure to undergo division is increase in centrosome number. When control and Cks-depleted populations were compared for numbers of centrosomes by staining with an antibody to
-tubulin, a significant increase in cells containing more than two centrosomes in the Cks-depleted population was found (Fig. 3e). Taken together, these data suggest that, whereas control-transfected cells undergo a normal cell cycle, where cell division follows chromosome duplication, Cks-depleted cells arrest transiently in G2 after chromosome duplication and then undergo another round or multiple rounds of chromosome duplication without division, thereby increasing in ploidy. The reproducible discrepancy between the LSC data and the manual counts with respect to the percentage of polyploid cells most likely results from the irregular lobular shape of many of the Cks-depleted nuclei (Fig. 3b). The logic circuit in the LSC software for distinguishing closely spaced objects most likely scores these as two individual nuclei.
![]() View larger version (29K): [in a new window] |
FIG. 3. Cell cycle and ploidy analysis of populations depleted for Cks proteins. CKS2–/– CKS1+/– MEFs were transfected with Cks1-specific, cyclin B1-specific, or GFP-specific siRNA twice, separated by 48 h. (a) At 24-hour intervals after the second transfection, slides were fixed, stained with PI, and analyzed for DNA content by LSC. The polyploid population was determined as all cells of >4C DNA content. Error bars represent standard errors. (b) Examples of large nuclei that accumulate in the Cks-silenced population. Typical nuclei in the control-transfected population are shown in the top row. Large nuclei apparent at high frequency in the Cks-silenced population are shown in the bottom row. Bar, 5 µm. All micrographs are at the same magnification. (c) Manual scoring of cells with large nuclei based on DAPI staining at the indicated times after the second transfection using GFP, Cks1, or cyclin B1 siRNAs. Three hundred cells were scored for each of three experiments for each siRNA. Error bars represent standard errors. (d) Estimation of relative DNA content of large nuclei 72 h posttransfection. DAPI staining of nuclear optical sections was determined by measuring both the sectional area and the average staining intensity. For the GFP siRNA control, only apparently normal-size cells were scored and the average was set to 1.0. For the Cks1- and cyclin B1-silenced populations, separate determinations were made for cells scored as normal and those scored as large in panel c. The ratios given are the averages of large nuclei divided by the averages of small nuclei. For each determination, 10 to 20 nuclei were analyzed. The nuclei scored as normal in the GFP control population had a DNA content similar to that of nuclei scored as normal in the Cks1- and cyclin B1-silenced populations. Error bars correspond to standard errors. (e) Determination of centrosome number 72 h after siRNA transfection. Cells transfected with the indicated siRNAs were stained with -tubulin-specific antibody and, centrosomes in each cell were counted by immunofluorescence microscopy. Two hundred cells were scored for each of three experiments for each siRNA. Error bars correspond to standard errors.
|
![]() View larger version (23K): [in a new window] |
FIG. 4. Analysis of cell cycle-regulatory proteins in Cks-depleted populations. CKS2–/– CKS1+/– MEFs were silenced for Cks1 twice, separated by 48 h, after which cell extracts were prepared at the indicated times after the second transfection and levels of cell cycle-regulatory proteins were analyzed by immunoblotting. β-Actin was used as a loading control.
|
![]() View larger version (27K): [in a new window] |
FIG. 5. Analysis of cyclin B1, Cdk1, and cyclin A2 transcript levels in Cks-depleted cells. (a) CKS2–/– CKS1+/– MEFs were silenced for Cks1 twice at 48-hour intervals, and 24 h later the indicated transcript levels relative to actin transcript levels were analyzed by real-time PCR. (b) Cell cycle analysis of populations depleted for cyclin B1. CKS2–/– CKS1+/– MEFs were transfected with cyclin B1-specific and GFP-specific siRNA twice, separated by 48 h. At 24-hour intervals after the second transfection, slides were fixed, stained with PI, and analyzed for DNA content by LSC. The polyploid population was determined as all cells of >4C DNA content. (c, left) Normalization for cell cycle effects was carried out by comparing transcript levels in Cks-depleted MEFs to transcript levels in cyclin B1-depleted MEFs. (Right) Comparison of cyclin B1, Cdk1, and cyclin A2 transcript levels in CKS2–/– CKS1+/– MEFs silenced for Cks1 alone or Cks1 and cyclin B1. (d, left) HeLa cells were silenced twice for Cks1 and Cks2, separated by 48 h, and 24 h later Cks1 and Cks2 levels were determined by real-time PCR. (Right) The same experiment, but the indicated transcript levels relative to actin levels were analyzed by real-time PCR.
|
Ectopic expression of cyclin B1 can rescue the proliferation phenotype conferred by RNAi-mediated Cks protein depletion. Since RNAi-mediated depletion of cyclin B1 confers a cell cycle phenotype similar to that observed upon Cks protein depletion, we determined whether ectopic expression of cyclin B1 could restore proliferation in Cks-depleted HeLa cells. HeLa cells were transduced with recombinant shRNA-expressing adenoviruses simultaneously targeting CKS1 and CKS2. One population was also transduced with a recombinant adenovirus expressing human cyclin B1 (27), while the other was transduced with a control adenovirus. Cks protein-depleted HeLa cells continued to proliferate if cyclin B1 was ectopically expressed, but not when transduced with control virus (Fig. 6). In addition, it was observed that both populations ectopically expressing cyclin B1 proliferated more slowly than control populations without cyclin B1 expression. This is most likely due to inhibitory effects of cyclin B1 deregulation on mitotic progression (18, 26, 29). The level of cyclin B1 mRNA elevation was approximately 10-fold, as determined by real-time PCR. However, the relative level in mitotic cells was probably significantly lower, since endogenous cyclin B1 mRNA is highly regulated and peaks at mitosis whereas the ectopic cyclin B1 mRNA is not regulated and is therefore expressed throughout the cell cycle. Nevertheless, because of the toxic effect of unregulated overexpression of cyclin B1, it was not possible to determine whether a complete rescue of Cks silencing was achieved. This result was obtained in three independent experiments. Therefore, cyclin B1 expression is most likely the limiting Cks protein-dependent function required for proliferation of MEFs.
![]() View larger version (11K): [in a new window] |
FIG. 6. Ectopic expression of cyclin B1 can rescue the proliferation defect associated with RNAi-mediated depletion of Cks proteins. HeLa cells were transduced simultaneously with Cks1- and Cks2-specific shRNA adenovirus or control (ctrl; empty vector) as well as a second set of recombinant adenoviruses (human cyclin B1 or empty vector). Cells were transfected both at day 0 and day 1. Cell counts were carried out beginning on day 0. Data are presented as relative increases in cell number. Error bars represent standard errors of the means. Levels of silencing of Cks1 and Cks2 mRNAs on day 3 were 92% and 75%, respectively. Cells transduced with cyclin B1-expressing adenovirus exhibited a 10-fold elevation of cyclin B1 mRNA throughout the time course.
|
![]() View larger version (27K): [in a new window] |
FIG. 7. Cks2 associates with the CCNB1 and CDK1 promoters and ORFs in a cell cycle-regulated manner. (a) Chromatin fractionation of HEK293A cells stably expressing Flag-Cks2 by retroviral transduction. Immunoblotting was carried on the soluble fraction (lane Sol) and insoluble chromatin-enriched fraction solubilized by sonic disruption (lane Chr). Histone H3 is a marker for chromatin proteins; -tubulin is a marker for soluble proteins. (b) Chromatin immunoprecipitation of Flag-Cks2 at the CCNB1 promoter (CCB_Pr) and ORF and the CDK1 ORF in G2-enriched populations of HEK293A cells arrested by thymidine block and released for 8 h (G2 enriched). The cells stably transduced with a retrovirus expressing Flag-Cks2 were compared to untransduced controls. Real-time PCR values are normalized to input. In this experiment, two different primer sets (Pr and Pr2) corresponding to the CCNB1 promoter region were used. (c) Chromatin immunoprecipitation of Flag-Cks2 and RNA polymerase II at the CCNB1 and CDK1 promoters and ORFs. Populations of Flag-Cks2 HEK293A cells arrested by thymidine block (S enriched) and released for 8 h (G2 enriched), respectively, were analyzed by ChIP and real-time PCR. Values given are normalized to the signal corresponding to a nontranscribed region on chromosome 19 from the same immunoprecipitates. Error bars correspond to 1 standard deviation. (d) ChIP of Flag-Cks2 and RNA polymerase II at the CCND3 and GAPDH promoters and ORFs. The same chromatin immunoprecipitates as in panel c were analyzed using primers corresponding to the CCND3 and GAPDH promoters and ORFs.
|
|
|
|---|
The link between cyclin B1 downregulation, G2 arrest, and polyploidy. The cyclin B1-Cdk1 protein kinase, also known as mitosis promoting factor (MPF), comprises the activity that drives eukaryotic cells into mitosis (13). Genetic studies of both yeast and mammalian cells, as well as studies with chemical inhibitors (67), indicate that this activity is essential for mitosis and that without it cells cannot progress past the G2 phase of the cell cycle (13, 42, 54, 64, 67). The G2 arrest conferred by siRNA-mediated silencing of CKS genes and concomitant failure to express cyclin B1, therefore, is consistent with the requirement of cyclin B1 for entry into mitosis. Indeed, we could show that ectopic expression of cyclin B1 could rescue the proliferation defect conferred by CKS gene silencing, supporting this interpretation. It has also been shown both in yeast and mammalian cells that inhibition or inactivation of cyclin B-Cdk1 results in the accumulation of polyploid cells (4, 8, 21, 25, 41). Presumably this phenomenon is a direct consequence of the requirement for high levels of Cdk activity for preventing prereplication complex assembly (also known as replication origin licensing) (11). Under normal circumstances, this mechanism restricts origin licensing and replication to one round per cell cycle, as Cdk activities remain high from the beginning of S phase until the end of mitosis. It has been shown in yeast, however, that if cyclin B-Cdk1 activity is inhibited after one round of replication but before cell division, origins are relicensed, leading to another round of replication and polyploidy (4, 8, 21). Therefore the induction of polyploidy as a result of CKS gene silencing, like the observed G2 arrest, is likely a direct consequence of impairment of cyclin B1 and Cdk1 expression. This conclusion is consistent with our observation of G2 arrest and polyploidy in cells silenced for cyclin B1 by RNAi. Although we did not carry out cell cycle or ploidy analysis of failing CKS1–/– CKS2–/– embryos, the abnormally large size of many of the embryonic cells suggests that they exhibited a phenotype similar to that of Cks-depleted somatic cells in culture, namely, G2 arrest and polyploidy.
Impairment of CCNB1, CCNA2, and CDK1 transcription by CKS gene silencing. Analysis of yeast has revealed that Cks1 and Cdk1 have a direct role in transcription of a significant number of genes (72). This function does not require the kinase activity of Cdk1 but instead involves the recruitment of proteasomes to chromatin of actively transcribed genes (72). Although the precise function of proteasomal recruitment in the context of transcriptional elongation is not well understood, preliminary evidence suggests that at least in yeast the function of the Cks1-Cdk1-proteasome complex is to reduce nucleosome density in order to facilitate transcriptional elongation of induced genes (S. R. Chaves, V. Yu, and S. I. Reed, unpublished data). In the context of CCNB1 and CDK1 transcription in mammalian cells, we have shown that Cks2 (Cks1 was not analyzed) and Cdk1 generally associate with chromatin and that Cks2 is recruited to the CCNB1 promoter in a cell cycle-specific fashion that correlates with active transcription (Fig. 7). Although we do not yet know whether Cdk1 and the proteasome are similarly recruited, it is tempting to speculate that the Cks dependency of CCNB1, CCNA2, and CDK1 transcription represents conservation of a fundamental proteasome-mediated chromatin-remodeling pathway. Indeed, all three genes share a common regulatory mechanism in that transcription is primarily controlled by a cell cycle-dependent repression element known as CHR (34, 51, 73, 74). Relief of repression at the appropriate time in the cell cycle allows the binding of a constitutive positive transcription factor, NF-Y (5, 35). It is possible the Cks proteins are involved in establishing an open chromatin environment permissive for NF-Y binding.
Cks proteins and cancer. Although the functions of Cks proteins have remained elusive, tumor profiling has revealed that both Cks1 and Cks2 are frequently overexpressed, at least at the mRNA level, in a variety of human malignancies (7, 9, 10, 24, 28, 31, 33, 36, 40, 44, 45, 56-58, 61, 65, 70). Furthermore, in one large breast cancer study, overexpression of Cks2 was particularly associated with aggressive disease and poor patient outcome (66). Although the link between Cks protein overexpression and cancer is unknown at this point, it is tempting to speculate, based on the data presented in this report, that it involves perturbations to normal cellular gene expression.
This work was supported by the National Institutes of Health grant CA74224 to S.I.R.; fellowships of the Susan G. Komen Breast Cancer Foundation, Roche Foundation, Novartis Jubiläumsstiftung, and Swiss Foundation for Medical-Biological Grants to B.G.; fellowships from the Lance Armstrong Foundation and U.S. Department of Defense to V.L.; a fellowship from the Lance Armstrong Foundation to S.R.C.; and a fellowship from the Leukemia and Lymphoma Society of America to C.H.S.
Published ahead of print on 14 July 2008. ![]()
Both authors contributed equally. ![]()
Present address: Novartis Pharma AG, Postfach 4002, Basel, Switzerland. ![]()
Present address: The Sydney Kimmel Cancer Center, 10835 Road to The Cure, San Diego, CA 92121. ![]()
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»