This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ning, S.
Right arrow Articles by Pagano, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ning, S.
Right arrow Articles by Pagano, J. S.

 Previous Article

Molecular and Cellular Biology, October 2008, p. 6536-6546, Vol. 28, No. 20
0270-7306/08/$08.00+0     doi:10.1128/MCB.00785-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.

TRAF6 and the Three C-Terminal Lysine Sites on IRF7 Are Required for Its Ubiquitination-Mediated Activation by the Tumor Necrosis Factor Receptor Family Member Latent Membrane Protein 1{triangledown}

Shunbin Ning,1 Alex D. Campos,3 Bryant G. Darnay,3 Gretchen L. Bentz,1 and Joseph S. Pagano1,2*

Lineberger Comprehensive Cancer Center,1 Department of Microbiology and Immunology and Department of Medicine, University of North Carolina, School of Medicine, Chapel Hill, North Carolina 27599,2 Department of Experimental Therapeutics, University of Texas M. D. Anderson Cancer Center, Houston, Texas 770303

Received 15 May 2008/ Returned for modification 20 June 2008/ Accepted 30 July 2008


arrow
ABSTRACT
 
We have recently shown that interferon regulatory factor 7 (IRF7) is activated by Epstein-Barr virus latent membrane protein 1 (LMP1), a member of the tumor necrosis factor receptor (TNFR) superfamily, through receptor-interacting protein-dependent K63-linked ubiquitination (L. E. Huye, S. Ning, M. Kelliher, and J. S. Pagano, Mol. Cell. Biol. 27:2910-2918, 2007). In this study, with the use of small interfering RNA and TNFR-associated factor 6 (TRAF6) knockout cells, we first show that TRAF6 and its E3 ligase activity are required for LMP1-stimulated IRF7 ubiquitination. In Raji cells which are latently infected and express high levels of LMP1 and IRF7 endogenously, expression of a TRAF6 small hairpin RNA construct reduces endogenous ubiquitination and endogenous activity of IRF7. In TRAF6–/– mouse embryonic fibroblasts, reconstitution with TRAF6 expression, but not with TRAF6(C70A), which lacks the E3 ligase activity, recovers LMP1's ability to stimulate K63-linked ubiquitination of IRF7. Further, we identify IRF7 as a substrate for TRAF6 E3 ligase and show that IRF7 is ubiquitinated by TRAF6 at multiple sites both in vitro and in vivo. Most important, we determine that the last three C-terminal lysine sites (positions 444, 446, and 452) of human IRF7 variant A are essential for activation of IRF7; these are the first such sites identified. A ubiquitination-deficient mutant of IRF7 with these sites mutated to arginines completely loses transactivational ability in response not only to LMP1 but also to the IRF7 kinase I{kappa}B kinase {varepsilon}. In addition, we find that K63-linked ubiquitination of IRF7 occurs independently of its C-terminal functional phosphorylation sites. These data support our hypothesis that regulatory ubiquitination of IRF7 is a prerequisite for its phosphorylation. This is the first evidence to imply that ubiquitination is required for phosphorylation and activation of a transcription factor.


arrow
INTRODUCTION
 
Intracellular signaling initiated by latent membrane protein 1 (LMP1), the principal oncoprotein of the human gammaherpesvirus Epstein-Barr virus (EBV), is of interest not only for viral oncogenesis but also for the reason that LMP1 shares early steps in pathways used by CD40, interleukin-1 (IL-1) receptor-Toll-like receptor (TLR), and tumor necrosis factor receptor (TNFR) for activation of NF{kappa}B (reviewed in references 16 and 35). As a member of the TNFR superfamily, LMP1 recruits TNFR-associated death domain protein, TNFR-interacting protein (RIP), and several TNFR-associated factors (TRAFs). Unlike CD40 and receptor activator of NF-{kappa}B (RANK), which contain TRAF6-binding sites, LMP1 does not have a consensus TRAF6-binding sequence but associates with TRAF6 indirectly (reviewed in references 8, 16, 35, 51, and 61).

Ubiquitination through K48-polyubiquitin linkage is well known as a process whereby proteins are targeted for proteasomal degradation. Recently, proteasome-independent functions for ubiquitination through K63 polyubiquitin or monoubiquitin linkages have been identified, and the importance of these ubiquitination events in a variety of cellular processes, including receptor internalization, vesicle trafficking, DNA repair, stress responses, and protein kinase activation, is becoming increasingly recognized (reviewed in references 3, 15, 32, 42, and 52). Although TRAF6 is the only TRAF family member which is essential for signaling from both the TNFR superfamily and the IL-1 receptor-TLR superfamily, which control both innate and adaptive immune responses (reviewed in references 7, 11, 28, 55, and 61), the mechanisms of TRAF6 action in these physiological processes have been elusive until recent findings that unveiled its E3 ligase activity for K63-linked ubiquitination in the activation of I{kappa}B kinase (IKK) for NF{kappa}B activation (14, 58). Besides TRAF6, TRAF2, TRAF7, TRAF3, and probably TRAF5 have also been shown to function as E3 ubiquitin (Ub) ligases. TRAF2, TRAF3 (31), TRAF6, and probably TRAF5 and TRAF7 (6) can act for K63-linked ubiquitination.

The interferon (IFN) regulatory factor (IRF) family has a variety of functions. Besides regulation of expression of IFNs, IRFs also play roles in oncogenesis (reviewed in references 53 and 54); in regulation of differentiation of hematopoietic cells, the cell cycle, and apoptosis (54); and in regulation of many autoimmune diseases, such as systemic lupus erythematosus, psoriasis, and type I diabetes (2, 43). Recognition of the centrality of IRF7 (66) in host immune defenses is highlighted by recent discoveries that identify IRF7 as the master regulator of all IFN-I-dependent immune responses (24) and activation of IRF7 triggered by intracellular TLRs and RIG-I-like receptors (reviewed in references 12, 21, 29, 55, 63, and 64). How IRF7 is activated is therefore of central importance, and activation of this protein by phosphorylation has been studied for some years. In recent years, TRAF6 and TRAF3 have been shown to play critical roles in TLR signaling for activation of IRF3/7 (reviewed in references 22 and 55). Further, TRAF6 (30)- and TRAF3 (31)-mediated ubiquitination has been shown to be involved in this process.

Recently, we have demonstrated that K63-linked ubiquitination of both IRF7 and RIP promotes the interaction of these two proteins and causes functional activation of IRF7 (27). That TRAF6 mediates ubiquitination of IRF7 by LMP1 was suggested by observations from promoter-reporter assays with a TRAF6 dominant-negative mutant but remained to be established (27). Moreover, the interdependence between ubiquitination and phosphorylation, if any, has been unexplored. Here, we prove that TRAF6 is in fact required for LMP1-stimulated transcriptional activity of IRF7 by acting as an E3 ligase responsible for regulatory ubiquitination of IRF7. Furthermore, we identify three key lysine sites which are critical for IRF7 activation in response to LMP1 and IKK{varepsilon}, implying that ubiquitination on these sites is a prelude to phosphorylation of IRF7.


arrow
MATERIALS AND METHODS
 
Cell lines and antibodies. Raji is an EBV-infected human Burkitt's lymphoma B-cell line with type III latency. 293 and 293T cells were derived from human kidney epithelial cells. TRAF6+/+ and TRAF6–/– mouse embryonic fibroblasts (MEFs) were gifts from Tak Mak (39). Raji cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum plus antibiotics, and 293 cells and MEFs were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum plus antibiotics.

Monoclonal TRAF6, Myc (5E10), Ub, hemagglutinin (HA), and His antibodies and polyclonal or monoclonal IRF7 and Ubc13 antibodies were purchased from Santa Cruz. Monoclonal Flag (M2) and tubulin antibodies were purchased from Sigma.

Constructs. pcDNA3.1-TRAF6 was a gift from Arnd Kieser (47). HA-Ub and HA-K63Ub were gifts from David Boone and Averil Ma (5). IFN-{alpha}4 promoter-Luc (IFN-{alpha}4p-Luc), Flag-IRF7, and its mutant Flag-IRF7(477A/479A) were gifts from Rongtuan Lin and John Hiscott (37). pcDNA3-LMP1 and Flag-LMP1 were kindly provided by Nancy Raab-Traub (41). The Renilla (pRL-TK) expression construct was purchased from Promega. All other constructs and mutants were made by subcloning or site-directed mutagenesis (Stratagene) and verified by sequencing.

RNA interference. The four 19-nucleotide oligonucleotides for small interfering RNA (siRNA) targeted to human Ubc13 have been described previously (68) and were synthesized (Invitrogen). The oligonucleotides of small interfering TRAF6 targeting human TRAF6 (GenBank accession numbers NM_004620 and NM_145803) were purchased from Dharmacon; the sequences are GGAGAAACCUGUUGUGAUUUU (sense) and AAUCACAACAGGUUUCUCCUU (antisense). The control siRNA, a scrambled sequence without specific targeted degradation of any known cellular mRNA, was purchased from Santa Cruz. These siRNAs were transfected into 293 cells in 12-well plates with the use of Lipofectamine 2000 according to the manufacturer's instructions.

Generation of stable TRAF shRNA (shTRAF6)-expressing Raji cell lines. The two complementary oligonucleotides for generating small hairpin RNA (shRNA) targeting TRAF6 are as follows: sense, 5'-gatccccCCACGAAGAGATAATGGATttcaagagaATCCATTATCTCTTCGTGGtttttggaaa-3'; and antisense, 5'-tcgatttccaaaaaCCACGAAGAGATAATGGATtctcttgaaATCCATTATCTCTTCGTGGggg-3'. For the negative control, the sequence targeting TRAF6 was scrambled to 5'-GCAAGCGAATCGATAAGTA-3', which does not target any human gene. These sequences were synthesized, annealed, and inserted at the BglII/XhoI sites of the pSuper.Retro/Puro vector driven by the human H1 gene promoter (OligoEngine Inc.). Retroviral production and infection of Raji cells were performed as described previously (27). Stable transfectants were selected by culturing for 2 weeks in the presence of 0.5 µg/ml puromycin (Mediatech Inc., Manassas, VA).

Protein expression and purification. For FLAG elution, 293T cells were transfected with the Flag-IRF7 construct. After 48 h, cells were collected in phosphate-buffered saline solution and Dounce homogenized in 100 µl hypotonic lysis buffer (10 mM NaCl, 1.5 mM MgCl2, 10 mM Tris, pH 7.5, and complete protease inhibitor cocktail [Roche]). Supernatant fluids were denatured at 95°C for 5 min with addition of sodium dodecyl sulfate (SDS) to give a final concentration of 1% and then diluted 10-fold with dilution buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and complete protease inhibitors) and immunoprecipitated with anti-FLAG affinity gel (Sigma) overnight (59). Samples were eluted with 300 µg/ml FLAG peptide (Sigma) according to the manufacturer's instructions.

Protein expression and purification from Escherichia coli were performed as described previously for His-tagged proteins (17) or for glutathione S-transferase (GST)-tagged proteins (34).

In vitro and in vivo ubiquitination assays. In vitro ubiquitination assays using His-TRAF6 and Flag-IRF7 were performed as described previously (59). For GST-tagged proteins, purified GST-TRAF6 and GST-IRF7-Flag or their mutants were incubated for 3 h at 37°C in 20 µl of a reaction buffer (20 mM HEPES [pH 7.4], 10 mM MgCl2, 1 mM dithiothreitol [DTT], 59 µM Ub, 50 nM E1, 850 nM of Ubc13-UeV1a, 1 mM ATP, 30 µM creatine phosphate, and 1 U of creatine kinase). After incubation, the beads were washed five times in buffer A (20 mM Tris, pH 7.4, 250 mM NaCl, 1 mM DTT, 1 mM sodium orthovanadate, 2 mM EDTA, 1% Triton X-100) and two times in low-salt buffer (20 mM Tris, pH 7.4, 25 mM NaCl, 1 mM DTT). Beads were then resuspended in 1% SDS (in water) and boiled for 10 min. Dissociated proteins were diluted 50 µl twice, each with 600 µl buffer A, and supernatant fluid was precleared with protein A/G beads (Santa Cruz) for 1 h and immunoprecipitated overnight with 1 µg anti-Flag M2, after which protein A/G beads were added for an additional 1 h. Beads were washed four times with buffer A and two times with low-salt buffer before Western blotting.

For the in vivo ubiquitination assay, 293 cells in six-well plates were transfected with 0.5 µg HA-Ub, 0.6 µg pCR3-FlagTRAF6, and 1.0 µg pcDNA3-IRF7 by using CalPho transfection reagent (Clontech). Cells were harvested after 36 h and lysed in 200 µl of buffer A with the addition of 10 mM N-ethylmaleimide for 30 min on ice. Three hundred micrograms of total proteins was used for immunoprecipitation (IP), and 30 µg was used for input controls. Lysates for IP were diluted with 1.2 ml of buffer A, and IP was performed with 2 µg anti-IRF7 and protein A/G-Sepharose beads (Santa Cruz) for 4 h. Beads were washed four times in buffer A and two times with low-salt buffer denatured in 50 µl of 1% SDS. A second IP was performed as described above with 1 µg anti-IRF7 and protein A/G beads overnight. Beads were washed four times with buffer A and two times with low-salt buffer before Western blotting with anti-HA.

RNA extraction and RT-PCR. RNA was extracted with the use of a Qiagen mini-RNA preparation kit, following the manufacturer's instructions. Reverse transcription (RT)-PCR was performed with the use of an RT-PCR system (Promega). cDNA products were diluted five times. Five microliters of diluted cDNA was used for IFN-stimulated gene 56 (ISG56) and IRF7 and 2 µl for actin. The primers used for PCR are as follows: for IRF7, CGCGGCACTAACGACAGGCGAG (forward) and GCTGCCGTGCCCGGAATTCCAC) (reverse); for ISG56, CCAGCGCTGGGTATGCGATCTCTGCC (forward) and GGGCCCGCTCATAGTACTCCAGGGC (reverse); and for actin, ACAATGAGCTGCTGGTGGCT (forward) and GATGGGCACAGTGTGGGTGA (reverse). PCR was performed in the linear range (30 cycles) at an annealing temperature of 60°C.

Transfection, reconstitution, IP, and immunoblotting. 293 cells were transfected with Effectene reagent (Invitrogen), and MEFs were transfected with an Amaxa Nucleofector II MEF kit, following the manufacturer's instructions. Reconstitutions of TRAF6 knockout cells with Myc-TRAF6 or Myc-TRAF6(C70A) were completed by selection with 4 mg/ml G418 for 2 weeks after transfection.

For IP, transfected 293 cells in 60-mm dishes or MEFs from three combined transfections were collected 48 h after transfection. Except for those shown in Fig. 2B, cell lysates were denatured in 1% SDS at 95°C for 10 min to dissociate any noncovalently bound proteins and diluted 10x before IP, or a second IP was performed with immunoprecipitates denatured in 1% SDS at 95°C for 10 min (4, 33, 59). Proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes, followed by immunoblotting with the indicated antibodies, and signals were detected with an enhanced chemiluminescence kit, following the manufacturer's protocol (Amersham Pharmacia Biotech).


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 2. LMP1 activates TRAF6 and enhances its association with IRF7. (A) LMP1 activates TRAF6. Endogenous TRAF6 is activated in the presence of LMP1 and HA-K63Ub and therefore autoubiquitinated (lanes 1 and 2). 293 cells in 60-mm dishes were transfected with 0.2 µg Flag-LMP1 and 0.5 µg HA-K63Ub. Transfected cells were collected for IP after 48 h. IB, immunoblotting; {alpha}TRAF6, anti-TRAF6. (B) LMP1 enhances interaction between IRF7 and TRAF6. 293 cells in 60-mm dishes were transfected with 0.2 µg pcDNA3-LMP1, 0.5 µg Flag-TRAF6, 0.5 µg Myc-IRF7, and 0.5 µg HA-K63Ub. Cells were collected for IP after 48 h.

Luciferase assay and data analysis. Cells were transfected with the indicated expression plasmids, together with IFN-{alpha}4p-Luc. Renilla was cotransfected as an internal transfection control. Empty vector was used to equalize the total amount of DNA in all transfections. Cells were collected 24 h after transfection. Luciferase activity was measured with equal amounts (20% of the total for each sample) of protein lysates in an Lmax luminometer (Molecular Devices Corp.) with the use of a dual luciferase assay kit (Promega). The results shown are averages ± standard errors from duplicates for each sample. At least three consistent results were obtained from independent experiments, and representative results are shown. The value for the ability of the vector controls to activate IFN-{alpha}4p-Luc was set to 1.


arrow
RESULTS
 
TRAF6 activates IRF7 and enhances LMP1-promoted IRF7 activity. We propose that TRAF6 is an E3 ligase for IRF7 K63-linked ubiquitination for the following reasons: first, TRAF6 is an E3 Ub ligase for K63-linked polyubiquitination (14); second, TRAF6 is involved in LMP1 signaling (47, 57); third, TRAF6 interacts with IRF7 and activates it in response to TLR signaling (30); and last, TRAF6 can also associate with RIP, which is required for LMP1 signaling to IRF7 (27), through the adaptor protein p62 (46). However, evidence for this proposal is not complete.

Here, we first tested the effect of TRAF6 on the transcriptional activity of IRF7. Luciferase assay results show that IRF7 (Fig. 1A) is activated by TRAF6, but not by TRAF2, in a dose-dependent manner. Further, TRAF6 enhances LMP1-promoted IRF7 transcriptional activity (Fig. 1B). The results suggest that TRAF6 in involved in LMP1 activation of IRF7.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 1. TRAF6 activates IRF7 and enhances LMP1-stimulated IRF7 activity. 293 cells in 24-well plates were transfected with 10 ng IRF7, increasing amounts of TRAF6 or TRAF2 (+, 20 ng; ++, 50 ng; and +++, 100 ng) (A) or 20 ng TRAF6 and 50 ng LMP1 (B), 25 ng IFN-{alpha}4p-Luc, and 10 ng Renilla. Luciferase activity was measured 24 h after transfection. (A) TRAF6 but not TRAF2 activates IRF7 in a dose-dependent manner. (B) TRAF6 increases LMP1-stimulated IRF7 activity.

LMP1 activates TRAF6 and enhances its interaction with IRF7. Next, we inquired whether LMP1 could activate TRAF6 and enhance its interaction with IRF7. TRAF6 E3 ligase is activated after dimerization or oligomerization and targets itself as one of the substrates for K63-linked ubiquitination (58). 293 cells were transfected with constructs as indicated (Fig. 2). Cells were collected after 48 h, and lysates were denatured (Fig. 2A) or not denatured (Fig. 2B) before IP. Western blotting was performed with the antibodies as indicated. Figure 2A shows that in the absence of exogenous TRAF6, ubiquitination of endogenous TRAF6 is not detectable under our experimental conditions even with transient expression of HA-K63Ub (Fig. 2A, lane 1), but significant ubiquitination is detected in the sample transfected with both HA-K63Ub and Flag-LMP1 (Fig. 2A, lane 2). These results indicate that LMP1 activates TRAF6 and results in its auto-ubiquitination and are consistent with a previous report (50). This is not surprising, since LMP1 is able to engage TRAF6 (47) and therefore facilitates TRAF6 dimerization or oligomerization.

Figure 2B shows that some TRAF6 and IRF7 proteins become associated physically when coexpressed with K63onlyUb (Fig. 2B, lane 3), and the association was enhanced in the presence of LMP1 (Fig. 2B, lane 4). Without exogenously expressed K63onlyUb, association between TRAF6 and IRF7 is also detectable but much weaker, despite the existence of LMP1 (Fig. 2B, lanes 5 and 6). These data (Fig. 2B) indicate that association of TRAF6 and IRF7 is mediated by LMP1-stimulated ubiquitination.

TRAF6-Ubc-13-mediated ubiquitination is required for IRF7 activation by LMP1. To check if TRAF6 is responsible for LMP1-mediated ubiquitination of IRF7, we used a TRAF6–/– MEF cell line. IP with denatured proteins shows that ubiquitinated IRF7 is detected in TRAF6+/+ cells in the absence of LMP1 and greatly increased in its presence; ubiquitination of IRF7 was not detected in TRAF6–/– cells even in the presence of LMP1 under our experimental conditions (Fig. 3A).


Figure 3
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 3. TRAF6-Ubc13-mediated, LMP1-stimulated ubiquitination and transcriptional activity of IRF7. (A and B) TRAF6+/+ and TRAF6–/– MEFs (5 x 106) were transfected with 2 µg Flag-IRF7, 1 µg LMP1, 1.5 µg HA-K63Ub, and 0.5 µg TRAF6 or TRAF6(C70A). Forty-eight hours later, cells were collected for IP with denatured lysates. (A) LMP1 did not stimulate ubiquitination of IRF7 in TRAF6–/– cells. IB, immunoblotting; WB, Western blotting; {alpha}Flag, anti-Flag. (B) Ubiquitination of IRF7 in response to LMP1 is recovered in TRAF6–/– MEFs reconstituted with TRAF6 but not TRAF6(C70A). (C) Ubc13 siRNA decreases LMP1-promoted IRF7 activity. 293 cells in 12-well plates were transfected with Ubc13 siRNA with the use of Lipofectamine reagent, following the manufacturer's instructions. After 12 h, cells were transfected with 50 ng IRF7, 50 ng LMP1 or its mutants, 30 ng IFN-{alpha}4p-Luc, and 20 ng Renilla. Twelve hours later, cells were transfected with the siRNA oligonucleotides again and cultured for an additional 12 h before luciferase assays. The value for the vector control in control siRNA (siControl)-transfected cells was set to 1. (D) Endogenous Ubc13 level is reduced by expression of Ubc13 siRNA in 293 cells.

We also reconstituted TRAF6–/– MEFs with TRAF6 or TRAF6(C70A), a mutant that has lost ligase activity, and checked the ubiquitination of IRF7 by LMP1 in these cells. In TRAF6–/– MEFs reconstituted with TRAF6(C70A), IRF7 ubiquitination could not be detected even in the presence of LMP1. However, in TRAF6–/– MEFs reconstituted with TRAF6, LMP1 is able to stimulate IRF7 ubiquitination (Fig. 3B).

Ubc13 and Uev1A (or the functionally equivalent MMS2) form an E2-conjugating enzyme complex named TRAF6-regulated IKK activator 1, which functions with certain E3 Ub ligases, such as TRAF2 (49), TRAF6 (14), or RAD5 (56), to catalyze K63-linked polyubiquitination. Expression of endogenous Ubc13 (Fig. 3D) in 293 cells was reduced by RNA interference. The cells were then transfected with IRF7 and LMP1 plus Ub expression vectors. Luciferase results show that IRF7 activity stimulated by LMP1 is dramatically reduced in Ubc13 siRNA-transfected cells (Fig. 3C) as well as in small interfering TRAF6-transfected cells (data not shown). Presumably, TRAF6-mediated ubiquitination is abrogated by reducing the expression of Ubc13 (14).

Together, these results indicate that LMP1 stimulates K63-linked ubiquitination and transcriptional activity of IRF7 through TRAF6-Ubc13. Ubc13 is also involved in LMP1 activation of NF{kappa}B since a dominant-negative form of Ubc13 inhibits LMP1 activation of NF{kappa}B (40).

Endogenous IRF7 ubiquitination and activity are reduced in Raji cells stably expressing the shTRAF6 construct. Further, to confirm the requirement of TRAF6 for LMP1-stimulated ubiquitination and transcriptional activity of IRF7 in an endogenous system, we knocked down expression of TRAF6 in Raji cells by expressing an shTRAF6 construct. Raji cells are B lymphocytes with an EBV type III latency phenotype and have high levels of endogenous IRF7 and LMP1, and IRF7 in these cells is highly ubiquitinated (27). As expected, when expression of TRAF6 is reduced by shTRAF6 (Fig. 4C), endogenous IRF7 transcriptional activity is reduced up to 70% (Fig. 4A). Correspondingly, ubiquitination is also significantly reduced (Fig. 4B). These results from a complete endogenous system confirm that TRAF6 is responsible for LMP1-stimulated ubiquitination and transcriptional activity of IRF7.


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
FIG. 4. Expression of shTRAF6 in Raji cells decreases endogenous ubiquitination and activity of IRF7. Raji cells with EBV type III latency were infected with shTRAF6 retrovirus. After selection for 2 weeks, cells were collected for IP or transfected with 2 µg IFN-{alpha}4p-Luc and 1 µg Renilla constructs for a luciferase assay, performed 24 h later. (A) Endogenous IRF7 activity is decreased in shTRAF6-expressing cells. (B) Endogenous ubiquitination of IRF7 is decreased in shTRAF6-expressing cells. IB, immunoblotting; {alpha}IRF7, anti-IRF7. (C) Endogenous TRAF6 level is reduced in shTRAF6-expressing cells.

IRF7 is a substrate for TRAF6 E3 ligase. To eliminate the possibility that the ubiquitination was mediated by a Ub ligase activity other than TRAF6, we expressed and purified TRAF6 from bacteria, which lacks a Ub system (33). To eliminate the possibility that IRF7 was coprecipitated with other proteins from 293T cells, cell lysates were denatured before IP to dissociate any noncovalently bound proteins (59).

As shown in Fig. 5A, ubiquitinated IRF7 is detected only in the presence of the components His-TRAF6, Ubc13-UeV1a, and K63-Ub, not in the absence of any of these components. We also used a TRAF6 mutant, His-TRAF6(C70A), in which cysteine 70, a key residue in the RING finger for TRAF6 E3 ligase activity (14), is mutated to alanine. Replacement of His-TRAF6 with His-TRAF6(C70A) did not produce detectable ubiquitination of IRF7. The results demonstrate that TRAF6 and its E3 ligase activity are required for IRF7 ubiquitination and that IRF7 is a substrate for TRAF6 E3 ligase.


Figure 5
View larger version (32K):
[in this window]
[in a new window]

 
FIG. 5. IRF7 is a substrate for TRAF6 E3 ligase and identification of IRF7 lysine sites for ubiquitination. (A) IRF7 is a substrate for TRAF6 E3 ligase. His-TRAF6 and His-TRAF6(C70A) proteins were expressed in and purified from E. coli, and Flag-IRF7 protein was expressed in and purified from 293T cells. An in vitro ubiquitination assay was performed. After the reaction, solutions were heated in 1% SDS at 95°C to dissociate protein interactions before IP with Flag antibody. Western blotting (WB) was performed with the antibodies indicated. IB, immunoblotting; {alpha}Flag, anti-Flag. (B) Identification of IRF7 ubiquitination sites. GST-IRF7-Flag and GST-TRAF6 were purified from E. coli. An in vitro ubiquitination assay was performed (see details in Materials and Methods). Samples were separated on SDS gels and immunoblotted with Ub antibody. Blots were stripped for reprobing IRF7 with Flag antibody. WT, wild type.

Lysines 444, 446, and 452 are critical for IRF7 activation. Human IRF7 variant A has 15 lysine sites in total. To identify IRF7 ubiquitination sites, we made a panel of deletion mutants and lysine-to-arginine (K->R) point mutants and expressed and purified the mutant proteins from E. coli to test their abilities to be ubiquitinated by TRAF6 in vitro. As expected, wild-type IRF7 protein is ubiquitinated in the presence of TRAF6. Also, two deletion mutants, IRF7(1-370) and IRF7(1-442), in which amino acids 371 to 503 and 443 to 503 are deleted, respectively, are ubiquitinated, indicating that IRF7 is ubiquitinated on multiple sites by TRAF6. The increased ubiquitination of the deletion mutants may be explained by the fact that deletion mutants are often assembled into a different or misfolded conformation, leading to increased ubiquitination. Although the decrease of ubiquitination of the single mutants K444R, K446R, and K452R is not significant, due to the fact that multiple sites are ubiquitinated, the triple mutant with lysines 444, 446, and 452 mutated to arginine (K444/446/452R) has consistently displayed significant reduction in ubiquitination intensity (Fig. 5B).

We also performed in vivo ubiquitination assays with these mutants, and similar results were obtained (Fig. 6A). Thus, both in vitro and in vivo ubiquitination assays indicate that IRF7 is ubiquitinated by TRAF6 on multiple lysine sites and suggest that K444, K446, and K452 may be TRAF6-targeted ubiquitination sites. To test if these ubiquitination-deficient mutants are defective in transactivation ability, we first performed luciferase assays. As seen in Fig. 6B, wild-type IRF7 strongly transactivates the IFN-{alpha}4 promoter, and IRF with lysines 373 and 375 mutated to arginine [IRF7(K373/375R)] transactivates it as well. Strikingly, single or double ubiquitination-deficient mutations of K444, K446, or K452 dramatically reduce the ability to transactivate the IFN-{alpha}4 promoter. Consistently, IRF7(K444R) has the highest reduction and IRF7(K446R) has the lowest reduction of transcriptional activity. Impressively, the triple mutant IRF7(K444/446/452R) completely loses its ability to transactivate the promoter. We also tested the abilities of the IRF7 mutants to transactivate an endogenous IRF7 target gene by measuring ISG56 mRNA with quantitative RT-PCR. Parallel results were obtained (Fig. 6C). Wild-type IRF7 and IRF7(K373/375R) stimulate ISG56 mRNA levels substantially, but other tested ubiquitination-deficient mutants did not. IRF7(K444/446/452R) and the phosphorylation-deficient mutant IRF7(1-470), which lacks all C-terminal functional phosphorylation sites, stimulated ISG56 mRNA levels only to control levels (Fig. 6C). Thus, these three of five total lysines tested are functional ubiquitination sites on IRF7; mutation of all these three sites reduces ubiquitination of IRF7 and, correspondingly, its transactivational ability.


Figure 6
View larger version (46K):
[in this window]
[in a new window]

 
FIG. 6. IRF7 lysines 444, 446, and 452 are functional ubiquitination sites. (A) Identification of IRF7 ubiquitination sites in vivo (see details in Materials and Methods). WT, wild type; IB, immunoblotting; HC, heavy chain. (B and C) Lysines 444, 446, and 452 are responsible for IRF7 transactivation ability. (B) 293 cells in 24-well plates were transfected with 125 ng IRF7 or its K->R mutants, 25 ng IFN-{alpha}4-Luc, and 10 ng Renilla plasmids. {alpha}IRF7, anti-IRF7; WT, wild type. Luciferase assays were performed 24 h after transfection. (C) 293 cells in six-well plates were transfected with 0.5 µg IRF7 or its ubiquitination-deficient mutants or the phosphorylation-deficient mutant IRF7(1-470). Forty-eight hours after transfection, RNA was extracted and RT-PCR performed for detection of ISG56, IRF7, and actin mRNA.

To confirm these observations, we tested if these ubiquitination-deficient mutants have reduced abilities to be activated by LMP1. As expected, wild-type IRF7 and IRF7(K373/375R) are similarly strongly activated by LMP1. However, IRF7(K444R), IRF7(K446R), and IRF7(K452R) all have significantly decreased activities compared to those of wild-type IRF7 and IRF7(K373/375R). Again, the triple mutant IRF7(K444/446/452R) completely loses the ability to respond to LMP1 stimulation (Fig. 7A). Further, we studied the activities of these mutants in response to the IRF7 kinase IKK{varepsilon} (48). The results were similar to those obtained with LMP1 (Fig. 7B).


Figure 7
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 7. Transactivation response of IRF7 ubiquitination-deficient mutants to LMP1 and to IKK{varepsilon}. (A, B, and C) 293 cells in 24-well plates were transfected with 25 ng (A) or 50 ng (B and C) of IRF7 or its K->R mutants, 25 ng LMP1 or 100 ng IKK{varepsilon} or the vector control, 25 ng IFN-{alpha}4-Luc, and 10 ng Renilla. Luciferase assays were performed 24 h after transfection. (A) IRF7 functional ubiquitination sites are required for its activation in response to LMP1 (solid bars). The expression levels of IRF7, IRF7(K373/375R), and IRF7(K444/446/452R) are shown at the bottom. WT, wild type; {alpha}IRF7, anti-IRF7. (B) IRF7 functional ubiquitination sites are required for its activation in response to IKK{varepsilon} (solid bars). (C) The IRF7 ubiquitination-deficient mutant IRF7(K444/446/452R) does not respond to LMP1 and Ub.

Together, these results show that lysines 444, 446, and 452, but not K373 and K375, are key ubiquitination sites that are responsible for IRF7 activation. More importantly, since these ubiquitination-deficient mutants have little or dramatically reduced transactivation ability in response to IKK{varepsilon} as well as to LMP1, ubiquitination on these sites seems to be a prelude to IRF7 phosphorylation rather than simply enhancing its transcriptional activity.

Ubiquitination of IRF7 is independent of its functional phosphorylation sites. K48-linked ubiquitination is usually preceded by phosphorylation (26). To check whether K63-linked ubiquitination of IRF7 is dependent on the two major phosphorylation sites Ser 477/479, we checked the ubiquitination abilities of IRF7, IRF7(S477D/S479D) [designated IRF7(2D)], IRF7(S477A/S479A) [designated IRF7(2A)] (which has the two major phosphorylation sites Ser 477/479 mutated to alanines [37]), and IRF7(1-470) in response to LMP1 with "denatured" IP. Wild-type IRF7, as well as the two phosphorylation-deficient mutants IRF7(2A) and IRF7(1-470), are all ubiquitinated in the presence of LMP1 and K63onlyUb, and the phosphorylation-deficient mutants may have even stronger capacity for ubiquitination. However, ubiquitination of IRF7(2D) is not detectable under our experimental conditions (Fig. 8A). To assess this in a relatively endogenous system, we made 293 cells stably expressing Flag-tagged versions of these constructs. LMP1 and Ub expression plasmids were transfected in these stable cell lines. Similar results were observed (Fig. 8B). These data indicate that LMP1 can stimulate ubiquitination of IRF7 independently of its C-terminal functional phosphorylation sites and suggest that phosphorylation may negatively regulate K63-linked ubiquitination.


Figure 8
View larger version (39K):
[in this window]
[in a new window]

 
FIG. 8. Ubiquitination of IRF7 is independent of its C-terminal functional phosphorylation sites. (A) 293 cells in 60-mm dishes were transfected with 0.5 µg Flag-IRF7 or its mutants, together with 0.2 µg LMP1 and 0.5 µg HA-K63onlyUb. Cells were collected 48 h after transfection for "denatured" IP with anti-Flag ({alpha}Flag) and blotting with anti-HA or anti-Flag antibodies. IB, immunoblotting. (B) 293 cells stably expressing the indicated proteins in 60-mm dishes were transfected with 0.2 µg LMP1 and 0.5 µg HA-K63Ub expression plasmids. Cells were collected 48 h after transfection, and IP was performed with denatured lysates with anti-Flag and blotting with anti-HA or anti-Flag antibodies.


arrow
DISCUSSION
 
The principal findings in this study are the unequivocal identification of IRF7 as a substrate for TRAF6 E3 ligase and the first identification of ubiquitination sites on IRF7 that mediate its activation. In addition, we present preliminary evidence that such ubiquitination is independent of C-terminal major functional phosphorylation sites. These findings have broader significance for IRF7-mediated innate immunity in addition to LMP1 signaling leading to IRF7 activation.

We have recently shown that regulatory ubiquitination plays a central role in activation of IRF7 by LMP1 (27). TRAF6 has long been known to be associated with intracellular signaling by LMP1, but its role has remained obscure (40, 47, 57, 62). Here, we show for the first time that IRF7 is a substrate for TRAF6 E3 ligase in vitro as well as in vivo. This finding supplies a key missing link between LMP1 and IRF7. Most important, we identify that Lys 444, 446, and 452 are functional ubiquitination sites required for IRF7 activation, which provides the first line of support for our hypothesis that regulatory ubiquitination of IRF7 is a prelude to its phosphorylation. In addition, we show that, in contrast to K48-linked ubiquitination, which is usually preceded by phosphorylation, K63-linked ubiquitination of IRF7 operates independently of its C-terminal major functional phosphorylation sites.

Ubiquitination has been implicated in TLR signaling leading to IRF7 activation (30). It is likely that this activation is direct. However, it is also possible that as-yet-unidentified targets, which may be involved in activation of an IRF7 kinase, such as IL-1 receptor-associated kinase 1, IKK{alpha}, or the noncanonical IKK TANK-binding kinase 1 or IKK{varepsilon} (23), are activated through ubiquitination (10) (Fig. 9). In our previous study, we showed that IRF7 can be ubiquitinated directly through K63-Ub chains, resulting in IRF7 activation (27), suggesting that IRF7 can be activated directly by its own ubiquitination or by ubiquitination-mediated phosphorylation (Fig. 9). Here, we identify three key lysine sites which are required for IRF7 activation. Mutation of these sites results in consistent decreases in ubiquitination intensity and also abrogates the transactivation ability of IRF7. Thus, our results with these ubiquitination-deficient mutants imply that ubiquitination of IRF7 precedes its phosphorylation (Fig. 9), in contrast to what was found for K48-linked ubiquitination-mediated degradation, which is usually preceded by phosphorylation (reviewed in references 19 and 26). In fact, preliminary data from immunofluorescence staining show that IRF7(K444/446/452R) did not translocate to the nucleus in response to LMP1 (S. Ning and J. S. Pagano, unpublished data). In addition, a kinase may be activated directly and regulated by ubiquitination (Fig. 9). In support of this possibility, the activity of IKKβ, a kinase in the NF{kappa}B pathways, has been shown to be regulated by monoubiquitination (9).


Figure 9
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 9. Signaling from LMP1 and TLR to IRF7 activation. Shown is a scheme of the signaling cascade from LMP1 or TLR to activation of IRF7. LMP1 recruits TRAF6 through TRAF2. The latter protein may act as an E3 ligase for K63-linked ubiquitination of RIP1, which is required for downstream ubiquitination of IRF7 by TRAF6. TLR7/9 recruits TRAF6 through the adaptor protein MyD88. Although RIP1 is not required for TLR3/4 signaling for activation of IRF3 (13), it may be involved in TLR3 signaling leading to IRF7 activation (Michelle Kelliher, personal communication). After recruitment, TRAF6 is auto-ubiquitinated and activated upon dimerization or oligomerization. Then, TRAF6 ubiquitinates and activates IRF7 through K63-Ub chains (pathway 1), which may recruit an IRF7 kinase (IKK{alpha}, IKK{varepsilon}, TANK-binding kinase 1, or IL-1 receptor-associated kinase 1) for IRF7 phosphorylation. And TRAF6-mediated ubiquitination may also regulate the activity of an IRF7 kinase (pathway 2). Solid arrows indicate regulatory pathways identified, and dashed arrows indicate pathways which are proposed but still under study. P, phosphorylated.

Direct identification of ubiquitination sites by mass spectrometry remains technically challenging, especially for higher eukaryotes where knock-in mutation is not nearly as feasible as in yeast cells. However, ubiquitination assays with K->R mutation have been extensively used for identification of ubiquitination lysine sites despite the limitations of the assay (1, 18, 25, 33, 38, 45, 68). Our studies showing that the triple mutant IRF7(K444/446/452R) significantly lost ubiquitination were carried out in the context of the full-length IRF7 protein and, together with the correlative functional analyses, meet if not exceed current standards for mapping ubiquitination sites.

In addition to ubiquitination, many other posttranslational modifications can occur on lysine sites, such as sumoylation, ISGylation, NEDDylation, and acetylation (15, 32). Since our ubiquitination assays (Fig. 5B and 6A), together with other data reported here (Fig. 7C), show that these mutants exhibit consistent decreases in ubiquitination intensity and that Ub significantly increases the activity of IRF7, but not that of IRF7(K444/446/452R), stimulated by LMP1, we reason that ubiquitination is at least one of the modifications that contribute to IRF7 activation.

Our data show that TRAF6 is critical for LMP1-stimulated IRF7 transcriptional activity. TRAF6 is also required for MyD88-dependent/TRIF-independent TLR7/9 signaling leading to production of IFN-Is (30, 44). However, TRAF6 is dispensable for IFN-β production by TRIF-dependent/MyD88-independent TLR4 signaling, for which TRAF3 is required instead (20). Similar to TRAF6, TRAF3 is also an E3 ligase (31). However, unlike TRAF6, which is engaged only in MyD88-dependent TLR pathways, TRAF3 is also engaged in TRIF-dependent TLR pathways, in addition to MyD88-dependent pathways (31). Whether TRAF3 alternatively targets IRF7 on these same sites for ubiquitination is an interesting question.

Besides the three lysine sites required for IRF7 activation, our results show that IRF7 is ubiquitinated by TRAF6 on multiple sites, some of which are located in amino acids 1 to 370 (Fig. 5B). We will profile all the ubiquitination sites and study whether selection of ubiquitination sites is linked to differential functions. Regulatory ubiquitination of a specific site(s) may stabilize IRF7 protein, which has a short half-life and has low levels in normal cells due to degradation by the proteasome-dependent pathway (65). K63-linked ubiquitination is well known to stabilize proteins. For example, K63-linked Ub chains stabilize RIP through binding to NEMO that results in impairment of the interaction between RIP and A20 (60); the latter targets RIP for degradation (59). LMP1 has also been reported to stabilize the oncoprotein MDM2 through ubiquitination (36). In cells with EBV type III latency, IRF7 levels are high in the presence of LMP1. One reason is that LMP1 induces expression of IRF7 (67), but another, potentially better reason is proposed here, that is, LMP1-stimulated, K63-linked ubiquitination protects IRF7 from degradation. Similarly, after virus infection, the level of IRF7 increases dramatically, which is due in part to induction by IFN produced upon virus infection and also, possibly more importantly, to ubiquitination-mediated stabilization. In addition, ubiquitination is known to promote DNA binding of transcription factors and facilitate the assembly of protein complexes (reviewed in references 3, 15, 32, 42, and 52).

We believe that K63-linked ubiquitination of IRF7 is likely to be a ubiquitous mechanism triggered by a variety of infections. The ubiquitination phenomena reported here and earlier (27), which are set into motion early in the LMP1 signaling mechanism, are likely to be paralleled in signaling initiated by other TNFR members, especially TNFR and CD40, and for targets other than IRF7.


arrow
ACKNOWLEDGMENTS
 
We are grateful to Tak Mak for providing TRAF6+/+ and –/– MEFs and Arnd Kieser, David Boone, Averil Ma, Nancy Raab-Traub, Rongtuan Lin, and John Hiscott, who were generous in providing plasmids for this research. We thank Jenny Ting and Yue Xiong for careful reading of and helpful suggestions on the manuscript. We also appreciate helpful input from Leslie Huye.

This work was supported by a grant from the NIH (R21-AI042371).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Lineberger Comprehensive Cancer Center, University of North Carolina, Campus Box 7295, Chapel Hill, NC 27599. Phone: (919) 966-5907. Fax: (919) 966-9673. E-mail: joseph_pagano{at}med.unc.edu Back

{triangledown} Published ahead of print on 8 August 2008. Back


arrow
REFERENCES
 
    1
  1. Abbott, D. W., A. Wilkins, J. M. Asara, and L. C. Cantley. 2004. The Crohn's disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO. Curr. Biol. 14:2217-2227.[CrossRef][Medline]
  2. 2
  3. Baccala, R., K. Hoebe, D. H. Kono, B. Beutler, and A. N. Theofilopoulos. 2007. TLR-dependent and TLR-independent pathways of type I interferon induction in systemic autoimmunity. Nat. Med. 13:543-551.[CrossRef][Medline]
  4. 3
  5. Ben-Neriah, Y. 2002. Regulatory functions of ubiquitination in the immune system. Nat. Immunol. 3:20-26.[CrossRef][Medline]
  6. 4
  7. Besse, A., B. Lamothe, A. D. Campos, W. K. Webster, U. Maddineni, S. C. Lin, H. Wu, and B. G. Darnay. 2007. TAK1-dependent signaling requires functional interaction with TAB2/TAB3. J. Biol. Chem. 282:3918-3928.[Abstract/Free Full Text]
  8. 5
  9. Boone, D. L., E. E. Turer, E. G. Lee, R. C. Ahmad, M. T. Wheeler, C. Tsui, P. Hurley, M. Chien, S. Chai, O. Hitotsumatsu, E. McNally, C. Pickart, and A. Ma. 2004. The ubiquitin-modifying enzyme A20 is required for termination of Toll-like receptor responses. Nat. Immunol. 5:1052-1060.[CrossRef][Medline]
  10. 6
  11. Bouwmeester, T., A. Bauch, H. Ruffner, P. O. Angrand, G. Bergamini, K. Croughton, C. Cruciat, D. Eberhard, J. Gagneur, S. Ghidelli, C. Hopf, B. Huhse, R. Mangano, A. M. Michon, M. Schirle, J. Schlegl, M. Schwab, M. A. Stein, A. Bauer, G. Casari, G. Drewes, A. C. Gavin, D. B. Jackson, G. Joberty, G. Neubauer, J. Rick, B. Kuster, and G. Superti-Furga. 2004. A physical and functional map of the human TNF-{alpha}/NF-{kappa}B signal transduction pathway. Nat. Cell Biol. 6:97-105.[CrossRef][Medline]
  12. 7
  13. Bradley, J., and J. S. Pober. 2001. Tumor necrosis factor receptor-associated factors (TRAFs). Oncogene 20:6482-6491.[CrossRef][Medline]
  14. 8
  15. Brinkmann, M. M., and T. F. Schulz. 2006. Regulation of intracellular signalling by the terminal membrane proteins of members of the Gammaherpesvirinae. J. Gen. Virol. 87:1047-1074.[Abstract/Free Full Text]
  16. 9
  17. Carter, R. S., K. N. Pennington, P. Arrate, E. M. Oltz, and D. W. Ballard. 2005. Site-specific monoubiquitination of I{kappa}B kinase IKKβ regulates its phosphorylation and persistent activation. J. Biol. Chem. 280:43272-43279.[Abstract/Free Full Text]
  18. 10
  19. Chen, Z. J. 2005. Ubiquitin signalling in the NF-{kappa}B pathway. Nat. Cell Biol. 7:758-765.[CrossRef][Medline]
  20. 11
  21. Chung, J. Y., Y. C. Park, H. Ye, and H. Wu. 2002. All TRAFs are not created equal: common and distinct molecular mechanisms of TRAF-mediated signal transduction. J. Cell Sci. 115:679-688.[Abstract/Free Full Text]
  22. 12
  23. Colonna, M. 2007. TLR pathways and IFN-regulatory factors: to each its own. Eur. J. Immunol. 37:306-309.[CrossRef][Medline]
  24. 13
  25. Cusson-Hermance, N., S. Khurana, T. H. Lee, K. A. Fitzgerald, and M. A. Kelliher. 2005. Rip1 mediates the Trif-dependent Toll-like receptor 3- and 4-induced NF-{kappa}B activation but does not contribute to interferon regulatory factor 3 activation. J. Biol. Chem. 280:36560-36566.[Abstract/Free Full Text]
  26. 14
  27. Deng, L., C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, C. Pickart, and Z. J. Chen. 2000. Activation of the I{kappa}B kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103:351-361.[CrossRef][Medline]
  28. 15
  29. Dye, B. T., and B. A. Schulman. 2007. Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins. Annu. Rev. Biophys. Biomol. Struct. 36:131-150.[CrossRef][Medline]
  30. 16
  31. Eliopoulos, A. G., and L. S. Young. 2001. LMP1 structure and signal transduction. Semin. Cancer Biol. 11:435-444.[CrossRef][Medline]
  32. 17
  33. Farina, A., F. Faiola, and E. Martinez. 2004. Reconstitution of an E box-binding Myc:Max complex with recombinant full-length proteins expressed in Escherichia coli. Protein Expr. Purif. 34:215-222.[CrossRef][Medline]
  34. 18
  35. Gack, M. U., Y. C. Shin, C. H. Joo, T. Urano, C. Liang, L. Sun, O. Takeuchi, S. Akira, Z. Chen, S. Inoue, and J. U. Jung. 2007. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I-mediated antiviral activity. Nature 446:916-920.[CrossRef][Medline]
  36. 19
  37. Glickman, M. H., and A. Ciechanover. 2002. The ubiquitin-proteasome proteolytic pathway: destruction for the sake of construction. Physiol. Rev. 82:373-428.[Abstract/Free Full Text]
  38. 20
  39. Hacker, H., V. Redecke, B. Blagoev, I. Kratchmarova, L. C. Hsu, G. G. Wang, M. P. Kamps, E. Raz, H. Wagner, G. Hacker, M. Mann, and M. Karin. 2006. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 439:204-207.[CrossRef][Medline]
  40. 21
  41. Hiscott, J. 2007. Convergence of the NF-{kappa}B and IRF pathways in the regulation of the innate antiviral response. Cytokine Growth Factor Rev. 18:483-490.[CrossRef][Medline]
  42. 22
  43. Hoebe, K., and B. Beutler. 2006. TRAF3: a new component of the TLR-signaling apparatus. Trends Mol. Med. 12:187-189.[CrossRef][Medline]
  44. 23
  45. Honda, K., and T. Taniguchi. 2006. IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6:644-658.[CrossRef][Medline]
  46. 24
  47. Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida, and T. Taniguchi. 2005. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 434:772-777.[CrossRef][Medline]
  48. 25
  49. Huang, T. T., S. M. Wuerzberger-Davis, Z. H. Wu, and S. Miyamoto. 2003. Sequential modification of NEMO/IKK{gamma} by SUMO-1 and ubiquitin mediates NF-{kappa}B activation by genotoxic stress. Cell 115:565-576.
  50. 26
  51. Hunter, T. 2007. The age of crosstalk: phosphorylation, ubiquitination, and beyond. Mol. Cell 28:730-738.[CrossRef][Medline]
  52. 27
  53. Huye, L. E., S. B. Ning, M. Kelliher, and J. S. Pagano. 2007. Interferon regulatory factor 7 is activated by a viral oncoprotein through RIP-dependent ubiquitination. Mol. Cell. Biol. 27:2910-2918.[Abstract/Free Full Text]
  54. 28
  55. Iwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5:987-995.[CrossRef][Medline]
  56. 29
  57. Kawai, T., and S. Akira. 2007. TLR signaling. Semin. Immunol. 19:24-32.[CrossRef][Medline]
  58. 30
  59. Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M. Matsuda, J. I. Inoue, S. Uematsu, O. Takeuchi, and S. Akira. 2004. Interferon {alpha} induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat. Immunol. 5:1061-1068.[CrossRef][Medline]
  60. 31
  61. Kayagaki, N., Q. Phung, S. Chan, R. Chaudhari, C. Quan, K. M. O'Rourke, M. Eby, E. Pietras, G. Cheng, J. F. Bazan, Z. Zhang, D. Arnott, and V. M. Dixit. 2007. DUBA: a deubiquitinase that regulates type I interferon production. Science 318:1628-1632.[Abstract/Free Full Text]
  62. 32
  63. Kerscher, O., R. Felberbaum, and M. Hochstrasser. 2006. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 22:159-180.[CrossRef][Medline]
  64. 33
  65. Lamothe, B., A. Besse, A. D. Campos, W. K. Webster, H. Wu, and B. G. Darnay. 2007. Site-specific Lys-63-linked tumor necrosis factor receptor-associated factor 6 auto-ubiquitination is a critical determinant of I{kappa}B kinase activation. J. Biol. Chem. 282:4102-4112.[Abstract/Free Full Text]
  66. 34
  67. Lamothe, B., W. K. Webster, A. Gopinathan, A. Besse, A. D. Campos, and B. G. Darnay. 2007. TRAF6 ubiquitin ligase is essential for RANKL signaling and osteoclast differentiation. Biochem. Biophys. Res. Commun. 359:1044-1049.[CrossRef][Medline]
  68. 35
  69. Li, H. P., and Y. S. Chang. 2003. Epstein-Barr virus latent membrane protein 1: structure and functions. J. Biomed. Sci. 10:490-504.[Medline]
  70. 36
  71. Li, L., Z. Li, S. Zhou, L. Xiao, L. Guo, Y. Tao, M. Tang, Y. Shi, W. Li, W. Yi, and Y. Cao. 2007. Ubiquitination of MDM2 modulated by Epstein-Barr virus encoded latent membrane protein 1. Virus Res. 130:275-280.[CrossRef][Medline]
  72. 37
  73. Lin, R., Y. Mamane, and J. Hiscott. 2000. Multiple regulatory domains control IRF-7 activity in response to virus infection. J. Biol. Chem. 275:34320-34327.[Abstract/Free Full Text]
  74. 38
  75. Lohrum, M. A. E., D. B. Woods, R. L. Ludwig, E. Balint, and K. H. Vousden. 2001. C-terminal ubiquitination of p53 contributes to nuclear export. Mol. Cell. Biol. 21:8521-8532.[Abstract/Free Full Text]
  76. 39
  77. Lomaga, M. A., W. C. Yeh, I. Sarosi, G. S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, A. van der Heiden, A. Itie, A. Wakeham, W. Khoo, T. Sasaki, Z. Cao, J. M. Penninger, C. J. Paige, D. L. Lacey, C. R. Dunstan, W. J. Boyle, D. V. Goeddel, and T. W. Mak. 1999. TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling. Genes Dev. 13:1015-1024.[Abstract/Free Full Text]
  78. 40
  79. Luftig, M., E. Prinarakis, T. Yasui, T. Tsichritzis, E. Cahir-McFarland, J. Inoue, H. Nakano, T. W. Mak, W. C. Yeh, X. Li, S. Akira, N. Suzuki, S. Suzuki, G. Mosialos, and E. Kieff. 2003. Epstein-Barr virus latent membrane protein 1 activation of NF-{kappa}B through IRAK1 and TRAF6. Proc. Natl. Acad. Sci. USA 100:15595-15600.[Abstract/Free Full Text]
  80. 41
  81. Miller, W. E., G. Mosialos, E. Kieff, and N. Raab-Traub. 1997. Epstein-Barr virus LMP1 induction of the epidermal growth factor receptor is mediated through a TRAF signaling pathway distinct from NF-{kappa}B activation. J. Virol. 71:586-594.[Abstract]
  82. 42
  83. Mukhopadhyay, D., and H. Riezman. 2007. Proteasome-independent functions of ubiquitin in endocytosis and signaling. Science 315:201-205.[Abstract/Free Full Text]
  84. 43
  85. Nestle, F. O., C. Conrad, A. Tun-Kyi, B. Homey, M. Gombert, O. Boyman, G. Burg, Y. J. Liu, and M. Gilliet. 2005. Plasmacytoid predendritic cells initiate psoriasis through interferon-{alpha} production. J. Exp. Med. 202:135-143.[Abstract/Free Full Text]
  86. 44
  87. Oganesyan, G., S. K. Saha, B. Guo, J. Q. He, A. Shahangian, B. Zarnegar, A. Perry, and G. Cheng. 2006. Critical role of TRAF3 in the Toll-like receptor-dependent and -independent antiviral response. Nature 439:208-211.[CrossRef][Medline]
  88. 45
  89. Read, M. A., J. E. Brownell, T. B. Gladysheva, M. Hottelet, L. A. Parent, M. B. Coggins, J. W. Pierce, V. N. Podust, R. S. Luo, V. Chau, and V. J. Palombella. 2000. Nedd8 modification of Cul-1 activates SCFβTrCP-dependent ubiquitination of I{kappa}B{alpha}. Mol. Cell. Biol. 20:2326-2333.[Abstract/Free Full Text]
  90. 46
  91. Sanz, L., M. T. az-Meco, H. Nakano, and J. Moscat. 2000. The atypical PKC-interacting protein p62 channels NF-kappaB activation by the IL-1-TRAF6 pathway. EMBO J. 19:1576-1586.[CrossRef][Medline]
  92. 47
  93. Schultheiss, U., S. Puschner, E. Kremmer, T. W. Mak, H. Engelmann, W. Hammerschmidt, and A. Kieser. 2001. TRAF6 is a critical mediator of signal transduction by the viral oncogene latent membrane protein 1. EMBO J. 20:5678-5691.[CrossRef][Medline]
  94. 48
  95. Sharma, S., B. R. tenOever, N. Grandvaux, G. P. Zhou, R. Lin, and J. Hiscott. 2003. Triggering the interferon antiviral response through an IKK-related pathway. Science 300:1148-1151.[Abstract/Free Full Text]
  96. 49
  97. Shi, C. S., and J. H. Kehrl. 2003. Tumor necrosis factor (TNF)-induced germinal center kinase-related (GCKR) and stress-activated protein kinase (SAPK) activation depends upon the E2/E3 complex Ubc13-Uev1A/TNF receptor-associated factor 2 (TRAF2). J. Biol. Chem. 278:15429-15434.[Abstract/Free Full Text]
  98. 50
  99. Song, Y. J., K. Y. Jen, V. Soni, E. Kieff, and E. Cahir-McFarland. 2006. IL-1 receptor-associated kinase 1 is critical for latent membrane protein 1-induced p65/RelA serine 536 phosphorylation and NF-{kappa}B activation. Proc. Natl. Acad. Sci. USA 103:2689-2694.[Abstract/Free Full Text]
  100. 51
  101. Soni, V., E. Cahir-McFarland, and E. Kieff. 2007. LMP1 TRAFficking activates growth and survival pathways. Adv. Exp. Med. Biol. 597:173-187.[Medline]
  102. 52
  103. Sun, L., and Z. J. Chen. 2004. The novel functions of ubiquitination in signaling. Curr. Opin. Cell Biol. 16:119-126.[CrossRef][Medline]
  104. 53
  105. Takaoka, A., T. Tamura, and T. Taniguchi. 2008. Interferon regulatory factor family of transcription factors and regulation of oncogenesis. Cancer Sci. 99:467-478.[CrossRef][Medline]
  106. 54
  107. Tamura, T., H. Yanai, D. Savitsky, and T. Taniguchi. 2008. The IRF family transcription factors in immunity and oncogenesis. Annu. Rev. Immunol. 26:535-584.[CrossRef][Medline]
  108. 55
  109. Uematsu, S., and S. Akira. 2007. Toll-like receptors and type I interferons. J. Biol. Chem. 282:15319-15323.[Abstract/Free Full Text]
  110. 56
  111. Ulrich, H. D., and S. Jentsch. 2000. Two RING finger proteins mediate cooperation between ubiquitin-conjugating enzymes in DNA repair. EMBO J. 19:3388-3397.[CrossRef][Medline]
  112. 57
  113. Wan, J., L. Sun, J. W. Mendoza, Y. L. Chui, D. P. Huang, Z. J. Chen, N. Suzuki, S. Suzuki, W. C. Yeh, S. Akira, K. Matsumoto, Z. G. Liu, and Z. Wu. 2004. Elucidation of the c-Jun N-terminal kinase pathway mediated by Epstein-Barr virus-encoded latent membrane protein 1. Mol. Cell. Biol. 24:192-199.[Abstract/Free Full Text]
  114. 58
  115. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue, and Z. J. Chen. 2001. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412:346-351.[CrossRef][Medline]
  116. 59
  117. Wertz, I. E., K. M. O'Rourke, H. Zhou, M. Eby, L. Aravind, S. Seshagiri, P. Wu, C. Wiesmann, R. Baker, D. L. Boone, A. Ma, E. V. Koonin, and V. M. Dixit. 2004. De-ubiquitination and ubiquitin ligase domains of A20 downregulate NF-kappaB signalling. Nature 430:694-699.[CrossRef][Medline]
  118. 60
  119. Wu, C. J., D. B. Conze, T. Li, S. M. Srinivasula, and J. D. Ashwell. 2006. Sensing of Lys 63-linked polyubiquitination by NEMO is a key event in NF-{kappa}B activation. Nat. Cell Biol. 8:398-406.[CrossRef][Medline]
  120. 61
  121. Wu, H., and J. R. Arron. 2003. TRAF6, a molecular bridge spanning adaptive immunity, innate immunity and osteoimmunology. Bioessays 25:1096-1105.[CrossRef][Medline]
  122. 62
  123. Wu, L., H. Nakano, and Z. Wu. 2006. The C-terminal activating region 2 of the Epstein-Barr virus-encoded latent membrane protein 1 activates NF-{kappa}B through TRAF6 and TAK1. J. Biol. Chem. 281:2162-2169.[Abstract/Free Full Text]
  124. 63
  125. Yoneyama, M., and T. Fujita. 2007. RIG-I family RNA helicases: cytoplasmic sensor for antiviral innate immunity. Cytokine Growth Factor Rev. 18:545-551.[CrossRef][Medline]
  126. 64
  127. Yoneyama, M., and T. Fujita. 2007. Function of RIG-I-like receptors in antiviral innate immunity. J. Biol. Chem. 282:15315-15318.[Free Full Text]
  128. 65
  129. Yu, Y., S. E. Wang, and G. S. Hayward. 2005. The KSHV immediate-early transcription factor RTA encodes ubiquitin E3 ligase activity that targets IRF7 for proteosome-mediated degradation. Immunity 22:59-70.[CrossRef][Medline]
  130. 66
  131. Zhang, L., and J. S. Pagano. 1997. IRF-7, a new interferon regulatory factor associated with Epstein-Barr virus latency. Mol. Cell. Biol. 17:5748-5757.[Abstract]
  132. 67
  133. Zhang, L., and J. S. Pagano. 2000. Interferon regulatory factor 7 is induced by Epstein-Barr virus latent membrane protein 1. J. Virol. 74:1061-1068.[Abstract/Free Full Text]
  134. 68
  135. Zhou, H., I. Wertz, K. O'Rourke, M. Ultsch, S. Seshagiri, M. Eby, W. Xiao, and V. M. Dixit. 2004. Bcl10 activates the NF-{kappa}B pathway through ubiquitination of NEMO. Nature 427:167-171.[CrossRef][Medline]


Molecular and Cellular Biology, October 2008, p. 6536-6546, Vol. 28, No. 20
0270-7306/08/$08.00+0     doi:10.1128/MCB.00785-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Paz, S., Vilasco, M., Arguello, M., Sun, Q., Lacoste, J., Nguyen, T. L.-A., Zhao, T., Shestakova, E. A., Zaari, S., Bibeau-Poirier, A., Servant, M. J., Lin, R., Meurs, E. F., Hiscott, J. (2009). Ubiquitin-Regulated Recruitment of I{kappa}B Kinase {varepsilon} to the MAVS Interferon Signaling Adapter. Mol. Cell. Biol. 29: 3401-3412 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ning, S.
Right arrow Articles by Pagano, J. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ning, S.
Right arrow Articles by Pagano, J. S.