This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chyla, B. J.
Right arrow Articles by Hiebert, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chyla, B. J.
Right arrow Articles by Hiebert, S. W.

 Previous Article  |  Next Article 

Molecular and Cellular Biology, October 2008, p. 6234-6247, Vol. 28, No. 20
0270-7306/08/$08.00+0     doi:10.1128/MCB.00404-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Deletion of Mtg16, a Target of t(16;21), Alters Hematopoietic Progenitor Cell Proliferation and Lineage Allocation{triangledown} ,{dagger}

Brenda J. Chyla,1,{ddagger},§ Isabel Moreno-Miralles,1,{ddagger}, Melissa A. Steapleton,1,{ddagger} Mary Ann Thompson,2,3 Srividya Bhaskara,1 Michael Engel,1,4 and Scott W. Hiebert1,2*

Department of Biochemistry,1 Vanderbilt-Ingram Cancer Center,2 Department of Pathology,3 Department of Pediatrics, Vanderbilt University School of Medicine, Nashville, Tennessee 372324

Received 10 March 2008/ Returned for modification 5 May 2008/ Accepted 7 August 2008


arrow
ABSTRACT
 
While a number of DNA binding transcription factors have been identified that control hematopoietic cell fate decisions, only a limited number of transcriptional corepressors (e.g., the retinoblastoma protein [pRB] and the nuclear hormone corepressor [N-CoR]) have been linked to these functions. Here, we show that the transcriptional corepressor Mtg16 (myeloid translocation gene on chromosome 16), which is targeted by t(16;21) in acute myeloid leukemia, is required for hematopoietic progenitor cell fate decisions and for early progenitor cell proliferation. Inactivation of Mtg16 skewed early myeloid progenitor cells toward the granulocytic/macrophage lineage while reducing the numbers of megakaryocyte-erythroid progenitor cells. In addition, inactivation of Mtg16 impaired the rapid expansion of short-term stem cells, multipotent progenitor cells, and megakaryocyte-erythroid progenitor cells that is required under hematopoietic stress/emergency. This impairment appears to be a failure to proliferate rather than an induction of cell death, as expression of c-Myc, but not Bcl2, complemented the Mtg16–/– defect.


arrow
INTRODUCTION
 
Chromosomal translocations disrupt master regulatory genes that control cellular proliferation, apoptosis, and the lineage decisions of progenitor cells (25, 53). Indeed, a critical component in the development of acute leukemia is the shunting of stem cells or multipotent progenitor cells toward a specific lineage, which also must acquire the ability to self-renew, to give rise to a specific form of acute myeloid leukemia (AML). The myeloid translocation gene on chromosome 16 (MTG16, also known as ETO-2 or CBFA2T3) and myeloid translocation gene on chromosome 8 (MTG8, also known as Eight-Twenty-one or ETO) are disrupted by t(16;21) and t(8;21), respectively. While t(8;21) accounts for as much as 10 to 15% of de novo AML (11, 12, 16, 17, 30, 43, 44), t(16;21) is relatively rare. Yet, the analysis of genes involved in rare translocations is often highly informative (35). In addition to mutations in acute leukemia, MTG8 was identified as a candidate cancer gene in colorectal carcinoma and mutations in MTG16 were also found in the initial screen (59). Moreover, MTG16 may also be inactivated in breast cancer (31). Thus, the analysis of the normal physiological functions of the MTG family is critical to our understanding of the development of acute leukemia and how mutation of MTG family members contributes to tumorigenesis in other organ systems.

The chromosomal translocation fusion proteins created at the breakpoints of t(8;21) and t(16;21) repress the transcription of tumor suppressor genes and genes that are required for hematopoietic differentiation (34). This is achieved by recruiting histone deacetylases and other transcriptional corepressors through their MTG8 or MTG16 sequences. Indeed, MTG family members associate with N-CoR/SMRT; mSin3A/3B; and histone deacetylases 1, 2, and 3 (2, 18, 23, 36, 63). MTG family members are recruited by DNA binding factors involved in chromosomal translocations (PLZF and BCL6) and by other regulators of hematopoiesis (e.g., TAL1/SCL, Gfi1, Gfi1b, and HEB) (9, 20, 39, 40, 55, 68). Thus, the cumulative data suggest that the MTG/ETO family members function as transcriptional corepressors whose activities are coopted by chromosomal translocations to induce leukemia.

Gene disruption strategies have been valuable to dissect the regulatory pathways and identify the critical factors that mediate the decision of a stem cell to self-renew and quiesce or to enter the rapidly expanding progenitor cell pool to populate the various hematopoietic cell lineages. Many of these key regulators are DNA binding transcription factors, which control gene expression programs to influence proliferation and differentiation. By contrast, only a limited number of the transcriptional regulators and chromatin remodeling factors that are recruited by DNA binding factors have been pinpointed as contributors to stem cell functions. This is especially true for transcriptional corepressors and gene silencing factors. Although a great deal of information has been gathered about the molecular interactions of the MTG family members through the analysis of the leukemia-related fusion proteins (34), less is known about the physiological functions of this gene family. Gene targeting studies of Mtg8/Eto and Mtgr1 have indicated a role in intestinal development but have yet to indicate any defects in hematopoiesis (1, 7). We have created mice lacking Mtg16 to better understand the physiological action of this key regulator. These mice show a bias toward the granulocyte/macrophage lineage and a decrease in the megakaryocyte-erythroid progenitor (MEP) cells, with the formation of a lineage–/c-Kit+, CD34hi/FC{gamma}Rlow population. We also found marked defects in short-term stem cell and progenitor cell proliferation in response to hematopoietic challenges. Analysis of the mechanistic basis of these defects indicates that loss of Mtg16 impairs progenitor cell cycle progression, which can be complemented by the exogenous expression of c-Myc.


arrow
MATERIALS AND METHODS
 
Plasmids. The murine Eto2/Mtg16 cDNA was obtained from Shari Meyers (LSUHSC, Shreveport, LA). The pPNT vector used for making the targeting construct was provided by the Vanderbilt-Ingram Cancer Center Transgenic Mouse/ES Cell Shared Resource (61). Murine stem cell virus (MSCV)-c-Myc and MSCV-Bcl2 were obtained from James DeGregori, University of Colorado (3). The Gfi1 cDNA was a gift from Tarik Moroy (Institut de recherches cliniques de Montréal), and the plasmids encoding PLZF and BCL6 were provided by Ari Melnick (Albert Einstein School of Medicine).

Mtg16-deficient mice. We obtained the genomic sequence of the Mtg16 allele using the Celera Discovery System and NIH databases and found that the genomic organization of this locus was similar to that of Mtg8 and Mtgr1. We amplified three homology regions from TL1 genomic DNA. Homology region 1 (HR1) was generated with the following primers: 5'-CTCGAGTATGAGGGTTGCATGGTGTTTTGGTTGG-3' and 5'-GGCGCGCCTTAATTAAATAACTTCGTATAGCATACATTATACGAAGTTAT[r]CAGTTTCCCAACCCTGCCT AGTTC-3'. HR2 was generated with the following primers: 5'-GACGCGTATAACTTCGTATAATGTATGCTATACGAAGTTAT[r]CCACGGAGAATGAACCATCCTGGATTA-3' and 5'-ACGCGTCAATTGACAAAGATGTCCTACATCACTGGGGCT-3'. HR3 was generated with the following primers: 5'-CAATTGATAACTTCGTATAATGTATGCTATACGAAGTTAT[r]CACCCCTACCATGCATCCAAAGAAGAT-3' and 5'-CTGGTTGATGACAGTCAGGGCATCCTC-3'. The restriction enzyme sites are shown in bold. The HR2, which contains the genomic sequence of Mtg16 exon 8 flanked by LoxP sites, was ligated to HR3, which includes 2 kb of Mtg16 genomic sequence. The HR2-HR3 combination was ligated to HR1, which contains 6 kb of Mtg16 genomic sequence. A neomycin resistance cassette was PCR amplified from the pPNT vector with the following primers: 5'-TTAATTAACTAGAGTCGGCTTCTG-3' and 5'-TTAATTAACTTTTCCCAAGGCAGTCTG-3'. The PAC1 restriction sites were used to add the neomycin cassette in between HR1 and HR2. A BamHI-HindIII fragment containing a thymidine kinase cassette was isolated from the pPNT vector and ligated into the KS Bluescript vector (TK-KSBS). The complete HR1-LoxP1-neomycin cassette-LoxP2-HR2-LoxP3-HR3 fragment was ligated into the TK-KSBP vector. The completed targeting construct was electroporated into TL1 embryonic stem cells. DNA isolated from the resulting single-cell clones was digested with XmnI and analyzed by Southern blotting for homologous recombination. A clone containing the correctly targeted Mtg16 locus was identified and injected into C57BL/6 blastocytes. Male chimeric mice were mated with C57BL/6 females, and agouti pups were tested for the targeted allele. The following primers were used to detect the floxed exon 8: 5'-CTGGGTCTCGACAAGAAGAAGTG-3' and 5'-GTCCATGATGCAGTTCAGAAG-3'. Thus, the wild-type allele yielded a 704-bp product and the floxed allele yielded a 647-bp product.

Mice containing a single copy of the targeted Mtg16 allele were mated with mice transgenic for the Cre recombinase driven off the EIIA promoter. The resulting offspring were analyzed for recombination between LoxP1 and LoxP3. The recombination event was detected using the following primers: 5'-ATGCAAGAACTAGGCAGGGTT-3' and 5'-GTCCATGATGCAGTTCAGAAG-3'. The expected product sizes are 1,405 bp for the wild-type allele and 282 bp for the recombined allele. These mice were backcrossed to C57BL/6J and subsequently analyzed to determine the effect of the loss of Mtg16 expression. The data in this paper were generated using mice from N3 to N4 backcrossed into the C57BL/6J strain.

Cell culture and protein analysis. Embryonic stem cells were grown on irradiated murine embryonic fibroblast feeder layers in Dulbecco modified Eagle medium (DMEM) containing 15% fetal calf serum, 0.1 mM nonessential amino acids, 2 mM L-glutamine, 50 µg/ml gentamicin, 103 U/ml leukemia inhibitory factor (LIF), and 55 µM β-mercaptoethanol (Gibco/Invitrogen). Bone marrow cells were cocultured with MSCV-producing BOSC23 cells in DMEM containing 10% fetal bovine serum supplemented with interleukin-6 (IL-6; PeproTech), stem cell factor (SCF; PeproTech), and LIF (Chemicon). Cos7 cells were cultured in DMEM supplemented with 10% fetal calf serum, 0.1 mM nonessential amino acids, and 2 mM L-glutamine (Gibco/Invitrogen). Transfection and coimmunoprecipitations for protein association studies were performed as described previously (2). Immunoblot analysis was performed using anti-Eto2 G-20 (Santa Cruz Biotechnology, Inc.) or monoclonal antibodies to the indicated epitope tags. Nuclear extracts were prepared from 5 x 106 splenocytes that were washed with phosphate-buffered saline, and the cells were then resuspended in buffer A (10 mM HEPES [pH 7.9], 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM dithiothreitol, and protease inhibitors). Triton X-100 (final concentration of 0.1%) was then added to the cells, and the mixture was incubated on ice for 8 min. The nuclei were collected by centrifugation, and the nuclear pellet was resuspended in radioimmunoprecipitation assay buffer containing protease inhibitors and subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Histology and peripheral blood analysis. Peripheral blood smears or sections of spleen or bone marrow were fixed in buffered formalin overnight at room temperature prior to being embedded in paraffin and sectioned. Sections were lightly counterstained with Mayer's hematoxylin and eosin (H&E) according to standard procedures. For the identification of reticulocytes, peripheral blood was isolated in heparinized tubes and mixed with reticuloctye staining solution (Sigma). The cells were counterstained on slides, and the reticulocytes were counted per 100 cells in a field. Further assessment of complete blood counts was performed on the Hemavet HV950FS blood analyzer (Drew Scientific, Inc.).

In vitro colony formation assays. Single-cell suspensions were obtained either by flushing cells from the tibia and femur or by mincing the spleen of mice. The red blood cells of the spleens were lysed with erythrocyte lysis buffer (Sigma). The cells were mixed with methylcellulose medium containing recombinant murine SCF (rmSCF), rmIL-3, recombinant human IL-6 (rhIL-6), and recombinant human erythropoietin (rhEpo) (Stem Cell Technologies Methocult GF M3434); methylcellulose medium containing rmSCF, rmIL-3, and rhIL-6 (Stem Cell Technologies Methocult GF M3534); or an erythroid burst-forming unit (BFU-E)-specific methylcellulose medium (Stem Cell Technologies Methocult SF M3436), which contains a proprietary combination of cytokines including rhEpo, and plated on 35-mm dishes in duplicate. Colonies were grown at 37°C and 5% CO2 for 8 to 14 days, and colonies were counted. The numbers of cells plated for each condition tested are stated in the figure legends. For the analysis of megakaryocytes, 1 x 105 cells were mixed with Megacult-C medium (Stem Cell Technologies), collagen (1.1 mg/ml), rmIL-3 (10 ng/ml), rhIL-6 (20 ng/ml), rhIL-11 (50 ng/ml), and recombinant human thrombopoietin (50 ng/ml) and plated in 35-mm plates in duplicate. Cultures were grown at 37°C and 5% CO2 for 6 days and were then transferred to a slide (Stem Cell Technologies; catalog no. 04863). The colonies were fixed and stained for acetylcholinesterase activity, and the number of colonies was scored by manual counting (as described in the manual for Megacult-C).

Bone marrow transplants. A single-cell suspension of bone marrow cells was obtained from the tibia and femur, and red blood cells were lysed with erythrocyte lysis buffer. Different concentrations of bone marrow cells were injected via the tail vein into lethally irradiated (900 rads) recipient wild-type C57BL/6 mice. For evaluation of spleen CFU (CFU-S) abilities, 5 x 104 bone marrow cells derived from either Mtg16+/+ or Mtg16-null mice were transplanted into lethally irradiated (900 rads) C57BL/6 wild-type mice. For retroviral infection, the recombinant retroviruses were produced after transient transfection of BOSC23 cells and the bone marrow cells were infected by coculture for 48 h in DMEM supplemented with 10% fetal bovine serum, IL-6, SCF, and LIF. This protocol yields 25 to 30% infection such that 200,000 cells were injected into the tail veins of recipient mice to match 50,000 wild-type cells. However, to ensure that low infection rates were not an issue, as many as 1,000,000 cells were injected. The spleens were isolated 8 or 12 days posttransplant and fixed in Tellsniczky's fixative.

Flow cytometry analysis. Single-cell suspensions were obtained by either flushing the tibia and femur or mincing the spleen or the thymus. Following lysis of the red blood cells using the erythrocyte lysis buffer, 1 x 106 to 4 x 106 cells were aliquoted into individual tubes. The cells were stained with antibodies against CD3, CD4, CD8, IL-7R{alpha}, Ter119, Gr-1, Mac-1, B220, CD41, ScaI, c-Kit, Flt3, CD34, and Fc{gamma}R. For the bromodeoxyuridine (BrdU) incorporation assays, mice were sacrificed 2 hours after intraperitoneal injection of 1 mg of BrdU. Cells were then harvested as previously described and detected using the BrdU flow kit (BD Pharmingen). For the homing studies, wild-type or Mtg16-null bone marrow cells were allowed to take up carboxyfluorescein succinimidyl ester (CFSE; Molecular Probes, Inc.) ex vivo and injected into the tail vein of irradiated recipient mice, and the bone marrow and spleens of recipient mice were analyzed by flow cytometry 6 h later to determine the percentage of cells containing CFSE-dependent fluorescence. Analysis was performed on a Becton Dickinson FACSCalibur, LSRII, or FACSAria flow cytometer.

Microarray and real-time quantitative PCR. Bone marrow cells were harvested as described above, and the lineage-negative fraction was separated using the lineage cell depletion kit and magnetically assisted cell sorting columns (Miltenyi Biotec). Total RNA was extracted using the Versagene total RNA purification kit (Gentra Systems), and microarray analysis was performed with the Applied Biosystems Inc. expression system. RNA was pooled from five mice, and biological triplicates were used to further avoid mouse-to-mouse variability. For the MEP and CD34hi/FcgRlow populations, cells were sorted by fluorescence-activated cell sorting (FACS), pooled from 10 mice, and analyzed as described above. For the quantitative PCR, 1 µg of total RNA was transcribed with the iScript cDNA synthesis kit (Bio-Rad) and 1/10 of the reaction was used for PCR using the iQ Sybr green Supermix (Bio-Rad) on an iCycler (Bio-Rad) or using TaqMan on an automated ABI platform. PCRs were performed in triplicate. The expression of the gene of interest was calculated relative to the levels of β-actin, glyceraldehyde-3-phosphate dehydrogenase, or GusB. Primer sequences were selected from the PrimerBank database (64) (PrimerBank identification numbers 6671756a2, 6753310a2, 31077096a3, and 16975506a2). The networks (8) were generated through the use of Ingenuity Pathways Analysis (Ingenuity Systems). The network score is based on the hypergeometric distribution and is calculated with the right-tailed Fisher exact test. The score is the negative log of this P value.


arrow
RESULTS
 
Mtg16-null mice are viable with signs of mild anemia. To examine the role of Mtg16/Eto2 in hematopoiesis, we deleted exon 8 of the gene, because splicing from exon 7 to exon 9 introduces a stop codon in the mRNA, thereby triggering nonsense-mediated mRNA decay. Homologous recombination was used to insert LoxP sequences flanking exon 8, and the G418 resistance gene (Neo) containing a 5' LoxP site was inserted directly upstream of exon 8 (Fig. 1A). Embryonic stem cells with a correctly targeted allele were identified and injected into blastocysts. Examination of the progeny by genomic PCR or Southern blot analysis confirmed germ line transmission of the "floxed" allele. The mice carrying the targeted allele were crossed with transgenic E2A-Cre recombinase mice, and offspring lacking exon 8 and Neo were identified. Genomic PCR (Fig. 1B), Southern blot analysis (data not shown), and Western blot analysis of splenocytes (Fig. 1C) confirmed that Mtg16/Eto2 was inactivated.


Figure 1
View larger version (65K):
[in this window]
[in a new window]

  		FIG. 1. Generation of Mtg16-null mice. (A) Schematic diagram showing a portion of the wild-type Mtg16 (Cbfa2t3) locus, targeting construct, and the resulting mutated locus after Cre recombinase-mediated deletion of exon 8 and the neomycin resistance cassette and the probes used. (B) PCR of genomic DNA demonstrates that exon 8 has been deleted (0.3-kb band). M, 100-bp ladder. (C) Western blot of nuclear extract from wild-type or Mtg16-null splenocytes shows the absence of Mtg16 protein. Histone H3 was used as a loading control (lower panel). (D and E) Peripheral blood smears from heterozygous (HET) or null mice were stained with reticulocyte stain (D), the numbers of reticulocytes were quantified by visual inspection after counting at least 200 cells, and the means of several measurements are shown as a bar graph (E); the error bars are standard errors of the means (E). The arrows in panel D indicate Howell-Jolly bodies. WT, wild type.

On a mixed 129SvEv x C57BL/6 genetic background, mice lacking Mtg16 were obtained at the expected frequency, were fertile, and appeared anatomically normal. Although one allele of Mtg16 is deleted in up to 40% of ductal breast carcinomas (31), there was no overt defect in breast development observed by whole-mount preparation and H&E sectioning (data not shown). Given the targeting of Mtg16 by t(16;21) in AML, we examined the peripheral blood for any defects. Complete blood counts revealed a mild anemia in some mice and a compensatory reticulocytosis at 4 weeks of age. Both Wright staining and reticulin staining of peripheral blood smears from 4-week-old mice indicated that Mtg16-null mice have on average twice as many circulating reticulocytes as do normal mice (Fig. 1D and E and data not shown). Consistent with this finding, we observed an increased number of Howell-Jolly bodies, which are nuclear remnants found in circulating, young red blood cells in response to anemia or splenic dysfunction (Fig. 1D, arrows).

Mtg16-null mice display disruptions in allocation to bone marrow progenitor cells. The peripheral blood phenotypes prompted us to examine the bone marrow, spleen, and thymus of Mtg16-null mice. Upon gross examination of the spleens of 4-week-old Mtg16-null mice, we noted splenomegaly with an average spleen weight twofold higher than that of the littermate controls. Histological examination of the spleens of these mice indicated that there was a disruption in the architecture (see Fig. S1A in the supplemental material), with the red pulp of the Mtg16-null spleens containing excess lymphoid, myeloid, erythroid, and megakaryocytic elements consistent with extramedullary hematopoiesis. The presence of excess myeloid progenitor cells was confirmed using methylcellulose colony formation assays (see Fig. S1B in the supplemental material). However, this was a transient effect, as the spleens were of sizes similar to those of the littermate controls at 8 and 12 weeks, which is coincident with the mice reaching full size. Therefore, the extramedullary hematopoiesis in the spleen correlates with the need for more red cells during rapid neonatal growth.

Flow cytometry using lineage-specific antibodies confirmed that all of the hematopoietic lineages were present in the bone marrow of these mice but that there were disruptions in lineage allocation (Fig. 2A). There were somewhat fewer total B220-positive B cells, as well as B220hi cells. In addition, it appeared that there were fewer maturing erythroid progenitor cells, as fewer cells were Ter119+. There were also fewer CD41+ cells, suggesting reduced numbers of megakaryocytes (see Fig. S2A in the supplemental material). Conversely, more cells were Gr-1+/Mac-1+, suggesting that the inactivation of Mtg16 allowed more cells to enter the granulocyte/macrophage pathway. As for erythropoiesis, while fewer cells were Ter119 positive, once committed to this lineage, the cells continued to differentiate, as the subpopulations distinguished by staining with anti-CD71 and anti-Ter119 were all present and in proportions similar to those of the control mice (Fig. 2B). Methylcellulose colony formation assays confirmed these flow cytometry results, as there were consistently more CFU-G colonies formed from both the bone marrow and the spleen (Fig. 2C and D). This increase in the granulocytic lineage appeared to be at the expense of the erythroid lineage, as there were only a few BFU-E formed (Fig. 2C and E). Although megakaryocytes and erythroid cells share a common progenitor cell (MEP), colonies containing mature megakaryocytes were produced in vitro (see Fig. S2B in the supplemental material). Thus, while there were no complete blocks in hematopoietic differentiation in the absence of Mtg16, there was altered production of cells within lineages and a dramatic reduction in BFU-E activity in vitro.


Figure 2
View larger version (35K):
[in this window]
[in a new window]

  		FIG. 2. Hematopoietic defects in Mtg16-null mice. (A) Flow cytometry analysis of bone marrow from wild-type and Mtg16-null mice using the lineage-specific antibodies indicated. An example of the cell plot histograms is shown. An unpaired two-tailed t test indicated that the changes observed in the number of cells were significant (Ter119, P = 0.0086; Gr-1/Mac-1, P = 0.0001; B220, P = 0.011). (B) Flow cytometry analysis of erythropoiesis using anti-CD71 versus anti-Ter119. The boxes mark the four stages of differentiation. An unpaired two-tailed t test indicated that there were no statistical differences (n = 5 for each population observed). (C) Bone marrow (2.5 x 104 cells) or spleen (2.0 x 105) cells were plated in methylcellulose containing IL-3, IL-6, Epo, and SCF, and colonies were quantified after 8 to 10 days in culture. (D) Bone marrow (2.5 x 104) or spleen (2.0 x 105) cells were plated in granulocyte and monocyte-specific methylcellulose containing IL-3, IL-6, and SCF, and colonies were quantified after 8 to 10 days in culture. (E) Bone marrow (5 x 104) or spleen (5 x 105) cells were plated in BFU-E-specific methylcellulose, and colonies were quantified after 14 days in culture. An unpaired two-tailed t test indicated that some of the differences in the colony numbers were significant (*, P = 0.01 to 0.05; **, P = 0.001 to 0.01; ***, P < 0.001). Shown are representative results from an experiment done in duplicate that are consistent with other biological replicates. WT, wild type.

Loss of Mtg16 sensitizes mice to the effects of phenylhydrazine. The reduction in the number of Ter119+ cells, the impairment in BFU-E, and the association of Mtg16 with TAL1/Scl and Gfi1b in hematopoietic cell lines (20, 55) led us to test the response of Mtg16-null mice to erythropoietic stress. Phenylhydrazine is a hemolytic agent used in the past to treat patients with polycythemia vera (4). Cohorts of control and Mtg16-null mice were injected with 40 mg phenylhydrazine/kg of body weight on days 0, 1, and 3, which is a regimen that is well tolerated in wild-type mice (Fig. 3A). However, the Mtg16-null mice quickly became moribund and the experiment was terminated at day 5 (Fig. 3A). Erythropoietic stress stimulates a dramatic proliferative response in the bone marrow and spleen. In the spleen, myeloid progenitor cells rapidly expand to regenerate the erythropoietic system. At the gross level, spleens of control mice increased in size by over fourfold to meet the phenylhydrazine challenge (Fig. 3B) and the total red blood cell counts and hematocrits were reduced by only about 50%, as expected. By contrast, the spleens of Mtg16-null mice did not increase in size and the red cell count plummeted along with the hematocrit (Fig. 3B). Histological analysis of the spleens of these mice indicated that the control mice were able to expand their progenitor populations to meet the hematopoietic challenge, but the Mtg16-null progenitor population failed to expand 5 days after the first injection of phenylhydrazine (Fig. 3C). Methylcellulose colony formation assays confirmed these results, as there was either a dramatic reduction or no BFU-E colonies formed using either a combination of Epo, IL-6, IL-3, and SCF (Fig. 3D) or using Epo alone (Fig. 3E), but with a concomitant increase in CFU-M, CFU-G, and CFU-GM colonies from the spleens of the Mtg16-null phenylhydrazine-treated mice (Fig. 3D).


Figure 3
View larger version (45K):
[in this window]
[in a new window]

  		FIG. 3. Mtg16 is required during hematopoietic stress. (A) Survival curves of mice injected with phenylhydrazine. (B) Characterization of the hematopoietic response to phenylhydrazine shown schematically as graphs. Open bars are data from control mice, and dark bars represent Mtg16-null mice. An unpaired two-tailed t test indicated that the decrease in red blood cells (RBC) at day 0 is significant (P = 0.0009, n = 6) and all of the changes observed at day 5 were significant (spleen weight, P = 0.001; hematocrit, P = 0.0044; RBC, P = 0.001; hemoglobin [Hb], P = 0.0083; n = 3). (C) Histological analysis of wild-type and Mtg16-null spleens before and 5 days after administration of phenylhydrazine. (D) Colony results from bone marrow (2.0 x 104) or spleen (1 x 105) cells plated on methylcellulose containing SCF, IL-3, IL-6, and Epo at day 3 or day 5 after phenylhydrazine injection. Shown are representative results from an experiment done in duplicate that are consistent with other biological replicates. (E) Colony results from bone marrow (5 x 104) or spleen (1 x 105) cells plated in erythroid cell-specific methylcellulose at day 3 or day 5 after phenylhydrazine injection. An unpaired two-tailed t test indicated that some of the differences in the colony numbers were significant (*, P = 0.01 to 0.05; **, P = 0.001 to 0.01; ***, P < 0.001). Shown are representative results from an experiment done in duplicate that are consistent with other biological replicates. WT, wild type; PHZ, phenylhydrazine.

Inactivation of Mtg16 disrupts progenitor cell gene expression networks. Mtg16 is the most highly expressed MTG family member in the early progenitor and stem cell populations (33). Thus, loss of Mtg16 is expected to alter transcriptional networks to affect erythroid progenitor cell proliferation. To begin to define the changes in gene expression underlying these phenotypes, we performed cDNA microarray analysis of immature bone marrow progenitor cells to further define the mechanistic basis of these defects. The bone marrow from young adult, sex-matched, wild-type and Mtg16-null mice was pooled, and lineage-positive cells were removed using the lineage panel of antibodies coupled to magnetic beads. Total RNA from the lineage-negative cells was prepared and used for cDNA microarray analysis (Fig. 4A; see also Fig. S3 in the supplemental material). The misregulation of numerous genes associated with stem cell and progenitor cell function was observed, including Socs2, Gfi1, HoxB2, PU.1, and members of the C/EBP family (Fig. 4A). The changes in expression of selected target genes were confirmed by quantitative reverse transcription-PCR (RT-PCR) (Fig. 4B and data not shown). In addition, quantitative RT-PCR was used to examine the expression of numerous cell cycle regulators whose induction could contribute to the observed phenotypes including the retinoblastoma family members and cyclin-dependent kinase inhibitors. However, we did not detect statistically significant changes in the expression of these genes either by microarray or by quantitative RT-PCR (data not shown).


Figure 4
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 4. Mtg16-null progenitor cells have alterations in gene expression. (A) Heat map showing some of the changes in gene expression that occur in lineage-negative bone marrow progenitor cells as determined by cDNA microarray analysis. The heat map shows genes whose expression is higher in the Mtg16-null cells as red and those genes whose expression is lower in green. WT, wild type. (B) Quantitative RT-PCR of selected genes to validate the microarray studies. An additional 15 to 20 cell cycle-related genes were also analyzed without significant changes. (C and D) The two most significant networks from Ingenuity Pathway Analysis showing genes whose expression changes in the absence of Mtg16. "Hematopoietic system development and function" is shown in panel C (score = 47), and "immune response, cell-to-cell signaling" is shown in panel D (score also = 47). Red, upregulated; green, downregulated.

When the mRNAs that showed a greater-than-twofold change were analyzed using Ingenuity Pathway Analysis software, two networks of transcription factors and their regulated genes were found to be altered (Fig. 4C and D; red is up, green is down; network score is 47 for each shown). Within these networks we noted that several genes that are regulated by Gfi1, which recruits MTG8, were derepressed. These included Gfi1 itself, neutrophil elastase (Ela2), and C/EBP{varepsilon} (Fig. 4C) (14, 27). We then performed a visual inspection of the array data to examine the expression of genes that are regulated by these and other DNA binding factors that recruit MTG family members. By expanding the expression array criteria to as low as 1.7-fold, we noted that two additional Gfi1-regulated genes, IL-6 receptor and C/EBP{alpha}, were induced, as was Socs3, which is regulated by Gfi1b (14, 28). In addition, we found that the BCL6-regulated genes Stat1, Id2, CD69, cyclin D2, and Cxcr4 were upregulated in the null mice (57) and that PLC{gamma}, Gadd45b, and Hes1, which are regulated by "E proteins" (e.g., HEB and E47 [56, 68]) were similarly activated. These results prompted us to extend this analysis to demonstrate that these factors can also associate with Mtg16. Immunoprecipitation followed by Western blot analysis indicated that Mtg16 bound to both Gfi1 and PLZF and modestly associated with the PLZF-related factor BCL6 (see Fig. S4 in the supplemental material).

The gene expression analysis identified transcriptional networks that are disrupted when Mtg16 is inactivated and also identified multiple genes whose activation might alter cell cycle progression, including Socs2 and Socs3, which dampen cytokine receptor signals (37, 41), and the C/EBP family members that can bind to and impair the action of E2Fs (19, 50, 51). In addition, we found that the levels of mRNA encoding the cyclin-dependent kinase inhibitor p27 were induced an average of 1.7-fold in the Mtg16-null cells but that the levels of p21 were not significantly altered either in the microarray analysis or in quantitative RT-PCR assays (data not shown). Cumulatively, these small changes in gene expression may have a significant impact on progenitor cell proliferation. In contrast, few genes associated with the induction of apoptosis were identified. Finally, we noted that CD34, which is expressed in common myeloid progenitor and granulocyte/macrophage progenitor cells, was upregulated in the Mtg16-null mice.

Inactivation of Mtg16 yields a c-Kit+/CD34hi/Fc{gamma}Rlow myeloid progenitor population. The stimulation of CD34 and genes that control myelopoiesis (e.g., C/EBP family members) could be due to altered transcription of these genes in the absence of Mtg16, or it could be due to a skewing of lineage allocation toward myeloid progenitor cells. Therefore, we examined the early progenitor bone marrow compartment using flow cytometry to define the ratios of early progenitor cells in the bone marrow of Mtg16-null mice. For this analysis, we first depleted maturing cells (lineage positive) and then identified cells expressing combinations of c-Kit, but not Sca1, and used Fc{gamma}R and CD34 to distinguish myeloid progenitor populations by flow cytometry (5, 65). Compared to wild-type control mice, the Mtg16-deficient mice contained slightly fewer lineage–/c-Kit+/Sca1+ cells (LSK, Fig. 5A). Within the myeloid progenitor cells (lineage–/c-Kit+/Sca1–), there were fewer MEPs (Fig. 5A, P < 0.05) but more common myeloid progenitor cells (CMPs, Fig. 5A and B) and more granulocyte/macrophage progenitor cells (GMPs, Fig. 5A and B) (45, 65). In addition, the Mtg16-null mice contained a cell population that highly expressed CD34 but poorly reacted with anti-Fc{gamma}R (Fig. 5A and B).


Figure 5
View larger version (25K):
[in this window]
[in a new window]

  		FIG. 5. Mtg16-null bone marrow contains a c-Kit+/CD34hi/Fc{gamma}Rlo population. (A) Flow cytometry using lineage-depleted bone marrow and anti-c-Kit, -ScaI, -Fc{gamma}R, and -CD34. From the graphs on the left, the c-Kit+/ScaIlo (MP) cells were gated and further analyzed using anti-Fc{gamma}R and anti-CD34 (graphs on the right). (B) Quantification of the gates shown in the right-hand panels in panel A. Open bars are data from control mice, and dark bars represent Mtg16-null mice. An unpaired two-tailed t test indicated that the changes observed in the number of cells were significant (CMP, P = 0.001; GMP, P = 0.019; MEP, P = 0.0001; CD34hi/Fc{gamma}Rlo, P = 0.0012; n = 5). (C) The indicated populations from the graphs in panel A were sorted by FACS; 500 cells were plated in methylcellulose containing SCF, IL-3, IL-6, and Epo; and colonies were quantified after 8 to 10 days in culture. (D) The indicated populations from the graphs in panel A were sorted by FACS; 500 cells were plated in methylcellulose containing SCF, IL-3, and IL-6; and colonies were quantified after 8 to 10 days in culture. (E) The indicated populations from the graphs in panel A were sorted by FACS, 2,000 cells were plated in erythroid cell-specific methylcellulose, and colonies were quantified after 14 days in culture. An unpaired two-tailed t test indicated that some of the differences in the colony numbers were significant (*, P = 0.01 to 0.05; **, P = 0.001 to 0.01; ***, P < 0.001). Shown are representative results from an experiment done in duplicate that are consistent with other biological replicates. WT, wild type.

To determine what lineage of cells the CD34hi/Fc{gamma}Rlow cells represented, we used FACS to isolate these cells along with CMPs, GMPs, and MEPs from wild-type and null mice and cultured these cells in methylcellulose supporting myeloid progenitor cell growth. Consistent with the FACS data that indicate that deleting Mtg16 in the bone marrow creates more granulocytic-lineage precursors, in both CMP and GMP populations, there were consistently more CFU-G colonies formed with a dramatic loss of BFU-E (Fig. 5C and D; see Fig. S5 in the supplemental material for photographic examples of the colonies formed). The Mtg16-null CD34hi/Fc{gamma}Rlow cells formed similar numbers of CFU-M, CFU-G, and CFU-GM colonies under these conditions as did wild-type CMP cells but had little or no potential to yield BFU-E (Fig. 5C to E).

Next, we sorted the CD34hi/Fc{gamma}Rlow cells from the null mice and compared gene expression in these cells to that in MEPs from wild-type or null bone marrow to further test whether these are MEPs that had deregulated CD34 expression. Comparison of the CD34hi/Fc{gamma}Rlow cells to MEPs from the null mice indicated that this was a distinct cell population, rather than an aberrant MEP population, as there were dramatic changes in gene expression profiles (Fig. 6A). These included the expression of granulocyte-specific genes such as myeloperoxidase, neutrophil elastase 2, CD52, and cathepsin G, as well as transcriptional regulator genes, such as Gfi1, C/EBP{alpha}, C/EBP{delta}, and C/EBP{varepsilon}, which contribute to granulocyte differentiation (15, 19, 24, 29, 48-50). In addition, EpoR was dramatically underrepresented in the CD34hi/Fc{gamma}Rlow population. Overall, the gene expression profiles and growth characteristics of this population (Fig. 5) were most consistent with an abnormal granulocytic/macrophage progenitor that failed to express Fc{gamma}R but maintained expression of c-Kit and CD34.


Figure 6
View larger version (32K):
[in this window]
[in a new window]

  		FIG. 6. Gene expression analysis defines the Mtg16-null c-Kit+/CD34+/Fc{gamma}Rlo population. (A and B) Heat map comparisons of the indicated FACS-sorted populations showing some of the changes in gene expression that occur in lineage-negative bone marrow progenitor cells as determined by cDNA microarray analysis. The heat map shows genes whose expression is higher in red and genes whose expression is lower in green. (C) Quantitative RT-PCR of selected genes to validate the microarray studies. WT, wild type; NC, no change.

This analysis also allowed us to directly compare wild-type and null MEP gene expression (Fig. 6B). Even in these committed progenitor cells, there were dramatic differences in gene expression. Some of the key genes that were upregulated include the regulators of differentiation Id1, Id2, Fli1, Pu.1, and Hes5 and regulators of cytokine signaling and cell proliferation such as Socs2, Cdc25b, p18ink4, and p21 (Fig. 6C). Whereas the microarrays did not detect changes in Gata3, quantitative RT-PCR found that it was upregulated relative to Gata1 (Fig. 6C). Conversely, genes that were underexpressed included the transcription factor genes Mef2c, Klf5, and Pax2 (see Fig. S6 in the supplemental material). Ingenuity Pathway Analysis uncovered four highly significant networks that were dysregulated in Mtg16-null MEPs versus wild-type MEPs (see Fig. S7 in the supplemental material). One of these networks (see Fig. S7C in the supplemental material, Cancer and Cellular Growth) contains many key regulators of cell cycle, proliferation, and cellular differentiation including p21, cyclin D1, Id1, Id2, Notch1, Hes5, and Fli1.

Mtg16 is required for short-term stem cell, multipotent progenitor, and MEP proliferation. Short-term stem cell and progenitor cell functions can be further examined using a spleen colony-forming assay. MEPs form colonies on the spleen 8 days after bone marrow transplantation (CFU-S8), and short-term stem cells and multipotent progenitor cells and MEPs form splenic colonies in roughly equal numbers 12 days after transplantation (CFU-S12) (45, 65). As expected, wild-type bone marrow from littermate control mice yielded copious numbers of colonies at both 8 and 12 days posttransplantation (Fig. 7A). In contrast, Mtg16-null bone marrow failed to form colonies and produced only "white patches" of cells at either 8 or 12 days after transplantation (Fig. 7A). The presence of the patches of cells in the spleens transplanted with null marrow suggested that the Mtg16-null progenitor cells found their way to the spleen but failed to expand to form colonies. When bone marrow cells were labeled ex vivo with the tracking dye CFSE, they homed to the spleen in similar numbers as did the wild-type donor control cells (Fig. 7B). Thus, while the bone marrow of Mtg16-deficient mice sustains the naïve mice in vivo, these cells are completely defective in the CFU-spleen assay (Fig. 7A) and fail to undergo the rapid expansion necessary after challenge with phenylhydrazine (Fig. 3).


Figure 7
View larger version (46K):
[in this window]
[in a new window]

  		FIG. 7. Inactivation of Mtg16 impairs hematopoietic progenitor cell proliferation. (A) CFU-S8 and CFU-S12 were obtained for wild-type and Mtg16-null bone marrow. (B) CFSE labeling indicates that Mtg16-null bone marrow cells home to the spleen. Bone marrow cells were labeled ex vivo and injected into the tail vein of lethally irradiated mice, and the CFSE-labeled cells that homed to the spleen were determined by FACS 6 h after injection. (C) Cell cycle analysis of transplanted splenocytes. Eight days after bone marrow transplantation the mice were injected with BrdU 2 h before sacrificing, the splenocytes were harvested, and the percentage of total BrdU-positive cells in the spleens was determined using flow cytometry. The histograms show a representative example. (D) Expression of c-Myc, but not Bcl2, complements the Mtg16-null defect in CFU-S12 assays. Mtg16-null bone marrow cells were infected with recombinant MSCVs expressing the indicated cDNAs and injected into irradiated recipient mice for CFU-S12 assays. (E) Quantification of the number of colonies formed in the CFU-S12 assay in panel D. An unpaired two-tailed t test indicated that the changes observed in the number of colonies were significant compared to the number of colonies from MSCV (Mtg16, P < 0.0001, n = 5; c-Myc, P < 0.0001, n = 6). WT, wild type.

The defect in CFU-S could be due to a failure of the cells to rapidly expand and form large colonies or could be due to increased cell death. Given that the endogenous splenocytes had received a lethal dose of radiation and would not synthesize DNA, we were able to use BrdU incorporation to measure the cycling status among the injected cells in the spleens 8 days after bone marrow transplantation. In mice transplanted with wild-type bone marrow, roughly 40% of the cells were cycling. In contrast, the Mtg16-null bone marrow produced half the number of BrdU-positive cells in the spleen 8 days posttransplant (Fig. 7C). While the irradiation of the recipient mice did not allow a determination of the level of apoptosis, the BrdU incorporation data suggest that the mechanistic basis of the Mtg16-null progenitor cells is a defect in proliferation.

The Mtg16 defect in CFU-S can be overcome by expression of c-Myc. To further define the mechanism underlying the Mtg16-null defect, we attempted to genetically complement the proliferation defect. Our gene expression studies identified a host of genes that are deregulated upon inactivation of Mtg16, making small interfering RNA or crossbreeding with mice lacking these genes impractical. Therefore, we asked whether expression of genes that can block apoptosis or stimulate proliferation might bypass the Mtg16-null proliferation defect. Bcl2 expression was used to impair apoptosis, and c-Myc was expressed to promote proliferation, due to its ability to bypass cyclin-dependent kinase inhibitors such as p27 and p21 (46, 66), which were upregulated in the null mice. Expression of c-Myc also leads to the activation of E2F family members and cell cycle progression (32), which might overcome the action of C/EBP family members and bypass any impaired signaling caused by expression of Socs family members (Fig. 4; see also Fig. S3 and S6 in the supplemental material). Our culture conditions for MSCV infection favored the expansion and transduction of stem cells and multipotent progenitor cells, which required us to focus on CFU-S12. The in vitro selection for rapidly growing cells led to the formation of somewhat larger microcolonies on the spleens in the vector control, but no fully formed colonies were observed (MSCV, Fig. 7D and E). This further confirms that these cells correctly home to the spleen but fail to expand into colonies. Reexpression of Mtg16 complemented the proliferation defect leading to the formation of robust colonies, which confirms that these defects are specific to the loss of Mtg16 (Fig. 7D). While expression of Bcl2 had no effect on colony formation, expression of c-Myc complemented the Mtg16-null defect in vivo. Expression of c-Myc in wild-type bone marrow did not affect CFU-S number (see Fig. S8 in the supplemental material). Thus, inactivation of Mtg16 causes a profound defect in progenitor cell expansion.


arrow
DISCUSSION
 
The chromosomal translocations that are associated with acute leukemia target master regulators of cell fate decisions, apoptosis, and cellular proliferation (35). Gene targeting of Mtg16 demonstrates that this gene is largely dispensable for normal development and viability in an unstressed environment and that the neonatal extramedullary hematopoiesis in the spleen occurs in response to the rapid growth during early development. However, there were fewer MEPs, and there was the formation of an abnormal CD34hi/Fc{gamma}Rlow progenitor cell population that had the growth properties and gene expression pattern characteristic of a myeloid progenitor cell. Hematopoietic stress disrupted the homeostasis that is achieved in the bone marrow of these mice and magnified the role of Mtg16 progenitor cell proliferation (Fig. 3). The Mtg16-null mice succumbed to acutely induced anemia, which appeared to be due to a failure to expand erythropoiesis in the spleen. Spleen colony formation assays emphasized the proliferation defect. This assay also assesses the function of multipotent progenitor cells and short-term stem cells (45, 65), and the total lack of colonies at day 12 after bone marrow transplantation indicates that these immature cells are also functionally defective in the Mtg16-null bone marrow.

The disruption in the allocation of cells to the different myeloid progenitor populations in the Mtg16-null mice is reminiscent of the defects in the small intestine of Mtgr1-deficient mice (1). Mtgr1-null mice also survive into adulthood, but these mice fail to maintain the secretory lineage cells in the small intestine (1). This phenotype is somewhat similar to deletion of Gfi1 in the gut (58), and Gfi1 can recruit Mtgr1 (1, 39). In addition to the small intestinal phenotype, the colons of the Mtgr1-null mice were hypersensitive to the ulcerative agent dextran sodium sulfate (DSS). After treatment with DSS, the Mtgr1-null colonic epithelium failed to correctly regenerate, suggesting altered stem cell functions (38). Targeted gene disruption of Mtg8 indicated that it is required for development of the gut (7), but without defects in lineage contributions. While there are no obvious phenotypes in the intestines of Mtg16-null mice (data not shown), the gut phenotypes observed in the Mtg8- and Mtgr1-deficient mice coupled with the identification of mutations in MTG8 in colorectal carcinoma and MTG16 in breast cancer suggest that further analysis of these mice, perhaps after cellular stress, is warranted.

Mechanistically, the altered progenitor cell functions can be traced to changes in gene expression patterns that can be linked to impaired repression by the DNA binding factors that recruit Mtg16. These include PLZF, BCL6, TAL1/SCL, Gfi1, Gfi1b, and Heb (9, 20, 39, 40, 55, 68). Gene expression profiling identified the derepression of genes that are regulated by many of these factors, which not only confirms the veracity of the arrays but also provides a molecular mechanism for how loss of Mtg16 affects cell lineage decisions. For example, Gfi1 autoregulates its own expression and represses both C/EBP{varepsilon} and neutrophil elastase, while PLZF regulates HoxB2. Indeed, the entire gene network that includes Gfi1, C/EBP{varepsilon}, and PU.1 was dysregulated in the Mtg16-null bone marrow (Fig. 4C). Within this network it is possible that the removal of Mtg16 impaired Gfi1-mediated repression of C/EBP{varepsilon}, which in turn affects the expression of PU.1 (Spi1) and C/EBPβ to alter the cell fate decisions in favor of granulocytes and monocytes. However, it is also noteworthy that C/EBPβ can associate with MTG8 and that PU.1 associates with RUNX1-MTG8 (52, 62). Thus, this network analysis points toward a more direct involvement of Mtg16 with multiple key regulators of hematopoiesis.

It is also notable that two of the DNA binding factors that recruit MTG family members, Gfi1b and TAL1/Scl, contribute to erythropoiesis (10, 21, 42). While TAL1/Scl can both activate and repress transcription, Gfi1b is commonly viewed as a dedicated repressor such that loss of a corepressor could partially impair Gfi1b actions (13, 54). Mice lacking Gfi1b died during embryogenesis, apparently due to defective erythropoiesis, such that its contribution to adult hematopoiesis has yet to be defined (54). Nevertheless, removal of one of the corepressors that is recruited by Gfi1b is likely to contribute to the defective proliferation, especially given that Gfi1b can control cellular proliferation via repression of the p21 cyclin-dependent kinase inhibitor. Indeed, p21 was upregulated in Mtg16-null MEPs, but other cyclin-dependent kinase inhibitors were also turned on as were drivers of the cell cycle such as N-Myc. Like Gfi1b, TAL1/Scl is also required for embryonic hematopoiesis, but when it was deleted in adult mice, these mice were mildly anemic. While the bone marrow was defective in CFU-S assays, these mice had increased numbers of MEPs and normal percentages of CMPs and GMPs (10, 21, 22, 42), whereas the Mtg16-null mice have fewer MEPs and an abnormal CD34hi/Fc{gamma}Rlow myeloid progenitor cell population (Fig. 5 and 6). Therefore, it is difficult to pinpoint single genes or pathways that would mediate the Mtg16-null phenotypes observed.

Loss of function of Mtg16 may be associated with the formation of acute leukemia, as t(8;21) fusion protein can associate with Mtg16 and impair its function in granulopoiesis (26). t(8;21) is associated with an increase in early myeloid progenitor cells, and deletion of Mtg16 function caused an accumulation of these populations (Fig. 5). Moreover, when expressed during embryogenesis, t(8;21) fusion protein also impaired erythropoiesis (47, 67). Though counterintuitive, the fusion protein impaired proliferation in vitro, and in vitro inactivation of Mtg16/ETO2 impaired the proliferation of erythroid cells (2, 6, 20, 60). Our in vivo study of CFU-S12 indicated that this proliferation defect is also found in multipotent progenitor cells and short-term stem cells (Fig. 7). Thus, loss of Mtg16 functions could contribute to some of the phenotypes associated with t(8;21), perhaps by favoring lineage allocation toward the CMP/GMP populations and away from erythropoiesis.


arrow
ACKNOWLEDGMENTS
 
We thank the members of the Hiebert lab for helpful discussions and encouragement and the Vanderbilt-Ingram Cancer Center (CA68485) and the Vanderbilt Digestive Diseases Research Center (5P30DK58404) for support and the use of shared resources including flow cytometry, DNA sequencing, transgenic/embryonic stem cells, immunohistochemistry, and histological analysis.

This work was supported by the T. J. Martell Foundation; the Robert J. Kleberg, Jr., and Helen C. Kleberg Foundation; National Institutes of Health (NIH) grants RO1-CA64140, RO1-CA112005, and RO1-HL088494 (S.W.H.); the Leukemia and Lymphoma Society postdoctoral fellowship 5074-03 (B.J.C.); and T32CA009385-24 (M.A.S.).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Department of Biochemistry, 512 Preston Research Building, Vanderbilt University School of Medicine, 23rd and Pierce Ave., Nashville, TN 37232. Phone: (615) 936-3582. Fax: (615) 936-1790. E-mail: scott.hiebert{at}vanderbilt.edu Back

{triangledown} Published ahead of print on 18 August 2008. Back

{dagger} Supplemental material for this article may be found at http://mcb.asm.org/. Back

{ddagger} These authors contributed equally to this study. Back

§ Present address: Abbott Laboratories, Abbott Park, IL. Back

Present address: University of North Carolina, Chapel Hill, NC. Back


arrow
REFERENCES
 
    1
  1. Amann, J. M., B. J. Chyla, T. C. Ellis, A. Martinez, A. C. Moore, J. L. Franklin, L. McGhee, S. Meyers, J. E. Ohm, K. S. Luce, A. J. Ouelette, M. K. Washington, M. A. Thompson, D. King, S. Gautam, R. J. Coffey, R. H. Whitehead, and S. W. Hiebert. 2005. Mtgr1 is a transcriptional corepressor that is required for maintenance of the secretory cell lineage in the small intestine. Mol. Cell. Biol. 25:9576-9585.[Abstract/Free Full Text]
    2. 2
  2. Amann, J. M., J. Nip, D. K. Strom, B. Lutterbach, H. Harada, N. Lenny, J. R. Downing, S. Meyers, and S. W. Hiebert. 2001. ETO, a target of t(8;21) in acute leukemia, makes distinct contacts with multiple histone deacetylases and binds mSin3A through its oligomerization domain. Mol. Cell. Biol. 21:6470-6483.[Abstract/Free Full Text]
    3. 3
  3. Bilousova, G., A. Marusyk, C. C. Porter, R. D. Cardiff, and J. DeGregori. 2005. Impaired DNA replication within progenitor cell pools promotes leukemogenesis. PLoS Biol. 3:e401.[CrossRef][Medline]
    4. 4
  4. Brown, G. E., and G. M. Roth. 1928. The reduction of hypercalcemia in cases of polycythemia vera by phenylhydrazine. J. Clin. Investig. 6:159-169.[CrossRef][Medline]
    5. 5
  5. Bryder, D., D. J. Rossi, and I. L. Weissman. 2006. Hematopoietic stem cells: the paradigmatic tissue-specific stem cell. Am. J. Pathol. 169:338-346.[Abstract/Free Full Text]
    6. 6
  6. Burel, S. A., N. Harakawa, L. Zhou, T. Pabst, D. G. Tenen, and D. E. Zhang. 2001. Dichotomy of AML1-ETO functions: growth arrest versus block of differentiation. Mol. Cell. Biol. 21:5577-5590.[Abstract/Free Full Text]
    7. 7
  7. Calabi, F., R. Pannell, and G. Pavloska. 2001. Gene targeting reveals a crucial role for MTG8 in the gut. Mol. Cell. Biol. 21:5658-5666.[Abstract/Free Full Text]
    8. 8
  8. Calvano, S. E., W. Xiao, D. R. Richards, R. M. Felciano, H. V. Baker, R. J. Cho, R. O. Chen, B. H. Brownstein, J. P. Cobb, S. K. Tschoeke, C. Miller-Graziano, L. L. Moldawer, M. N. Mindrinos, R. W. Davis, R. G. Tompkins, and S. F. Lowry. 2005. A network-based analysis of systemic inflammation in humans. Nature 437:1032-1037.[CrossRef][Medline]
    9. 9
  9. Chevallier, N., C. M. Corcoran, C. Lennon, E. Hyjek, A. Chadburn, V. J. Bardwell, J. D. Licht, and A. Melnick. 2004. ETO protein of t(8;21) AML is a corepressor for Bcl-6 B-cell lymphoma oncoprotein. Blood 103:1454-1463.
    10. 10
  10. Curtis, D. J., M. A. Hall, L. J. Van Stekelenburg, L. Robb, S. M. Jane, and C. G. Begley. 2004. SCL is required for normal function of short-term repopulating hematopoietic stem cells. Blood 103:3342-3348.
    11. 11
  11. Davis, J. N., L. McGhee, and S. Meyers. 2003. The ETO (MTG8) gene family. Gene 303:1-10.[CrossRef][Medline]
    12. 12
  12. Davis, J. N., B. J. Williams, J. T. Herron, F. J. Galiano, and S. Meyers. 1999. ETO-2, a new member of the ETO-family of nuclear proteins. Oncogene 18:1375-1383.[CrossRef][Medline]
    13. 13
  13. Duan, Z., and M. Horwitz. 2003. Gfi-1 oncoproteins in hematopoiesis. Hematology 8:339-344.[CrossRef][Medline]
    14. 14
  14. Duan, Z., and M. Horwitz. 2003. Targets of the transcriptional repressor oncoprotein Gfi-1. Proc. Natl. Acad. Sci. USA 100:5932-5937.[Abstract/Free Full Text]
    15. 15
  15. Duprez, E., K. Wagner, H. Koch, and D. G. Tenen. 2003. C/EBPbeta: a major PML-RARA-responsive gene in retinoic acid-induced differentiation of APL cells. EMBO J. 22:5806-5816.[CrossRef][Medline]
    16. 16
  16. Erickson, P., J. Gao, K. S. Chang, T. Look, E. Whisenant, S. Raimondi, R. Lasher, J. Trujillo, J. Rowley, and H. Drabkin. 1992. Identification of breakpoints in t(8;21) acute myelogenous leukemia and isolation of a fusion transcript, AML1/ETO, with similarity to Drosophila segmentation gene, runt. Blood 80:1825-1831.[Abstract/Free Full Text]
    17. 17
  17. Gamou, T., E. Kitamura, F. Hosoda, K. Shimizu, K. Shinohara, Y. Hayashi, T. Nagase, Y. Yokoyama, and M. Ohki. 1998. The partner gene of AML1 in t(16;21) myeloid malignancies is a novel member of the MTG8(ETO) family. Blood 91:4028-4037.[Abstract/Free Full Text]
    18. 18
  18. Gelmetti, V., J. Zhang, M. Fanelli, S. Minucci, P. G. Pelicci, and M. A. Lazar. 1998. Aberrant recruitment of the nuclear receptor corepressor-histone deacetylase complex by the acute myeloid leukemia fusion partner ETO. Mol. Cell. Biol. 18:7185-7191.[Abstract/Free Full Text]
    19. 19
  19. Gery, S., A. F. Gombart, Y. K. Fung, and H. P. Koeffler. 2004. C/EBPepsilon interacts with retinoblastoma and E2F1 during granulopoiesis. Blood 103:828-835.
    20. 20
  20. Goardon, N., J. A. Lambert, P. Rodriguez, P. Nissaire, S. Herblot, P. Thibault, D. Dumenil, J. Strouboulis, P. H. Romeo, and T. Hoang. 2006. ETO2 coordinates cellular proliferation and differentiation during erythropoiesis. EMBO J. 25:357-366.[CrossRef][Medline]
    21. 21
  21. Hall, M. A., D. J. Curtis, D. Metcalf, A. G. Elefanty, K. Sourris, L. Robb, J. R. Gothert, S. M. Jane, and C. G. Begley. 2003. The critical regulator of embryonic hematopoiesis, SCL, is vital in the adult for megakaryopoiesis, erythropoiesis, and lineage choice in CFU-S12. Proc. Natl. Acad. Sci. USA 100:992-997.[Abstract/Free Full Text]
    22. 22
  22. Hall, M. A., N. J. Slater, C. G. Begley, J. M. Salmon, L. J. Van Stekelenburg, M. P. McCormack, S. M. Jane, and D. J. Curtis. 2005. Functional but abnormal adult erythropoiesis in the absence of the stem cell leukemia gene. Mol. Cell. Biol. 25:6355-6362.[Abstract/Free Full Text]
    23. 23
  23. Hildebrand, D., J. Tiefenbach, T. Heinzel, M. Grez, and A. B. Maurer. 2001. Multiple regions of eto cooperate in transcriptional repression. J. Biol. Chem. 276:9889-9895.[Abstract/Free Full Text]
    24. 24
  24. Hock, H., M. J. Hamblen, H. M. Rooke, D. Traver, R. T. Bronson, S. Cameron, and S. H. Orkin. 2003. Intrinsic requirement for zinc finger transcription factor Gfi-1 in neutrophil differentiation. Immunity 18:109-120.[CrossRef][Medline]
    25. 25
  25. Hope, K. J., L. Jin, and J. E. Dick. 2003. Human acute myeloid leukemia stem cells. Arch. Med. Res. 34:507-514.[CrossRef][Medline]
    26. 26
  26. Ibanez, V., A. Sharma, S. Buonamici, A. Verma, S. Kalakonda, J. Wang, S. Kadkol, and Y. Saunthararajah. 2004. AML1-ETO decreases ETO-2 (MTG16) interactions with nuclear receptor corepressor, an effect that impairs granulocyte differentiation. Cancer Res. 64:4547-4554.[Abstract/Free Full Text]
    27. 27
  27. Ivins, S., K. Pemberton, F. Guidez, L. Howell, R. Krumlauf, and A. Zelent. 2003. Regulation of Hoxb2 by APL-associated PLZF protein. Oncogene 22:3685-3697.[CrossRef][Medline]
    28. 28
  28. Jegalian, A. G., and H. Wu. 2002. Regulation of Socs gene expression by the proto-oncoprotein GFI-1B: two routes for STAT5 target gene induction by erythropoietin. J. Biol. Chem. 277:2345-2352.[Abstract/Free Full Text]
    29. 29
  29. Karsunky, H., H. Zeng, T. Schmidt, B. Zevnik, R. Kluge, K. W. Schmid, U. Duhrsen, and T. Moroy. 2002. Inflammatory reactions and severe neutropenia in mice lacking the transcriptional repressor Gfi1. Nat. Genet. 30:295-300.[CrossRef][Medline]
    30. 30
  30. Kitabayashi, I., K. Ida, F. Morohoshi, A. Yokoyama, N. Mitsuhashi, K. Shimizu, N. Nomura, Y. Hayashi, and M. Ohki. 1998. The AML1-MTG8 leukemic fusion protein forms a complex with a novel member of the MTG8(ETO/CDR) family, MTGR1. Mol. Cell. Biol. 18:846-858.[Abstract/Free Full Text]
    31. 31
  31. Kochetkova, M., O. L. McKenzie, A. J. Bais, J. M. Martin, G. A. Secker, R. Seshadri, J. A. Powell, S. J. Hinze, A. E. Gardner, H. E. Spendlove, N. J. O'Callaghan, A. M. Cleton-Jansen, C. Cornelisse, S. A. Whitmore, J. Crawford, G. Kremmidiotis, G. R. Sutherland, and D. F. Callen. 2002. CBFA2T3 (MTG16) is a putative breast tumor suppressor gene from the breast cancer loss of heterozygosity region at 16q24.3. Cancer Res. 62:4599-4604.[Abstract/Free Full Text]
    32. 32
  32. Leone, G., J. DeGregori, R. Sears, L. Jakoi, and J. R. Nevins. 1997. Myc and Ras collaborate in inducing accumulation of active cyclin E/Cdk2 and E2F. Nature 387:422-426.[CrossRef][Medline]
    33. 33
  33. Lindberg, S. R., A. Olsson, A. M. Persson, and I. Olsson. 2005. The leukemia-associated ETO homologues are differently expressed during hematopoietic differentiation. Exp. Hematol. 33:189-198.[CrossRef][Medline]
    34. 34
  34. Linggi, B. E., S. J. Brandt, Z. W. Sun, and S. W. Hiebert. 2005. Translating the histone code into leukemia. J. Cell. Biochem. 96:938-950.[CrossRef][Medline]
    35. 35
  35. Look, A. T. 1997. Oncogenic transcription factors in the human acute leukemias. Science 278:1059-1064.[Abstract/Free Full Text]
    36. 36
  36. Lutterbach, B., J. J. Westendorf, B. Linggi, A. Patten, M. Moniwa, J. R. Davie, K. D. Huynh, V. J. Bardwell, R. M. Lavinsky, M. G. Rosenfeld, C. Glass, E. Seto, and S. W. Hiebert. 1998. ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors. Mol. Cell. Biol. 18:7176-7184.[Abstract/Free Full Text]
    37. 37
  37. Marine, J. C., C. McKay, D. Wang, D. J. Topham, E. Parganas, H. Nakajima, H. Pendeville, H. Yasukawa, A. Sasaki, A. Yoshimura, and J. N. Ihle. 1999. SOCS3 is essential in the regulation of fetal liver erythropoiesis. Cell 98:617-627.[CrossRef][Medline]
    38. 38
  38. Martinez, J. A., C. S. Williams, J. M. Amann, T. C. Ellis, I. Moreno-Miralles, M. K. Washington, P. Gregoli, and S. W. Hiebert. 2006. Deletion of Mtgr1 sensitizes the colonic epithelium to dextran sodium sulfate-induced colitis. Gastroenterology 131:579-588.[Medline]
    39. 39
  39. McGhee, L., J. Bryan, L. Elliott, H. L. Grimes, A. Kazanjian, J. N. Davis, and S. Meyers. 2003. Gfi-1 attaches to the nuclear matrix, associates with ETO (MTG8) and histone deacetylase proteins, and represses transcription using a TSA-sensitive mechanism. J. Cell. Biochem. 89:1005-1018.[CrossRef][Medline]
    40. 40
  40. Melnick, A. M., J. J. Westendorf, A. Polinger, G. W. Carlile, S. Arai, H. J. Ball, B. Lutterbach, S. W. Hiebert, and J. D. Licht. 2000. The ETO protein disrupted in t(8;21)-associated acute myeloid leukemia is a corepressor for the promyelocytic leukemia zinc finger protein. Mol. Cell. Biol. 20:2075-2086.[Abstract/Free Full Text]
    41. 41
  41. Metcalf, D., C. J. Greenhalgh, E. Viney, T. A. Willson, R. Starr, N. A. Nicola, D. J. Hilton, and W. S. Alexander. 2000. Gigantism in mice lacking suppressor of cytokine signalling-2. Nature 405:1069-1073.[CrossRef][Medline]
    42. 42
  42. Mikkola, H. K., J. Klintman, H. Yang, H. Hock, T. M. Schlaeger, Y. Fujiwara, and S. H. Orkin. 2003. Haematopoietic stem cells retain long-term repopulating activity and multipotency in the absence of stem-cell leukaemia SCL/tal-1 gene. Nature 421:547-551.[CrossRef][Medline]
    43. 43
  43. Miyoshi, H., T. Kozu, K. Shimizu, K. Enomoto, N. Maseki, Y. Kaneko, N. Kamada, and M. Ohki. 1993. The t(8;21) translocation in acute myeloid leukemia results in production of an AML1-MTG8 fusion transcript. EMBO J. 12:2715-2721.[Medline]
    44. 44
  44. Miyoshi, H., K. Shimizu, T. Kozu, N. Maseki, Y. Kaneko, and M. Ohki. 1991. t(8;21) breakpoints on chromosome 21 in acute myeloid leukemia are clustered within a limited region of a single gene, AML1. Proc. Natl. Acad. Sci. USA 88:10431-10434.[Abstract/Free Full Text]
    45. 45
  45. Na Nakorn, T., D. Traver, I. L. Weissman, and K. Akashi. 2002. Myeloerythroid-restricted progenitors are sufficient to confer radioprotection and provide the majority of day 8 CFU-S. J. Clin. Investig. 109:1579-1585.[CrossRef][Medline]
    46. 46
  46. O'Hagan, R. C., M. Ohh, G. David, I. M. de Alboran, F. W. Alt, W. G. Kaelin, Jr., and R. A. DePinho. 2000. Myc-enhanced expression of Cul1 promotes ubiquitin-dependent proteolysis and cell cycle progression. Genes Dev. 14:2185-2191.[Abstract/Free Full Text]
    47. 47
  47. Okuda, T., Z. Cai, S. Yang, N. Lenny, C. J. Lyu, J. M. van Deursen, H. Harada, and J. R. Downing. 1998. Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood 91:3134-3143.[Abstract/Free Full Text]
    48. 48
  48. Pabst, T., B. U. Mueller, P. Zhang, H. S. Radomska, S. Narravula, S. Schnittger, G. Behre, W. Hiddemann, and D. G. Tenen. 2001. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat. Genet. 27:263-270.[CrossRef][Medline]
    49. 49
  49. Person, R. E., F. Q. Li, Z. Duan, K. F. Benson, J. Wechsler, H. A. Papadaki, G. Eliopoulos, C. Kaufman, S. J. Bertolone, B. Nakamoto, T. Papayannopoulou, H. L. Grimes, and M. Horwitz. 2003. Mutations in proto-oncogene GFI1 cause human neutropenia and target ELA2. Nat. Genet. 34:308-312.[CrossRef][Medline]
    50. 50
  50. Porse, B. T., D. Bryder, K. Theilgaard-Monch, M. S. Hasemann, K. Anderson, I. Damgaard, S. E. Jacobsen, and C. Nerlov. 2005. Loss of C/EBP alpha cell cycle control increases myeloid progenitor proliferation and transforms the neutrophil granulocyte lineage. J. Exp. Med. 202:85-96.[Abstract/Free Full Text]
    51. 51
  51. Porse, B. T., T. A. Pedersen, X. Xu, B. Lindberg, U. M. Wewer, L. Friis-Hansen, and C. Nerlov. 2001. E2F repression by C/EBPalpha is required for adipogenesis and granulopoiesis in vivo. Cell 107:247-258.[CrossRef][Medline]
    52. 52
  52. Rochford, J. J., R. K. Semple, M. Laudes, K. B. Boyle, C. Christodoulides, C. Mulligan, C. J. Lelliott, S. Schinner, D. Hadaschik, M. Mahadevan, J. K. Sethi, A. Vidal-Puig, and S. O'Rahilly. 2004. ETO/MTG8 is an inhibitor of C/EBPbeta activity and a regulator of early adipogenesis. Mol. Cell. Biol. 24:9863-9872.[Abstract/Free Full Text]
    53. 53
  53. Rowley, J. D. 1999. The role of chromosome translocations in leukemogenesis. Semin. Hematol. 36:59-72.[Medline]
    54. 54
  54. Saleque, S., S. Cameron, and S. H. Orkin. 2002. The zinc-finger proto-oncogene Gfi-1b is essential for development of the erythroid and megakaryocytic lineages. Genes Dev. 16:301-306.[Abstract/Free Full Text]
    55. 55
  55. Schuh, A. H., A. J. Tipping, A. J. Clark, I. Hamlett, B. Guyot, F. J. Iborra, P. Rodriguez, J. Strouboulis, T. Enver, P. Vyas, and C. Porcher. 2005. ETO-2 associates with SCL in erythroid cells and megakaryocytes and provides repressor functions in erythropoiesis. Mol. Cell. Biol. 25:10235-10250.[Abstract/Free Full Text]
    56. 56
  56. Schwartz, R., I. Engel, M. Fallahi-Sichani, H. T. Petrie, and C. Murre. 2006. Gene expression patterns define novel roles for E47 in cell cycle progression, cytokine-mediated signaling, and T lineage development. Proc. Natl. Acad. Sci. USA 103:9976-9981.[Abstract/Free Full Text]
    57. 57
  57. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13:199-212.[CrossRef][Medline]
    58. 58
  58. Shroyer, N. F., D. Wallis, K. J. Venken, H. J. Bellen, and H. Y. Zoghbi. 2005. Gfi1 functions downstream of Math1 to control intestinal secretory cell subtype allocation and differentiation. Genes Dev. 19:2412-2417.[Abstract/Free Full Text]
    59. 59
  59. Sjoblom, T., S. Jones, L. D. Wood, D. W. Parsons, J. Lin, T. D. Barber, D. Mandelker, R. J. Leary, J. Ptak, N. Silliman, S. Szabo, P. Buckhaults, C. Farrell, P. Meeh, S. D. Markowitz, J. Willis, D. Dawson, J. K. Willson, A. F. Gazdar, J. Hartigan, L. Wu, C. Liu, G. Parmigiani, B. H. Park, K. E. Bachman, N. Papadopoulos, B. Vogelstein, K. W. Kinzler, and V. E. Velculescu. 2006. The consensus coding sequences of human breast and colorectal cancers. Science 314:268-274.[Abstract/Free Full Text]
    60. 60
  60. Strom, D. K., J. Nip, J. J. Westendorf, B. Linggi, B. Lutterbach, J. R. Downing, N. Lenny, and S. W. Hiebert. 2000. Expression of the AML-1 oncogene shortens the G(1) phase of the cell cycle. J. Biol. Chem. 275:3438-3445.[Abstract/Free Full Text]
    61. 61
  61. Tybulewicz, V. L., C. E. Crawford, P. K. Jackson, R. T. Bronson, and R. C. Mulligan. 1991. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65:1153-1163.[CrossRef][Medline]
    62. 62
  62. Vangala, R. K., M. S. Heiss-Neumann, J. S. Rangatia, S. M. Singh, C. Schoch, D. G. Tenen, W. Hiddemann, and G. Behre. 2003. The myeloid master regulator transcription factor PU.1 is inactivated by AML1-ETO in t(8;21) myeloid leukemia. Blood 101:270-277.
    63. 63
  63. Wang, J., T. Hoshino, R. L. Redner, S. Kajigaya, and J. M. Liu. 1998. ETO, fusion partner in t(8;21) acute myeloid leukemia, represses transcription by interaction with the human N-CoR/mSin3/HDAC1 complex. Proc. Natl. Acad. Sci. USA 95:10860-10865.[Abstract/Free Full Text]
    64. 64
  64. Wang, X., and B. Seed. 2003. A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res. 31:e154.[Abstract/Free Full Text]
    65. 65
  65. Yang, L., D. Bryder, J. Adolfsson, J. Nygren, R. Mansson, M. Sigvardsson, and S. E. Jacobsen. 2005. Identification of Lin(-)Sca1(+)kit(+)CD34(+)Flt3-short-term hematopoietic stem cells capable of rapidly reconstituting and rescuing myeloablated transplant recipients. Blood 105:2717-2723.
    66. 66
  66. Yang, W., J. Shen, M. Wu, M. Arsura, M. FitzGerald, Z. Suldan, D. W. Kim, C. S. Hofmann, S. Pianetti, R. Romieu-Mourez, L. P. Freedman, and G. E. Sonenshein. 2001. Repression of transcription of the p27(Kip1) cyclin-dependent kinase inhibitor gene by c-Myc. Oncogene 20:1688-1702.[CrossRef][Medline]
    67. 67
  67. Yergeau, D. A., C. J. Hetherington, Q. Wang, P. Zhang, A. H. Sharpe, M. Binder, M. Marin-Padilla, D. G. Tenen, N. A. Speck, and D. E. Zhang. 1997. Embryonic lethality and impairment of haematopoiesis in mice heterozygous for an AML1-ETO fusion gene. Nat. Genet. 15:303-306.[CrossRef][Medline]
    68. 68
  68. Zhang, J., M. Kalkum, S. Yamamura, B. T. Chait, and R. G. Roeder. 2004. E protein silencing by the leukemogenic AML1-ETO fusion protein. Science 305:1286-1289.[Abstract/Free Full Text]

Molecular and Cellular Biology, October 2008, p. 6234-6247, Vol. 28, No. 20
0270-7306/08/$08.00+0     doi:10.1128/MCB.00404-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.



This article has been cited by other articles:

  • Guo, C., Hu, Q., Yan, C., Zhang, J. (2009). Multivalent Binding of the ETO Corepressor to E Proteins Facilitates Dual Repression Controls Targeting Chromatin and the Basal Transcription Machinery. Mol. Cell. Biol. 29: 2644-2657 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental material
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chyla, B. J.
Right arrow Articles by Hiebert, S. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chyla, B. J.
Right arrow Articles by Hiebert, S. W.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»