| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||

David K. Han, and
Kevin P. Claffey*
Center for Vascular Biology, University of Connecticut Health Center, Farmington, Connecticut 06030-3501
Received 7 November 2006/ Returned for modification 4 December 2006/ Accepted 1 November 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
VEGF expression under hypoxia also requires posttranscriptional mRNA stability and mRNA transport mechanisms. VEGF mRNA is highly labile under normal oxygen and nutrient conditions (3, 5, 17) and is mediated through AU-rich elements (AREs) in the 3' untranslated region (3'-UTR) (5). A consensus destabilization motif (AUUUA) occurs eight times in the human VEGF 3'-UTR, which is 1.6 kb in length (3). ARE-binding proteins such as AUF1 and tristetraprolin (TTP) have all been shown to destabilize mRNAs in various mammalian cell types (2, 4, 11, 40, 44). In addition to their destabilization effects, ARE elements can contribute to mRNA stabilization through interactions with the ELAV family of RNA-binding proteins, which includes Hel-N1, HuC, HuD, and HuR (7, 19, 22, 30). Interestingly, poly(A)-binding protein has been predominantly a stabilizing factor for polyadenylated mRNAs; however, recent investigations suggest that it may also have destabilizing effects (2, 11, 26). Hypoxia-induced mRNA stability has been shown to be a mechanism that can facilitate VEGF expression in tumors even without HIF-1 transcription (32). The identification of 3'-UTR elements in VEGF which promote mRNA stability has determined that AU-rich regions also confer hypoxia-dependent mRNA stability (3, 10, 24). The RNA-binding proteins that interact with these 3'-UTR elements include HuR, hnRNP A1, hnRNP L, poly(A)-binding protein, PAIP2, and TI5IId, according to literature reports (23). HuR and hnRNP L are predominantly nuclear proteins that have the capacity to shuttle between nuclear and cytoplasmic compartments, especially under hypoxic conditions (6, 13, 18, 31). Previous identification of a predicted stem-loop structure in the 3'-UTR of VEGF mRNA showed that this element can provide hypoxia-induced stability to a heterologous mRNA (3). Cross-linking and affinity purification experiments identified both HuR and hnRNP L as RNA-binding proteins for this hypoxia stability region (HSR) element (36). An additional protein with an apparent molecular mass of 90/88 kDa was also found to cross-link to the HSR 126-bp 3'-UTR stem-loop RNA under hypoxic conditions but has not been identified to date (3).
VEGF protein synthesis under hypoxic conditions also requires 5'-UTR mRNA elements to maximize expression. In the case of VEGF, the 5'-UTR contains predicted internal ribosome entry sites that facilitate mRNA loading onto ribosomes and efficient translation (15, 27, 39). These sequences are G/C-rich, have a predicted secondary structure that makes the translation start site accessible, and have been shown to confer increased expression of chloramphenicol acetyltransferase (43) reporter protein under hypoxia in HeLa cells (39). In a recent analysis of translational control mechanisms, eIF-4F initiation complexes were found to be disrupted under conditions of hypoxia (42). This would dictate that 5'-cap-dependent translation would be blocked and that mRNAs with internal ribosome entry site sequences would be preferentially translated under hypoxia. The increased association of carbonic anhydrase IX (CAIX) mRNA with polysomes was demonstrated in prolonged hypoxia up to 16 h, suggesting that mRNA shuttling and loading mechanisms are also important for hypoxia-dependent gene expression (20).
In this study, a 90- to 88-kDa protein complex that binds to the VEGF HSR 3'-UTR A/U-rich stem-loop element that confers hypoxia-dependent mRNA stability was identified. Affinity purification and proteomic analysis revealed that the characteristics of this protein complex were consistent with those of the double-stranded RNA-binding protein-interleukin enhancer binding protein factor-3/nuclear factor family of alternatively spliced DRBPs. One of these alternatively spliced proteins, double-stranded RNA-binding protein 76/NF90 (DRBP76/NF90), was found to contribute to VEGF expression under hypoxia, and silencing its expression reduced VEGF mRNA and protein levels. The role for DRBP76/NF90 in VEGF mRNA and protein synthesis under hypoxic conditions and in tumor progression was evaluated, and DRBP76/NF90 was shown to significantly contribute to hypoxia-induced VEGF expression and tumorigenesis in vivo in a breast carcinoma model.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell harvest and lysis. Following exposure to normoxia or hypoxia, conditioned media were collected and centrifuged at 14,000 x g for 10 min and supernatants stored at –80°C. Cells were washed three times with cold phosphate-buffered saline (PBS) and lysed in 1% Triton lysis buffer (1% Triton X-100, 50 mM HEPES [pH 7.5], 10 mM sodium pyrophosphate, 150 mM NaCl, 100 mM NaF, 0.2 mM sodium orthovanadate, 1 mM EGTA [pH 7.5], 1.5 mM MgCl2, 10% glycerol, and protease inhibitor cocktail [10 µl/ml] [Sigma]), disrupted by pipetting, and incubated on ice for 10 min. The lysates were separated by centrifugation at 14,000 x g for 10 min at 4°C and supernatants frozen at –80°C. Non-Triton-soluble fractions (crude nuclear pellets) were extracted with radioimmunoprecipitation assay (RIPA) buffer (1% NP-40, 0.1% sodium dodecyl sulfate [SDS], and 1% deoxycholate in PBS). Total cell lysates were provided by direct lysis with 5 volumes of RIPA buffer after three initial PBS washes.
Protein concentrations were determined using a Bio-Rad DC protein assay (Bio-Rad Inc.) according to the manufacturer's instructions, with bovine serum albumin as a standard protein.
Cell fractionation. Cells were washed twice in cold PBS and collected with a cell scraper in NP-40 lysis buffer (0.5% NP-40, 50 mM HEPES [pH 7.5], 10 mM sodium pyrophosphate, 150 mM NaCl, 100 mM NaF, 0.2 mM sodium orthovanadate, 1 mM EGTA [pH 7.5], 1.5 mM MgCl2, 10% glycerol, and protease inhibitor cocktail [Sigma] [10 µl/ml[). The NP-40 lysate was transferred to a Dounce homogenizer and further lysed using 10 strokes, incubated for 10 min on ice, and centrifuged at 3,000 x g for 10 min at 4°C. The crude nuclear pellets (after centrifugation at 3,000 x g) were salt extracted in lysis buffer (minus NP-40) with 0.25 M KCl by incubation for 30 min at 4°C and centrifugation at 13,000 x g for 20 min at 4°C, and supernatants were stored at –80°C (for nuclear extracts). The supernatant initially centrifuged at 3,000 x g was centrifuged at 20,000 x g for 30 min at 4°C and the supernatants (cytoplasmic and light membrane fractions) stored at –80°C. For affinity purification experiments, the supernatant initially centrifuged at 20,000 x g was centrifuged at 100,000 x g for 1.5 h at 4°C to obtain a primarily cytoplasmic soluble fraction without membranes.
RNA binding and UV cross-linking. RNA binding and UV cross-linking were performed as described previously (3). Briefly, 100 ng biotin-UTP-VEGF 3'-UTR 126-bp HSR RNA (5'-AGACACACCCACCCACATACATACATTTAT ATATATATATATTATATATATATAAAAATAAATATCTCTATTTATAT ATATAAAATATATATATTCTTTTTTTAAATTAACAGTGCTAATGTTA TT-3'), no RNA, or the HSR combined with the total VEGF 3'UTR or a control VEGF 3'-UTR sequence (CTRL1) (5'-GATGTATTTGACTGCTGTGGACT TGAGTTGGGAGGGGAATGTTCCCACTCAGATCCTGACAGGGAAGA GGAGGAGATGAGAGACTCTGGCATGATCTTTTTTTTGTCCCACTTG GTGGGGCCAGGGTCCTCTCCCCTGCCCAAGAATGTGCAAGGCCAG GGCATG-3') was incubated with 40 µg hypoxic 100,000 x g supernatant cell extract in up to 30 µl of RNA binding buffer, with or without 0.5% Triton X-100, containing 20 mM HEPES (pH 7.5), 5 mM MgCl2, 50 mM KCl, 0.5 mM EGTA (pH 7.5), 0.5 mM dithiothreitol, 10% glycerol, and fresh tRNA (0.067 mg/ml) (Sigma). The mixture was incubated for 20 min at 30°C and then UV cross-linked in a UV Stratalinker crosslinker (Stratagene, La Jolla, CA) for 15 min at room temperature. Streptavidin Magna beads were added and incubated on a rocker platform for 15 min at room temperature. Beads were magnetically separated and unbound protein was collected, the Magna beads were washed with PBS three times, and the bound protein was incubated with 1 µl of RNase T1 and 1 µg of RNase A for 10 min at room temperature. The sample was then denatured in SDS-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer under reducing conditions and separated with 10% SDS-PAGE and transferred to nitrocellulose. The blots were developed to detect biotin by use of streptavidin-horseradish peroxidase (streptavidin-HRP) conjugate (Sigma) and developed with Lumiglo substrate (K&P, Inc.) by use of BioMax LS film (Eastman Kodak) or imaged on a Kodak 2000MM multimodal imager.
Immunoblot analysis. Monoclonal antibody to human DRBP76 was used to detect DRBP76/NF90 and interleukin promoter enhancing factor 3 (ILF3)/NF110 (Transduction Laboratories). Immunoblottings were performed using a 1:1,000 dilution of anti-DRBP76 monoclonal antibody followed by a 1:3,000 dilution of HRP-conjugated goat anti-mouse immunoglobulin G (Amersham Pharmacia Biotech) in a blocking buffer containing either 5% bovine serum albumin or 5% nonfat milk and 0.1% Tween 20 in Tris-buffered saline. The blots were then developed using Lumiglo substrate (K&P, Inc.) on BioMax LS film (Eastman Kodak) or on a Kodak MM2000 multimodal imager.
Northern blot analysis.
Total RNA was extracted using an RNeasy RNA extraction kit (Qiagen, Chatsworth, CA). Northern blot analysis was performed as described previously (3). Hybridization was carried out overnight at 65°C with [
32P]dCTP-labeled human VEGF 165 AccI/NcoI fragment (823 bp). A ribosome-associated protein cDNA probe, 36B4, was used as a loading control. Blots were washed at high stringency (1% SDS, 1x SSC [1x SSC is 0.15 M NaCl plus 0.015 M sodium citrate] at 60°C) and exposed to Kodak MR film. Quantification was determined by densitometry using ImageQuant software.
Quantitative and qualitative RT-PCR. Reverse transcription (RT) was carried out with random hexamers as primers following the protocol of the manufacturer (Invitrogen). PCR amplification was carried out with Taq DNA polymerase or proofreading Platinum Pfx polymerase (Invitrogen). The qualitative PCR primers for three alternatively spliced VEGF isoforms as described were as follows: forward primer, 5'-ATGCGGATCAAACCTCACC-3'; reverse primer, 5'-ATCTGGTTCCCGAAACCCTG-3'. The GAPDH primers used were as follows: forward primer, 5'-CCACCCATGGCAAATTCCATGGCA-3'; reverse primer, 5'-TCTAGACGGCAGGTCAGGTCCACC-3'. All qualitative RT-PCR analyses were repeated at least twice to assure identical results. PCR products were resolved on a 0.75% agarose electrophoresis gel containing ethidium bromide and with Tris-acetate-EDTA buffer and imaged with the Kodak 2000MM multimodal imager. Quantitative RT-PCR (qRT-PCR) was performed as described previously (28). All quantitative analyses were performed in triplicate and normalized to human cyclophilin A or 36B4/RPLP0 (NCBI accession number NM_053275) values for each sample. The qRT-PCR primers used were as follows: cyclophilin A forward primer, 5'-CTGGACCCAACACAAATGGTT-3'; cyclophilin A reverse primer, 5'-CCACAATATTCATGCCTTCTTTCA-3'; DRBP76/NF90 forward primer, 5'-AACCATGGAGGCTACATGAAT-3'; DRBP76/NF90 reverse primer, 5'-CGCTCTAGGAAGACCCAAAATC-3'; ILF3/NF110 forward primer, 5'-GGCTCCTACTACCAAGGTGACAACT-3'; ILF3/NF110 reverse primer, 5'-TTATAGCCTTTCTGCTTGCCCT-3'; VEGF (all spliced forms) forward primer, 5'-CGAGGGCCTGGAGTGTGT-3'; VEGF reverse primer, 5'-GGCCTTGGTGAGGTTTGATC-3'; murine PECAM-1/CD31 forward primer, 5'-CAAGAGAAGCGGCCTGGGTAC-3'; murine PECAM-1/CD31 reverse primer, 5'-TTTTCGGACTGGCAGCTGAT-3'; RPLP0/36B4 (the ribosome-associated protein) forward primer, 5'-TCCTCGTGGAAGTGACATCGT-3'; RPLP0/36B4 reverse primer, 5'-CTGTCTTCCCTGGGCATCA-3'.
RNA interference. RNA interference oligonucleotides were designed using a gene-specific application (Design Center; Dharmacon) and synthesized as the following small interfering RNA (siRNA)-ready double-stranded RNA hybrids: ILF3 siRNA (5'-NNGGAUGUUGUCACAGCUAGU-3'), DRBP76 siRNA (5'-NNCAGCGUUGUUCGGCAUCAA-3'), and VEGF siRNA (5'-AACGAACGUACUUGCAGAUGU-3'). siRNAs were transfected into cells using Oligofectamine (Invitrogen) according to the manufacturer's protocol. Primary experiments with a dose-response curve evaluated optimal doses for transfection efficiency. Transiently transfected cells were allowed to recover for 24 h and were then incubated for 24 or 48 h under normoxic or hypoxic conditions. Cell-conditioned media were collected at the time of harvest, and cells were lysed in 1% Triton X-100 lysis buffer as described above. RNA was recovered from one-third of the Triton X-100 cellular lysate by use of an RNeasy kit (Qiagen). Protein (30 to 70 µg) was resolved on a 10% SDS-PAGE gel under reducing or nonreducing conditions and analyzed by immunoblotting for DRBP76NF90 and ILF3/NF110, with β-actin (Abcam, Cambridge, MA) as a loading control. The extracted RNA was run on a Northern blot and probed for VEGF mRNA by use of established protocols (3).
Stable small hairpin vector synthesis and cell selection. pSilencer 2.1-U6 neo vector (Ambion) was used as a base vector and modified to express green fluorescent protein (GFP) as follows: a fragment containing the cytomegalovirus (CMV) promoter and ZsGreen (Clontech) cDNA and an existing DRBP76/NF90 or ILF3/NF110 hairpin fragment were digested from pSirenRetroQ hairpin vector (Clontech) by use of BamHI and EcoRV digestion and ligated into the BamHI and BSAXI sites in pSilencer 2.1 U6-neo vector. The hairpin fragment sequence used for DRBP76/NF90 (developed using standard loop hairpin rules as suggested for pSirenRetroQ) was 5'-GATCCGCAGCGTTGTTCGGCATCAATTTTCAAGAGAAATTGAAGCCGAACAACGCTGCGGATCTTTTTT- 3'. Bacterial cells were transformed and selected with ampicillin. Vectors showing positive results were confirmed by direct sequencing, and MDA-MB-435 cells were transfected using Lipofectamine 2000 (Invitrogen). Cells were selected with 1 mg/ml Geneticin sulfate (G418) for at least four cell passages, and stable G418-resistant cells were then selected by cell sorting for maximal ZsGreen expression by use of a FACS 440 cell sorter.
Polysome isolation and analysis. Polysomes were isolated as previously described (21). MDA-MB-435 cells were grown to 90% confluence and subjected to 24 h of normoxia or hypoxia. Cells were treated with 0.1 mg/ml cycloheximide (CHX) for 3 min in normoxia or hypoxia and washed three times with PBS-CHX and then lysed with Triton X-100 (0.1%) buffer supplemented with 0.1 mg/ml CHX. Lysates were centrifuged at 10,000 x g, heparin (200 µg/ml) was added, and the lysates were recentrifuged. The lysate was layered on a 10 ml continuous sucrose gradient (20 to 50% sucrose in 15 mM MgCl-15 mM Tris [pH 7.4]-0.3 M NaCl) and centrifuged for 120 min at 190,000 x g in an SW41-Ti rotor at 4°C. Absorbance was read at 260 nm and 280 nm in 0.5 ml fractions. Fractions were processed for RNA isolation using a Qiagen RNeasy kit (Qiagen, Inc.) according to the manufacturer's protocol. Quantitative RT-PCR was performed as indicated above using human VEGF and ribosome-associated protein (36B4/RPL0) as a control. VEGF mRNA levels normalized to 36B4/RPL0 were determined for each fraction.
ELISA. A human VEGF sandwich enzyme-linked immunosorbent assay (ELISA) was performed according to a protocol used previously (37). VEGFs in conditioned media were normalized to the total protein extracted from wells by use of RIPA lysis buffer and quantification with a Bio-Rad DC protein assay kit (Bio-Rad).
Luciferase assay. MDA-MB-435S and MDA-MB-435 shDRBP76-GFP cells were transfected using a 5x HIF-1 promoter element luciferase reporter (3), luciferase control vector, or CMV-driven β-galactosidase vector and Lipofectamine 2000 (Invitrogen). Cells were recovered overnight and treated under either normoxia or hypoxia conditions for 24 h. Cells were harvested with a passive lysis buffer from an assay kit, and luciferase activity was measured according to the instructions of the supplier (Promega, Madison, WI). Luciferase activity was normalized to β-galactosidase expression as determined with a similar kit (Promega), and activity was normalized using total protein extracts.
Human orthotopic xenograft breast cancer model. Procedures for a xenograft tumor model were performed as previously described (1) using the MDA-MB-435-GFP cell line described previously (1, 38) and the shDRBP76-GFP described above. Cells (1 x 106) were injected subcutaneously in the mammary fat pad of female athymic (nu/nu) mice, and tumor growth was determined by external caliper measurements of tumor and calculated as width2 x length x 0.52 to approximate an ellipsoid structure. At harvest, tumors were divided into sections for immunohistochemical and molecular analysis. One third of the tumor was processed and embedded in paraffin. One third of the tumor was mechanically homogenized with a Tissuemiser (Fisher Scientific) in RNA lysis buffer and processed with an RNeasy kit (Qiagen). The remaining third of the tumor was embedded in optimal cutting medium and frozen at –80°C. Cryosectioning and hematoxylin and eosin staining were used to identify viable areas of the tumor, and those areas were excised from the frozen optimal cutting medium block using a 2 mm dermal biopsy core. Sample were processed for immunoblot analysis by homogenization with 1% Triton X-100 protein lysis buffer, incubated on ice for 10 min, and centrifuged at 14,000 x g for 10 min.
Immunohistochemistry. Paraffin-embedded tumor sections were postfixed and used for immunohistochemical analyses with antibodies to platelet endothelial cell adhesion molecule PECAM-1 (Pharmingen, San Diego, CA) and Ki67 (DakoCytomation) and for apoptosis using an ApopTag terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) kit (Intergen, Purchase, NY). Secondary detection was performed with appropriate biotinylated secondary antibodies and a VectaStain Elite kit (Vector, Inc., Burlingame, CA) with diaminobenzidine substrate. Counterstaining was performed with 1% methyl green. Negative-control slides were obtained by omitting the primary antibody. Sections from each tumor were also stained with hematoxylin and eosin. Images were quantified by counting the number of vessels per high-power field or viable numbers per total area by use of Image Pro Plus (Media Cybernetics, Silver Spring, MD) image analysis and recognition software.
Statistical analysis. Results from individual experiments are represented as means ± standard errors unless otherwise stated. Statistical comparison of groups was performed using two-tailed Student's t tests. Statistical significance was defined as P < 0.05 and P < 0.01 (see figures and legends).
| RESULTS |
|---|
|
|
|---|
46 kDa and
60 kDa. The 60-kDa protein has already been characterized as representing hnRNP L, a nuclear RNA-binding protein (36), and the 46-kDa band is likely to represent HuR, although this has not been confirmed directly. Interestingly, the light membrane-cytoplasm extracts demonstrated a strong doublet at an apparent molecular mass of 90 to 88 kDa that was described previously in a report of a study using total cell lysates and a complete VEGF 3'-UTR as a probe (3). The level of signal for this species was increased in hypoxic cell extracts to an extent similar to that seen for the nuclear proteins. To establish the specificity of protein binding to the HSR element, we performed a similar cross-linking experiment using biotinylated HSR RNA combined with a 10-fold molar excess of unlabeled competitor RNAs (Fig. 1B). The unlabeled HSR and full-length VEGF 3'-UTR RNAs both effectively competed for the 90- to 88-kDa UV-cross-linked signal in hypoxic cell extracts. A competitor RNA with a size similar to that of the HSR (126 bp), CTRL1, which is adjacent to the HSR element in the VEGF 3'-UTR, did not compete for the 90- to 88-kDa species. No UV cross-linking was observed when cell extracts were preheated to 100°C for 5 min, suggesting that the cross-linked signals are likely proteins that can be heat inactivated (data not shown). These data are consistent with previous observations indicating that the VEGF 3'UTR HSR element conferred mRNA stability to a heterologous luciferase reporter under hypoxia conditions whereas the control adjacent sequence, CTRL1, could not (3).
|
|
|
|
Stable small hairpin interference of DRBP76/NF90 expression in MDA-MB-435 cells affects hypoxia-induced VEGF mRNA and protein expression. Since transient RNA interference of proteins has to be verified for effectiveness in each individual experiment and since the experimental time window is limited to less than 1 week, we employed a small hairpin expression system to repress DRBP76/NF90 protein expression in a stable manner. To facilitate screening of the stable integrated vector we employed a U6-promoter-driven small hairpin RNA (shRNA) system with neomycin resistance to which a GFP expression cassette was added (see Materials and Methods). Primary stable transfected pools of MDA-MB-435 cells were selected for drug resistance alone and demonstrated an approximately 50% repression of the DRBP76/NF90 protein isoform (data not shown). In an effort to improve upon the pool of cells with uniform DRBP76/NF90 repression, we performed double cell sorting to select cells with high-level GFP expression (shDRBP76-GFP; Fig. 4A).
|
To evaluate whether DRBP76 silencing affected VEGF mRNA binding capacity, we performed VEGF-HSR UV cross-linking experiments with cell extracts from parental MDA-MB-435 cells and the shDRBP76-GFP cells exposed to normoxic or hypoxic culture conditions. Figure 4C shows a loss of UV cross-linking signal for DRBP76/NF90 in the shDRBP76-GFP cells which correlates with a distinct band in the parental cell extracts. To control for the level of proteins in the gel, direct immunoblot analyses were subsequently performed using the UV-cross-linked blots and antibodies to DRBP/ILF3 and β-actin as internal controls. The DRBP76/NF90 isoform was clearly depleted from the shDRBP76-GFP cell extracts under both normoxic and hypoxic conditions, and the β-actin signal levels were comparable for all lanes. Interestingly, there was some increase in binding capacity for the ILF3/NF110 isoform, which may indicate an increase in available ILF3 protein in the shDRBP76-GFP cells.
DRBP76/NF90 silencing in MDA-MB-435 cells shows reduced VEGF mRNA expression, little difference in HIF-1-dependent transcriptional activity, and a reduced VEGF mRNA half-life (t1/2) under hypoxia conditions. Parental MDA-MB-435 cells and the shDRBP76-GFP cells with stable repression of the DRBP76/NF90 isoform were subjected to normoxic or hypoxic conditions for 20 h. Total RNA was isolated and Northern blot analysis performed in triplicate to assess VEGF mRNA levels. Figure 5A shows the induction of VEGF mRNA under hypoxia conditions for the MDA-MB-435 cells. The levels of VEGF mRNA under normoxic and hypoxic conditions in the shDRBP76-GFP cells were lower than those seen with the parental MDA-MB-435 cells. The hypoxia induction of VEGF mRNA was also muted in these cells, with a hypoxic increase of VEGF/36B4 signal of 0.091 compared to 0.175 for the parental cells. A ribosomal housekeeping gene, 36B4/RPLP0, was found not to be adversely affected in the shDRBP76-GFP cells and was thus used as an internal control.
|
To assess whether VEGF mRNA stability may be affected, we performed a transcriptional blockade and analysis of VEGF mRNA decay under conditions of hypoxia (Fig. 5C). Parental MDA-MB-435 cells demonstrated increased mRNA stability as expected under hypoxia at a t1/2 of 2.97 h, whereas the t1/2 of VEGF mRNA in the shDRBP76-GFP cells was determined to have been reduced in a statistically significant manner to 1.72 h. These data suggest that VEGF mRNA t1/2 was affected by the loss of DRBP76/NF90 function.
VEGF mRNA loading onto active polysomes is affected by loss of DRBP76/NF90 expression. To achieve effective VEGF protein synthesis under hypoxia, mRNAs must be loaded onto active polysomes for protein translation, as observed with several other hypoxia-induced proteins, especially during prolonged hypoxia (20). Despite the significant depletion of total RNAs present on polysomes under hypoxia, VEGF mRNA is selectively associated with polysomes. Thus, to determine whether VEGF mRNA loading onto polysomes is one potential function for DRBP76/NF90, we isolated polysome fractions from parental and shDRBP76-GFP cells under normoxic and hypoxic conditions. The polysome nucleic acid and protein profiles look similar for the parental MDA-MB-435 and the shDRBP76-GFP cells, as shown in Fig. 6A. The normoxic sucrose gradient profiles show significant nucleic acid and protein levels in the polysome region between fractions 5 and 10. In contrast, the hypoxia profiles show increased nucleic acid in the light regions (fractions 2 to 5) and a significant deprivation of nucleic acid in the polysome regions (fractions 5 to 10). The levels of polysome reduction in total nucleic acid in hypoxic cells appeared to be equivalent for the two cell lines; thus, there was no significant change in the overall polysome protein and RNA profiles in the shDRBP76-GFP cells.
|
Overexpression of DRBP76/NF90 by MDA-MB-435 cells promotes both constitutive and hypoxia-induced VEGF mRNA and protein synthesis. To assess whether providing additional DRBP76/NF90 protein to cells could affect the induction of VEGF in human breast carcinoma cells, we transiently transfected MDA-MB-435 cells to overexpress the DRBP76/NF90 protein and tested the expression of VEGF mRNA by quantitative RT-PCR analysis (Fig. 7A). The transient transfection and analysis of cells with either β-galactosidase-expressing vector or vector encoding DRBP76/NF90 showed that VEGF mRNA levels were increased in the DRBP76/NF90-expressing cells under both normoxic and hypoxic conditions. To confirm whether the mRNA expression would translate into increased protein production, we examined secreted VEGF protein from transient transfected cells; the results demonstrated that VEGF protein accumulated in the media of transfected cells and that levels increased under both normoxic and hypoxic conditions in cells expressing DRBP76/NF90 compared to control cell results (Fig. 7B).
|
|
|
In addition to these molecular and histological analyses, markers of cell proliferation and tumor cell apoptosis were evaluated using Ki67 and TUNEL staining, respectively. In situ quantification of these endpoints in the MDA-MB-435-GFP and shDRBP76-GFP tumors revealed significant variations within each tumor and between the tumors in each group. Thus, these analyses did not provide data that would indicate proliferation or apoptotic alterations in the shDRBP76-GFP group, although these possibilities cannot be ruled out completely (data not shown). Thus, the hypoxic response in these tumors with respect to VEGF expression appears to be significantly affected by loss of DRBP76/NF90 protein and likely contributes to reduced angiogenic response and tumor growth potential.
| DISCUSSION |
|---|
|
|
|---|
VEGF expression is known to be facilitated by transcriptional and posttranscriptional mechanisms. Transcriptional activation through HIF-1-dependent pathways has been well established. In addition, it has been established that mRNA stabilization also contributes to VEGF expression under hypoxic conditions and VEGF mRNA stability has been shown to be provided for by a number of mRNA-binding proteins, including HuR, hnRNP L, and hnRNP A1 proteins, all of which are predominantly nuclear. Effective mRNA export from the nucleus and loading onto active polysomes under hypoxia has been attributed to increases in extranuclear shuttling of these nuclear mRNA-binding proteins. Previous studies investigating VEGF 3'-UTR structure have shown that a predicted stem-loop structure participates in VEGF mRNA stability and contributes to increased protein expression under hypoxia conditions, thus defining a stability element in the VEGF 3'-UTR (3).
In this report we have identified the double-stranded RNA-binding protein isoform DRBP76/NF90 as a DRBP that binds to the VEGF 3'-UTR stem-loop hypoxia stability region. Although the DRBP family of proteins have multiple alternatively spliced isoforms (see references 29 and 34 for reviews), we determined that the 90-kDa isoform is abundant and promotes hypoxia-induced VEGF mRNA levels and protein translation. Interestingly, this isoform was present in both nuclear and cytoplasmic compartments whereas the ILF3/NF110 isoform was retained in the nucleus and nuclear-associated membranes, as determined by cell fractionation studies. The observation that DRBP76/NF90 isoform repression did not dramatically affect HIF-1-dependent transcription indicates that DRBP76/NF90 functions as a posttranscriptional regulator.
In support of DRBP function in mRNA stability, the loss of DRBP76/NF90 reduced hypoxia-dependent VEGF mRNA stability, as determined by t1/2 studies, as well as the association of VEGF mRNA with active polysomes. In contrast, overexpression of DRP76/NF90 increased VEGF mRNA and protein levels in human breast cancer cells, suggesting that misregulation of the DRBP proteins could also promote VEGF synthesis in human breast cancer cells, although overexpression or misregulation of DRBPs has not been established as a mechanism of increased VEGF expression to date.
The ability to repress the expression of the DRBP76/NF90 isoform in stable cell lines was useful in determining its role in VEGF expression under metabolic stress conditions. These cells demonstrated similar proliferation rates under optimal growth conditions. However, hypoxia-dependent VEGF protein synthesis and secretion was significantly affected, suggesting that posttranscriptional and translational processes are facilitated by DRBP76/NF90 activity. Thus, the DRBP76/NF90 protein isoform is not essential to cell viability or proliferation.
Given the observation that DRBP76/NF90 repression did not dramatically affect cell growth under optimal conditions and despite the reduction in VEGF expression under hypoxia, the limitations in tumorigenic potential for the shDRBP76-GFP cells were indeed dramatic. The effects of DRBP76/NF90 repression on tumor expansion and viability were significant on several fronts. First, the tumors had a defined time point (about 4 weeks) at which growth was significantly affected, resulting in a tumor size of approximately 75 mm3. Second, at harvest, those shDRBP76-GFP tumors that persisted still demonstrated reduced DRBP76/NF90 expression, with a corresponding reduction in VEGF expression. Finally, histological and molecular analysis revealed that the tumors had reduced viability, which coincides with the reduced angiogenic potential. The effect of DRBP76/NF90 isoform repression on tumor growth indicated that although the shDRBP76-GFP cells were viable for proliferation under optimal growth conditions, their stress response, including the ability to actively produce VEGF, was a primary defect that prevented tumorigenic progression in vivo.
These data demonstrate that the DRBP family of proteins, and the DRBP76/NF90 isoform in particular, significantly contributes to the regulation of VEGF mRNA transport and stability and facilitates translation under hypoxic conditions. This mechanism appears to selectively target stress-induced pathways, since the DRBP76/NF90 isoform was not essential to normal cell proliferation in vitro. These data also support the hypothesis that selective mechanisms and processes exist to facilitate the expression of hypoxia-inducible genes under conditions of hypoxic stress. The contribution of VEGF 3' untranslated mRNA structure and its interaction with DRBP76/NF90 represent another example of complex RNA elements that facilitate gene expression during cellular stress or in response to nutrient imbalance.
| ACKNOWLEDGMENTS |
|---|
We appreciate the efforts of Nancy Ryan, Susan Kavel, and Diane Gran for their technical assistance.
| FOOTNOTES |
|---|
Published ahead of print on 26 November 2007. ![]()
Present address: The Feinstein Institute for Medical Research, Autoimmune Disease Center, 350 Community Drive, Manhasset, NY 11030. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Bernstein, P., and J. Ross. 1989. Poly(A), poly(A) binding protein and the regulation of mRNA stability. Trends Biochem. Sci. 14:373-377.[CrossRef][Medline]
3. Claffey, K. P., S.-C. Shih, A. Mullen, S. Dziennis, J. L. Cusick, K. R. Abrams, S. W. Lee, and M. Detmar. 1998. Identification of a Human VPF/VEGF 3' untranslated region mediating hypoxia-induced mRNA stability. Mol. Biol. Cell 9:469-481.
4. DeMaria, C. T., and G. Brewer. 1996. AUF1 binding affinity to A+U-rich elements correlates with rapid mRNA degradation. J. Biol. Chem. 271:12179-12184.
5. Dibbens, J. A., D. L. Miller, A. Damert, W. Risau, M. A. Vadas, and G. J. Goodall. 1999. Hypoxic regulation of vascular endothelial growth factor mRNA stability requires the cooperation of multiple RNA elements. Mol. Biol. Cell 10:907-919.
6. Fan, X. C., and J. A. Steitz. 1998. HNS, a nuclear-cytoplasmic shuttling sequence in HuR. Proc. Natl. Acad. Sci. USA 95:15293-15298.
7. Fan, X. C., and J. A. Steitz. 1998. Overexpression of HuR, a nuclear-cytoplasmic shuttling protein, increases the in vivo stability of ARE-containing mRNAs. EMBO J. 17:3448-3460.[CrossRef][Medline]
8. Forsythe, J. A., B. H. Jiang, N. V. Iyer, F. Agani, S. W. Leung, R. D. Koos, and G. L. Semenza. 1996. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 16:4604-4613.[Abstract]
9. Gallouzi, I. E., C. M. Brennan, M. G. Stenberg, M. S. Swanson, A. Eversole, N. Maizels, and J. A. Steitz. 2000. HuR binding to cytoplasmic mRNA is perturbed by heat shock. Proc. Natl. Acad. Sci. USA 97:3073-3078.
10. Goldberg-Cohen, I., H. Furneauxb, and A. P. Levy. 2002. A 40-bp RNA element that mediates stabilization of vascular endothelial growth factor mRNA by HuR. J. Biol. Chem. 277:13635-13640.
11. Gorgoni, B., and N. K. Gray. 2004. The roles of cytoplasmic poly(A)-binding proteins in regulating gene expression: a developmental perspective. Brief. Funct. Genomics Proteomics 3:125-141.
12. Guil, S., J. C. Long, and J. F. Cáceres. 2006. hnRNP A1 relocalization to the stress granules reflects a role in the stress response. Mol. Cell. Biol. 26:5744-5758.
13. Guttinger, S., P. Muhlhausser, R. Koller-Eichhorn, J. Brennecke, and U. Kutay. 2004. Transportin2 functions as importin and mediates nuclear import of HuR. Proc. Natl. Acad. Sci. USA 101:2918-2923.
14. Hirota, K., and G. L. Semenza. 2006. Regulation of angiogenesis by hypoxia-inducible factor 1. Crit. Rev. Oncol. Hematol. 59:15-26.[Medline]
15. Huez, I., L. Creancier, S. Audigier, M. C. Gensac, A. C. Prats, and H. Prats. 1998. Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA. Mol. Cell. Biol. 18:6178-6190.
16. Hwang, S. I., D. H. Lundgren, V. Mayya, K. Rezaul, A. E. Cowan, J. K. Eng, and D. K. Han. 2006. Systematic characterization of nuclear proteome during apoptosis: a quantitative proteomic study by differential extraction and stable isotope labeling. Mol. Cell. Proteomics 5:1131-1145.
17. Ikeda, E., M. G. Achen, G. Breier, and W. Risau. 1995. Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. J. Biol. Chem. 270:19761-19766.
18. Kim, J. H., B. Hahm, Y. K. Kim, M. Choi, and S. K. Jang. 2000. Protein-protein interaction among hnRNPs shuttling between nucleus and cytoplasm. J. Mol. Biol. 298:395-405.[CrossRef][Medline]
19. King, P. H. 2000. RNA-binding analyses of HuC and HuD with the VEGF and c-myc 3'-untranslated regions using a novel ELISA-based assay. Nucleic Acids Res. 28:E20.[CrossRef][Medline]
20. Koritzinsky, M., M. G. Magagnin, T. van den Beucken, R. Seigneuric, K. Savelkouls, J. Dostie, S. Pyronnet, R. J. Kaufman, S. A. Weppler, J. W. Voncken, P. Lambin, C. Koumenis, N. Sonenberg, and B. G. Wouters. 2006. Gene expression during acute and prolonged hypoxia is regulated by distinct mechanisms of translational control. EMBO J. 25:1114-1125.[CrossRef][Medline]
21. Koritzinsky, M., R. Seigneuric, M. G. Magagnin, T. van den Beucken, P. Lambin, and B. G. Wouters. 2005. The hypoxic proteome is influenced by gene-specific changes in mRNA translation. Radiother. Oncol. 76:177-186.[CrossRef][Medline]
22. Levine, T. D., F. Gao, P. H. King, L. G. Andrews, and J. D. Keene. 1993. Hel-N1: an autoimmune RNA-binding protein with specificity for 3' uridylate-rich untranslated regions of growth factor mRNAs. Mol. Cell. Biol. 13:3494-3504.
23. Levy, A. P. 1998. Hypoxic regulation of VEGF mRNA stability by RNA-binding proteins. Trends Cardiovasc. Med. 8:246-250.[CrossRef][Medline]
24. Levy, N. S., S. Chung, H. Furneaux, and A. P. Levy. 1998. Hypoxic stabilization of vascular endothelial growth factor mRNA by the RNA-binding protein HuR. J. Biol. Chem. 273:6417-6423.
25. Liu, Y., S. R. Cox, T. Morita, and S. Kourembanas. 1995. Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells. Identification of a 5' enhancer. Circ. Res. 77:638-643.
26. Ma, S., T. Musa, and J. Bag. 2006. Reduced stability of mitogen-activated protein kinase kinase-2 mRNA and phosphorylation of poly(A)-binding protein (PABP) in cells overexpressing PABP. J. Biol. Chem. 281:3145-3156.
27. Miller, D. L., J. A. Dibbens, A. Damert, W. Risau, M. A. Vadas, and G. J. Goodall. 1998. The vascular endothelial growth factor mRNA contains an internal ribosome entry site. FEBS Lett. 434:417-420.[CrossRef][Medline]
28. Neurath, K. M., M. P. Keough, T. Mikkelsen, and K. P. Claffey. 2006. AMP-dependent protein kinase alpha 2 isoform promotes hypoxia-induced VEGF expression in human glioblastoma. Glia 53:733-743.[CrossRef][Medline]
29. Parker, L. M., I. Fierro-Monti, T. W. Reichman, S. Gunnery, and M. B. Mathews. 2001. Double-stranded RNA-binding proteins and the control of protein synthesis and cell growth. Cold Spring Harb. Symp. Quant. Biol. 66:485-497.[CrossRef][Medline]
30. Peng, S. S., C. Y. Chen, N. Xu, and A. B. Shyu. 1998. RNA stabilization by the AU-rich element binding protein, HuR, an ELAV protein. EMBO J. 17:3461-3470.[CrossRef][Medline]
31. Rebane, A., A. Aab, and J. A. Steitz. 2004. Transportins 1 and 2 are redundant nuclear import factors for hnRNP A1 and HuR. RNA 10:590-599.
32. Ryan, H. E., M. Poloni, W. McNulty, D. Elson, M. Gassmann, J. M. Arbeit, and R. S. Johnson. 2000. Hypoxia-inducible factor-1
is a positive factor in solid tumor growth. Cancer Res. 60:4010-4015.
33. Sarkar, B., J. Y. Lu, and R. J. Schneider. 2003. Nuclear import and export functions in the different isoforms of the AUF1/heterogeneous nuclear ribonucleoprotein protein family. J. Biol. Chem. 278:20700-20707.
34. Saunders, L. R., and G. N. Barber. 2003. The dsRNA binding protein family: critical roles, diverse cellular functions. FASEB J. 17:961-983.
35. Semenza, G. L. 2000. HIF-1: mediator of physiological and pathophysiological responses to hypoxia. J. Appl. Physiol. 88:1474-1480.
36. Shih, S. C., and K. P. Claffey. 1999. Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L. J. Biol. Chem. 274:1359-1365.
37. Shih, S. C., A. Mullen, K. Abrams, D. Mukhopadhyay, and K. P. Claffey. 1999. Role of protein kinase C isoforms in phorbol ester-induced vascular endothelial growth factor expression in human glioblastoma cells. J. Biol. Chem. 274:15407-15414.
38. Skobe, M., T. Hawighorst, D. G. Jackson, R. Prevo, L. Janes, P. Velasco, L. Riccardi, K. Alitalo, K. Claffey, and M. Detmar. 2001. Induction of tumor lymphangiogenesis by VEGF-C promotes breast cancer metastasis. Nat. Med. 7:192-198.[CrossRef][Medline]
39. Stein, I., A. Itin, P. Einat, R. Skaliter, Z. Grossman, and E. Keshet. 1998. Translation of vascular endothelial growth factor mRNA by internal ribosome entry: implications for translation under hypoxia. Mol. Cell. Biol. 18:3112-3119.
40. Stoecklin, G., B. Gross, X. F. Ming, and C. Moroni. 2003. A novel mechanism of tumor suppression by destabilizing AU-rich growth factor mRNA. Oncogene 22:3554-3561.[CrossRef][Medline]
41. Tsuzuki, Y., D. Fukumura, B. Oosthuyse, C. Koike, P. Carmeliet, and R. K. Jain. 2000. Vascular endothelial growth factor (VEGF) modulation by targeting hypoxia-inducible factor-1
hypoxia response element
VEGF cascade differentially regulates vascular response and growth rate in tumors. Cancer Res. 60:6248-6252.
42. van den Beucken, T., M. Koritzinsky, and B. G. Wouters. 2006. Transl