| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Previous Article | Next Article ![]()
Molecular and Cellular Biology, February 2008, p. 1018-1028, Vol. 28, No. 3
0270-7306/08/$08.00+0 doi:10.1128/MCB.01136-07
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
,
Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Ramiro de Maeztu 9, 28004 Madrid, Spain,1 Instituto de Investigaciones Biomédicas, Universidad Autónoma de Madrid, Consejo Superior de Investigaciones Científicas, Arturo Duperier 4, 28029 Madrid, Spain,2 Riken Research Center for Allergy and Immunology, 1-7-22 Suehiro, Tsurumi-ku, Yokohama 230-0045, Japan,3 Anatomy and Histopathology, Facultad de Veterinaria, Universidad de León, Campus Vegazana, 24071 León, Spain4
Received 26 June 2007/ Returned for modification 2 August 2007/ Accepted 12 November 2007
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The Polycomb group (PcG) of proteins are transcriptional repressors that prevent the inappropriate expression of genes that determine cell identity (4, 11). PcG gene products assemble in multimeric complexes (Polycomb repressing complexes [PRC]) whose transcriptional activity is associated to their role as chromatin modifiers (64). PRC are compositionally diverse, but depending on which of two sets of core subunits they contain, they are designated type PRC1 or PRC2 (40). Histone H2AK119 monoubiquitylation depends on the RING finger E3 ligases of PRC1 complexes (10, 73), whereas histone H3K27 trimethylation is carried out by PRC2 complexes (12, 18, 34, 46). Well known as developmental regulators (57), PcG genes also play important roles in cell proliferation control (41, 52). Murine models of loss of function of PcG genes encoding PRC1 subunits show reduced size and hypocellularity of hematopoietic organs (1, 15, 69, 70) and also, in some cases (Bmi1) of brain structures (71), indicating that PcG complexes are positive regulators of cell proliferation. The upregulation of PcG products observed in a wide variety of tumors (54, 68) and their cooperation in oncogene-induced tumorigenesis (27) further support a role for PcG complexes as promoters of proliferation. Exceptionally, inactivation of the PRC2 subunit Eed resulted in enlarged hematopoietic compartments (36). These alterations are due, at least in part, to PcG-mediated repression of the Ink4a/Cdkn2a locus, which encodes the tumor suppressors p16Ink4a and p19Arf. Loss of function of PRC1 proteins, and Bmi1 in particular, results in premature senescence of hematopoietic and neuronal stem cells (28, 37, 44, 48, 49, 51). PcG complexes also promote expansion of maturing cells by preventing senescence and apoptosis, although the contribution of each of these mechanisms varies depending on the particular tissue and the PcG protein (9, 14, 38, 45).
Ring1B and its paralog Ring1A are the RING finger E3 ligases that monoubiquitylate H2A (20, 73). They associate directly with Bmi1, Mel18, M33, and Phc1, forming the core of PRC1 complex(es) (25, 39, 63). The contribution of Ring1A and Ring1B to cell turnover of renewing tissues is not known. Constitutive inactivation of Ring1A results in fertile mice with no overt phenotypes (19), whereas inactivation of Ring1B leads to embryonic lethality due to defective gastrulation (72). Considering that Ring1B expression in the adult hematopoietic compartment is detected in all differentiation stages, from the hematopoietic stem cells (HSCs) and their immature descendants (29), we sought to address the role of Ring1B in adult hematopoiesis using a conditional mutant mouse line. We find that Ring1B inactivation results in a reduction of total bone marrow cells and, at the same time, an enlargement of the immature cell compartment. We also show that the alterations in the size of bone marrow cell populations are due to cell proliferation defects caused by upregulation of components of the cell cycle machinery that act as activators (cyclin D2) or inhibitors (p16Ink4a) of proliferation in a differentiation stage-dependent manner. Finally, we observed premature development of lymphomas in compound Ring1B;Ink4a mutant mice that suggests an important role for Ring1B in controlling the expansion of progenitor cells in adult hematopoiesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
For in vivo conditional inactivation, Ring1Bflox/flox (hereafter, Ring1Bf/f) mice were crossed with MxCre transgenic mice (33). MxCre expression was induced by intraperitoneally injecting 250 µg of polyinosine-polycytidine (pIpC; Pharmacia) on three alternate days in 6- to 12-week-old mice. "Ex vivo" conditional inactivation of Ring1B was carried out on cells obtained from mice generated by crossing Ring1Bf/f mice with RERTert mice, a mouse line in which an IRES-Cre-ERT2 (tamoxifen-inducible Cre) cassette was knocked in into the 3' untranslated region of the RNA polII (Polr2a) gene (43), to obtain Ring1Bf/f; RERTert/ert mice (here termed Ring1Bf/f CreERT2). Translocation of Cre-ERT2 to cell nuclei and loxP recombination were achieved by adding to the cultures 4'-hydroxy tamoxifen ([4-HT] 0.4 µM final concentration; Sigma) or vehicle (+4-HT and –4-HT cultures, respectively).
Compound Ring1Bfl/fl; Ink4a–/– mice were obtained by crossing Ring1Bf/f mice with the Ink4a–/– mouse line (65). Genotyping of the Ink4a allele was done by Southern blotting as described previously (65). All mouse procedures were institutionally approved and were in accordance with national and European regulations.
Cell counting and blood analysis. Bone marrow cells were flushed out of both femurs with phosphate-buffered saline (PBS) containing 2% fetal calf serum (PBS-2% FCS) under sterile conditions. Spleens and thymi were disrupted in a Dounce homogenizer (loose pestle) in PBS-2% FCS. Cells were counted in a hemocytometer.
Blood was obtained by heart puncture immediately after mice were sacrificed. Blood counts were mostly performed by manual counting on a hemocytometer or automatically using an Abacus (Diatron) hematological analyzer. Manual counting of white blood cells was carried out after erythrocytic lysis.
Immunophenotyping and cell separation.
Single-cell suspensions were washed with PBS and resuspended in cold washing solution (PBS-2% FCS-0.1% sodium azide). The appropriate antibodies were then added, and cells were labeled for 20 min at 4°C. After a washing step, cells labeled with biotin-conjugated antibodies were further incubated with streptavidin conjugated to phycoerythrin (PE) or peridinin chlorophyll protein-Cy5.5. Samples were acquired in a FACScan fluorescence-activated cell sorter (FACS) instrument with CellQuest software or a FACSCanto with Diva software, all from Becton Dickinson. The antibodies that were used were as follows: c-Kit conjugated to fluorescein isothiocyanate (FITC), biotin, or allophycocyanin (for analysis); Sca-1, Gr-1, CD41, and B220 conjugated to FITC or biotin; Mac-1, CD3, and Ter119 conjugated to biotin; CD34 conjugated to FITC; Fc
R and CD19 conjugated to PE. All antibodies were purchased from BD Biosciences.
For common myeloid progenitor (CMP) sorting, isolated colonies with immature phenotype were pooled, immunomagnetically depleted of Lin+ cells, and labeled with anti-c-Kit-allophycocyanin -, anti-CD34-FITC-, and anti-Fc
R-PE-conjugated antibodies and sorted on the c-Kit+/CD34+/Fc
Rlo gate in a FACS Vantage sorter equipped with a Diva system (BD Biosciences), set to render the highest purity. Immunomagnetic cell isolation was done using a Lineage Cell Depletion kit and LD columns together with a QuadroMACS separation unit from Miltenyi Biotec. Hematopoietic cell subpopulations for Ring1B expression analysis were isolated by cell sorting as described previously (30), using Mac1+ Gr1lo for monocytic and Mac1+ Gr1high for granulocytic precursors, respectively, in a FACS Vantage sorter (BD Biosciences).
In vitro colony forming assays. Myeloid and pre-B-cell colony plating assays were performed in cytokine-supplemented methylcellulose-based medium M3434 and M3630 (StemCell Technologies), seeding total bone marrow in duplicate (2 x 105 or 2 x 104 cells/35-mm dish for pre-B-cell and myeloid assays, respectively). For assays of isolated progenitors, 500 Lin– cells were used per plate. Myeloid cultures were scored for colony formation and morphologically analyzed at day +12 unless otherwise specified. Pre-B-cell and immature myeloid colonies were systematically scored at day +8 and day +7 after seeding, respectively. Serial replating, using equal numbers of cells, was performed 10 days after plating.
Cell proliferation, cell division, and apoptosis assays. Bone marrow or isolated Lin– cells were cultured in 24-well plates containing Iscove's modified Dulbecco's medium-10% FCS medium plus 20 or 50 ng/ml of recombinant murine interleukin-3 (IL-3) or recombinant human IL-6, respectively (Peprotech). Recombination in cultured cells was achieved by adding 4-HT (0.4 µM; Sigma) or vehicle, where indicated. Lin– cells cultures also contained 100 ng/ml of recombinant human stem cell factor (Peprotech). Viable cells were counted by trypan blue exclusion in a hemocytometer.
Bromodeoxyuridine (BrdU) incorporation was assessed by adding the nucleotide precursor analog to the culture medium at a final concentration of 10 µM. After 18 h labeled cells were determined with a flluorochrome-conjugated anti-BrdU antibody (FITC BrdU flow kit; BD-Pharmingen) and analyzed by flow cytometry in a FACScan cytometer equipped with CellQuest software (BD Biosciences). For cell division assays, cells were labeled with 2 µM carboxy-fluorescein diacetate succinimidyl ester (CFDA-SE) and handled as indicated by the manufacturer (Invitrogen). Cell-associated fluorescence was analyzed by flow cytometry 18 h later. To determine the fluorescence associated to cells before division, two aliquots were removed: one was analyzed immediately, and the second was kept at 4°C to match the analysis conditions. An FITC-conjugated recombinant human annexin V kit (Bender Medsystems) was used to stain apoptotic cells prior to flow cytometry analysis.
Western blotting analysis. Cells were lysed in radioimmunoprecipitation assay buffer (10 mM Tris-HCl, pH 7.2, 150 mM NaCl, 1% TX-100, 0.1% sodium dodecyl sulfate, 1% deoxycholate, 5 mM EDTA, 20 mM NaF, 100 µM orthovanadate, and protease inhibitors) for 30 min on ice. Cell lysates were cleared of debris by centrifugation at 15,000 x g for 15 min, aliquoted, snap-frozen, and kept at –70°C until used. Thirty micrograms of total protein was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to BioTrace polyvinylidene difluoride membranes (Pall Corporation) for 1 h at 2 mA/cm2 on a semidry transfer apparatus (Amersham). Ponceau staining was routinely performed on membranes, and digital photographs were taken in order to record a sample loading control. After being blocked in Tris-buffered saline containing 0.1% Tween 20 and 5% nonfat dry milk, filters were incubated overnight at 4°C with the following antibodies: anti-Ring1B (63), anti-p16Ink4a (M-156; Santa Cruz), anti-cyclin D2 (M-20; Santa Cruz), anti-cyclin D3 (C-16; Santa Cruz), anti-p27kip1 (clone 57; Transduction Laboratories), anti-cdc6 (Ab-3; Oncogene), anti-p57kip2 (KP-39; Sigma), anti-cyclin A (H-432; Santa Cruz), anti p19Arf (ab80; Abcam). After a washing step and incubation with horseradish peroxidase-conjugated secondary antibodies (Dako), signals were detected using an enhanced chemiluminescence system (Pierce).
Histopathology and immunohistochemistry. Normal and tumor tissue samples were fixed in 10% neutral-buffered formalin for 24 h. After dehydration and paraffin wax embedding, 3-µm sections were prepared and stained with hematoxylin and eosin. For immunohistochemical analysis, sections were mounted on poly-L-lysine-coated slides, and anti-Pax5 antibodies were detected by the avidin-biotin-peroxidase complex method (Peroxidase Elite, Vectastain, and ABC kit; Vector Laboratories).
Quantitative reverse transcription-PCR expression analysis.
RNA was isolated from sorted hematopoietic cell populations using an RNeasy kit (Qiagen). Random-primed cDNA was generated using a Superscript III First Strand reverse transcription kit (Invitrogen). Triplicate reactions of cDNA amplification were performed in Sybr Premix Ex Taq (Takara) and analyzed using a 7900HT Fast Real-Time PCR System (Applied Biosystems). Relative mRNA normalized to acidic ribosomal phosphoprotein mRNA levels was determined using the comparative cycle threshold (
CT) method. The following sets of primers were used: for Ring1B, TTGACATAGAATGGGACAGC (forward) and GTCAGCAGAAAGTCTTGTGG (reverse); for acidic ribosomal phosphoprotein, CGACCTGGAAGTCCAACTAC (forward) and ATCTGCTGCATCTGCTTG (reverse).
ChIP. Lin– and Lin+ bone marrow cells were processed for chromatin immunoprecipitation (ChIP) assays using anti-trimethylated H3K27 (Upstate), anti-Ring1B (3), and anti-Bmi1 (21) antibodies. Immunoprecipitated DNA was amplified using the primer pair TTGCCCTGAATATAGCATGA and TCATGCTATATTCAGGGCAA or the pair CGATCCTTTAGCGCTGTTTC and CACACTCTGCTCCTGACCTG that span 271 bp and 201 bp in the murine p16Ink4a gene promoter area, respectively.
Statistical analyses. Values are expressed as means ± standard deviation (SD). Data sets were compared using a two-tailed Student's t test, and differences were considered significant for P values of <0.05.
| RESULTS |
|---|
|
|
|---|
|
Cell-autonomous increase of Ring1B-deficient myeloid clonogenic cells. Clonogenic assays were employed to determine the abundance of cells (CFU) able to expand and give rise to differentiated progeny in vitro. These include primitive, multilineage progenitors and immediate unilineage precursors that give rise to characteristic, morphologically distinguishable colonies. For lymphoid cells, clonogenic assays in the presence of IL-7 revealed a severe reduction in the number and size of Ring1B-deficient pre-B-cell colonies (Fig. 2A). On the other hand, ablation of Ring1B resulted in an almost twofold increase of myeloid CFU (Fig. 2B). Whereas all types of supported CFU were represented, their relative proportions were altered, particularly the mixed granulo-mono-erythromegakaryocitic (GEMM) colonies (sixfold increase; P < 0.0001) (Fig. 2B) originated from the most immature progenitors. The GEMM colonies derived from blast-like cell clusters, which in mutant bone marrow cultures appeared invariably denser (Fig. 2C, top) and also contained a higher proportion of the primitive CMP (fivefold increase; P = 0.05) (Fig. 2C, bottom). We conclude that Ring1B clearly affected both the size and clonogenic activity of the progenitors' compartment.
|
Ring1B inactivation enhances the proliferative rate of myeloid progenitors. We used ex vivo inactivation of Ring1B to investigate whether differences in cell proliferation rate, apoptosis, or cell differentiation could account for the accumulation of Ring1B-deficient primitive hematopoietic cells. Pulse labeling of Lin– cells with BrdU demonstrated that more cells incorporated BrdU in 4-HT-treated (Cre+) than in nontreated (Cre–) cultures (Fig. 3A). We also used CFDA-SE fluorescence decay as an additional test of the cell division rate. This assay is based on the dilution of the fluorescent dye resulting from its equal distribution among daughter cells upon cell division. As shown in Fig. 3B, nearly all Ring1B-deficient Lin– cells had completed one cell cycle at the same point when 30% of the Ring1B-expressing Lin– cells still remained undivided. Under these culture conditions, annexin V labeling (an indicator of apoptosis) showed no differences between treated and nontreated cultures (Fig. 3C). These results indicate that the enlargement of the mutant Lin– compartment is due to an increase in the cell proliferation rate provoked by the loss of Ring1B.
|
Ring1B negatively regulates cyclin D2 and p16Ink4a. After establishing the role of Ring1B in proliferation of hematopoietic cells, we began to study the underlying mechanism(s) by analyzing protein expression levels of known cell cycle regulators. The rate of cell proliferation in mammalian cells is determined mainly in the G1 phase of the cell cycle by the specific activation of cyclin-dependent kinases, which are in turn negatively regulated by two families of cyclin-dependent kinase inhibitors (CKIs) (66). First, we compared total bone marrow cell extracts from control MxCre-negative and in vivo deleted Ring1B (MxCre positive) mice. Western blot analysis showed increased levels of cyclin D2 (Fig. 4A) and also of the cell cycle progression indicator cyclin A (see Fig. S4A in the supplemental material) in extracts from Ring1B-deficient cells. Also, levels of the CKI p27 appeared slightly higher in mutant cells (see Fig. S4 in the supplemental material). However, the most prominent difference was observed for the levels of p16Ink4a, another CKI which, while undetectable in extracts from nondeleted cells, gave a strong signal in Ring1B-deficient cell extracts (Fig. 4A). No signals were detected for cdc6, a component of the replication licensing machinery, the CKI p57, or p19Arf in any of the extracts (see Fig. S4A in the supplemental material).
|
We investigated these cell populations by using liquid cultures of ex vivo Ring1B-ablated Lin– cells under conditions that recapitulate the differentiation events occurring in normal myelopoiesis. Initially after treatment, the relative accumulation of cells was faster in mutant (+4-HT; Cre+) than in control (–4-HT; Cre–) cultures (Fig. 4C). However, by day 6 after treatment, this ratio was inverted, and Ring1B-expressing cultures contained more cells than those of Ring1B-deficient cells. Analysis of CFDA-SE fluorescence decay confirmed the inversion of cell division rates between days 4 and 6 after 4-HT (Fig. 4D) treatment. The lower accumulation of mutant cells did not result from increased cell death, as determined by annexin V staining (Fig. 4E). Instead, the late upregulation of p16Ink4a, detected only by day 6 after treatment (Fig. 4F), correlated with the switch in proliferation rate. This contrasted with the prompt upregulation of the proliferation promoter cyclin D2 in mutant cultures (Fig. 4F), which, in the absence of the inhibitor p16Ink4a, would explain the enhanced proliferation observed before day +6. A possible explanation for the differential regulation of p16Ink4a in immature versus mature cells may be related to the decreasing levels of Bmi1 during hematopoietic differentiation (26), which would ensure p16Ink4a silencing in progenitors, even in the absence of Ring1B. We tested this by analyzing promoter occupancy at the Ink4a locus in ChIP assays and found that whereas Ring1B was detected in both immature Lin– and maturing Lin+ cells, Bmi1 was seen associated predominantly in the immature compartment (Fig. 4G).
Collectively, these results show that through the balanced expression of positive and negative cell cycle regulators, Ring1B controls the expansion of differentiating hematopoietic cells both by restricting proliferation of progenitors and by contributing to their expansion during maturation.
Ink4a deficiency rescues only the expansion defects of Ring1B-deficient hematopoietic cells. Given the correlation seen between p16Ink4a upregulation and proliferation inhibition in maturing ex vivo Ring1B-deleted cells, the overall decrease of bone marrow cells associated with Ring1B inactivation could be explained by similar mechanisms. To test this hypothesis, we crossed Ring1Bf/f; MxCre and Ring1Bf/f mice with a mouse line carrying an Ink4a null mutation which does not express either p16Ink4a or p19Arf (65). Bone marrow analysis after pIpC-induced Ring1B ablation showed that inactivation of the Ink4a locus abolished the differences in cellularities of bone marrow and spleen observed in single Ring1B-deficient cells (Fig. 5A). Furthermore, the severe reduction of pre-B-cell colonies associated with Ring1B inactivation was not observed in cultures of bone marrow cells that were also deficient in Ink4a, which showed even a further increase in the number and size of pre-B-cell CFU (Fig. 5B). In contrast, the increased number of Ring1B-deficient myeloid CFU was not affected by the lack of Ink4a (Fig. 5C), although the enlarged size of double mutant colonies indicated that Ink4a products could act by restricting the proliferative potential of maturing Ring1B-deficient cells. Since p19Arf is not affected by Ring1B inactivation, the results confirm that the proliferative deficits of Ring1B-deficient hematopoietic cells are due to the upregulation of p16Ink4a in maturing cells.
|
|
| DISCUSSION |
|---|
|
|
|---|
Dual roles of Ring1B in positive and negative regulation of cell proliferation through downregulation of cell cycle inhibitors and activators. The hematopoietic compartment is among the tissues most affected by mutations in PcG genes, resulting in smaller thymi and spleens and a hypocellular bone marrow (36, 55). Inactivation of Ring1B results in a hematopoietic phenotype milder than that of other PRC1 mutant mice but equally consistent with a positive role in cell proliferation. However, the enlargement of the size of the mutant progenitor compartment indicates that Ring1B also acts as an antiproliferative regulator. The accumulation of Ring1B-deficient immature cells seems to be due mostly to their hyperproliferative phenotype rather than to reduced apoptosis or defective differentiation. Thus, the antiproliferative activity of Ring1B contrasts with the most prominent role of other PRC1 subunits as proliferation promoters, e.g., Bmi1. It also resembles that of the PRC2 component Eed, whose inactivation antagonizes the effects of a Bmi1 mutation (35). Moreover, the use of an ex vivo inactivation model shows that these proliferative alterations are, at least in part, the result of Ring1B cell-autonomous regulated events.
In agreement with a dual role for Ring1B in negative and positive regulation of cell proliferation, we find that Ring1B targets both cell cycle activators and inhibitors. Usually, the activity of PcG proteins as promoters of cell proliferation is associated to their role as repressors of the Ink4a locus (23). We find that the inactivation of Ring1B also causes upregulation of p16Ink4a but not of p19Arf, similarly to the previous observation of Ink4a mRNA selective derepression in constitutively Ring1B-deficient mouse embryos (72). In addition, our analysis demonstrates that Ring1B regulates negatively the G1 cyclin D2 and the replication factor cdc6, two characteristic promoters of cell proliferation.
Repression by PcG complexes usually refers to the mechanisms dealing with maintenance of transcriptionally silent loci. An example is the Ink4a/Arf locus, which is normally inactive in proliferating cells. Association of PcG components, including Ring1B, to genomic regions of Ink4a/Arf and its correlation with the repressed state are considered indications of direct transcriptional control (6, 21, 31). On the other hand, negative regulation of transcriptionally active loci, such as cyclin D2 in proliferating cells, appears as a novel scenario for Polycomb repression. However, studies in Drosophila melanogaster show that the Cyclin A gene, the product of which is needed for cell cycle progression, is repressed by PRC1 subunits, Polycomb and Polyhomeotic (42). Furthermore, Polycomb was found associated to the Cyclin A locus, just as Ring1B and Bmi1 appear bound to regions of the Cyclin D2 gene in ES cells and fibroblasts (5, 7). It is likely, then, that the presence of Polycomb complexes in the proximity of regulatory regions of active loci (6, 8, 50) may serve a regulatory role for fine-tuning of the transcriptional response. Regardless of the underlying mechanism(s), the finding that Ring1B negatively regulates cyclin D2 reinforces the notion that the role of PcG complexes in cell proliferation includes the regulation of components of the machinery involved in cell cycle progression.
Selective regulation of hematopoietic cell proliferation by Ring1B and other PcG products. Normal hematopoiesis displays an orchestrated use of the cell cycle machinery components in order to ensure the self-renewal and expansion activities associated with the various stages of cell differentiation of hematopoietic lineages (53). These include proliferative responses as diverse as the high self-renewal capacity and low proliferative rate of HSCs, the various proliferation rates of their progeny along their maturation, or retrieval from active proliferation of fully differentiated cells (58).
In our studies, Ring1B inactivation resulted in upregulation of cyclin D2 in most hematopoietic cells analyzed, except for B-cell precursors, whereas that of p16Ink4a was detected only in maturing B and myeloid cells but not in progenitors, thus providing an explanation for their altered proliferation rates. Mutant myeloid progenitor hyperproliferation would result from increased cyclin D2, in the absence of p16Ink4a, as it occurs in Cyclin D2-transduced bone marrow cells (61). In turn, progressive accumulation of p16Ink4a along differentiation would abrogate the proliferative potential of the maturing progeny, despite their high content of cyclin D2, thereby resulting in a hypoplastic bone marrow. In this simple hypothesis, inhibition, but not promotion, of proliferation caused by Ring1B inactivation would be alleviated by loss of p16Ink4a. Indeed, myeloid and B-cell precursors of mice bearing a coincident loss of Ring1B and Ink4a proliferate efficiently, and the reduced cellularity of Ring1B-deficient bone marrow is restored in the compound mutant. Instead, the hyperproliferative phenotype elicited by Ring1B inactivation in myeloid progenitors was not reversed by the absence of Ink4a. Altogether, our data support a broad regulatory role for Ring1B in the differentiation/expansion of adult hematopoietic cells by integrating signals during amplification of immature progenitors and during the expansion of their maturing progeny (Fig. 7).
|
Ring1B-Ink4a interaction: implications for tumorigenesis. The role of Ring1B as a proliferation promoter through repression of inhibitors of cell proliferation is consistent with the rescue of Ring1B-deficient bone marrow hypocellularity by Ink4a/Arf inactivation. This observation is reminiscent of the substantial restoration of the self-renewing capacity of HSCs (48) and of thymocytes and splenocytes of Bmi1–/– Ink4a/Arf–/– mice (9). Bmi1-mediated repression of Ink4a appears as a causal agent of primed cell proliferation in tumors, and protein expression analysis shows upregulation of Bmi1 in a variety of tumor cells. Similarly, Ring1B protein expression is increased in a variety of tumors (60), and its expression correlates with poor prognosis in a subset of malignant human cancers (24). However, the antiproliferative activity of Ring1B may also play a role in the development of neoplastic processes, as suggested by the decreased latency of tumor development in mice whose bone marrow is doubly Ring1B and Ink4a/Arf deficient compared to those lacking only Ink4a/Arf. Since Ring1B inactivation does not lead to p19Arf upregulation, the contribution of Ring1B in the absence of p16Ink4a to neoplastic events may lie in the presence of a population of progenitors with enhanced self-renewal properties susceptible of transformation (16, 32), thus cooperating with other genetic/epigenetic lesions appearing during the onset and development of tumors.
In conclusion, we have identified an antiproliferative role for Ring1B in the expansion of progenitor cells, mediated by the suppression of a positive regulator of the cell cycle machinery, which may be important in the tight control of proliferation occurring during adult hematopoiesis. It will be of interest to investigate whether this role in cell turnover takes place also in other self-renewing tissues.
| ACKNOWLEDGMENTS |
|---|
T.M. and M.R-T. were recipients of FPI and FPU fellowships, respectively, from the Ministerio de Educación y Ciencia. This work was supported by grants from the Fundación Médica Mutua Madrileña (C.C.), Plan Nacional de Investigacion Científica BFU2005-03651 (C.C.) and SAF2004-06952-CO2-01 (M.V.), the OncoCycle program from the Comunidad de Madrid (M.V.), and in part by a grant of the Genome Network Project from the Ministry of Education Culture, Sports, Science and Technology of the Japanese Government (H.K.).
| FOOTNOTES |
|---|
Published ahead of print on 26 November 2007. ![]()
Supplemental material for this article may be found at http://mcb.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
2. Arai, S., and T. Miyazaki. 2005. Impaired maturation of myeloid progenitors in mice lacking novel Polycomb group protein MBT-1. EMBO. J. 24:1863-1873.[CrossRef][Medline]
3. Atsuta, T., S. Fujimura, H. Moriya, M. Vidal, T. Akasaka, and H. Koseki. 2001. Production of monoclonal antibodies against mammalian Ring1B proteins. Hybridoma 20:43-46.[CrossRef][Medline]
4. Boyer, L. A., D. Mathur, and R. Jaenisch. 2006. Molecular control of pluripotency. Curr. Opin. Genet. Dev. 16:455-462.[CrossRef][Medline]
5. Boyer, L. A., K. Plath, J. Zeitlinger, T. Brambrink, L. A. Medeiros, T. I. Lee, S. S. Levine, M. Wernig, A. Tajonar, M. K. Ray, G. W. Bell, A. P. Otte, M. Vidal, D. K. Gifford, R. A. Young, and R. Jaenisch. 2006. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441:349-353.[CrossRef][Medline]
6. Bracken, A. P., D. Kleine-Kohlbrecher, N. Dietrich, D. Pasini, G. Gargiulo, C. Beekman, K. Theilgaard-Mönch, S. Minucci, B. T. Porse, J. C. Marine, K. H. Hansen, and K. Helin. 2007. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells. Genes Dev. 21:525-530.
7. Bracken, A. P., N. Dietrich, D. Pasini, K. H. Hansen, and K. Helin. 2006. Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions. Genes Dev. 20:1123-1136.
8. Breiling, A., L. P. O'Neill, D. D'Eliseo, B. M. Turner, and V. Orlando. 2004. Epigenome changes in active and inactive Polycomb-group-controlled regions. EMBO Rep. 5:976-982.[CrossRef][Medline]
9. Bruggeman, S. W., M. E. Valk-Lingbeek, P. P. van der Stoop, J. J. Jacobs, K. Kieboom, E. Tanger, D. Hulsman, C. Leung, Y. Arsenijevic, S. Marino, and M. van Lohuizen. 2005. Ink4a and Arf differentially affect cell proliferation and neural stem cell self-renewal in Bmi1-deficient mice. Genes Dev. 19:1438-1443.
10. Buchwald, G., P. van der Stoop, O. Weichenrieder, A. Perrakis, M. van Lohuizen, and T. K. Sixma. 2006. Structure and E3-ligase activity of the Ring-Ring complex of Polycomb proteins Bmi1 and Ring1b. EMBO J. 25:2465-2474.[CrossRef][Medline]
11. Buszczak, M., and A. C. Spradling. 2006. Searching chromatin for stem cell identity. Cell 125:233-236.[CrossRef][Medline]
12. Cao, R., L. Wang, H. Wang, L. Xia, H. Erdjument-Bromage, P. Tempst, R. S. Jones, and Y. Zhang. 2002. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298:1039-1043.
13. Cooper, A. B., C. M. Sawai, E. Sicinska, S. E. Powers, P. Sicinski, M. R. Clark, and I. Aifantis. 2006. A unique function for cyclin D3 in early B cell development. Nat. Immunol. 7:489-497.[CrossRef][Medline]
14. Coré, N., F. Joly, A. Boned, and M. Djabali. 2004. Disruption of E2F signaling suppresses the INK4a-induced proliferative defect in M33-deficient mice. Oncogene 23:7660-7668.[CrossRef][Medline]
15. Coré, N., S. Bel, S. J. Gaunt, M. Aurrand-Lions, J. Pearce, A. Fisher, and M. Djabali. 1997. Altered cellular proliferation and mesoderm patterning in Polycomb-M33-deficient mice. Development 124:721-729.[Abstract]
16. Cozzio, A., E. Passegué, P. M. Ayton, H. Karsunky, M. L. Cleary, and I. L. Weissman. 2003. Similar MLL-associated leukemias arising from self-renewing stem cells and short-lived myeloid progenitors. Genes Dev. 17:3029-3035.
17. Crosnier, C., D. Stamataki, and J. Lewis. 2006. Organizing cell renewal in the intestine: stem cells, signals and combinatorial control. Nat. Rev. Genet. 7:349-359.[CrossRef][Medline]
18. Czermin, B., R. Melfi, D. McCabe, V. Seitz, A. Imhof, and V. Pirrotta. 2002. Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111:185-196.[CrossRef][Medline]
19. del Mar Lorente, M., C. Marcos-Gutiérrez, C. Pérez, J. Schoorlemmer, A. Ramírez, T. Magin, and M. Vidal. 2000. Loss- and gain-of-function mutations show a Polycomb group function for Ring1A in mice. Development 127:5093-5100.[Abstract]
20. de Napoles, M., J. E. Mermoud, R. Wakao, Y. A. Tang, M. Endoh, R. Appanah, T. B. Nesterova, J. Silva, A. P. Otte, M. Vidal, H. Koseki, and N. Brockdorff. 2004. Polycomb group proteins Ring1A/B link ubiquitylation of histone H2A to heritable gene silencing and X inactivation. Dev. Cell 7:663-676.[CrossRef][Medline]
21. Dietrich, N., A. P. Bracken, E. Trinh, C. K. Schjerling, H. Koseki, J. Rappsilber, K. Helin, and K. H. Hansen. 2007. Bypass of senescence by the polycomb group protein CBX8 through direct binding to the INK4A-ARF locus. EMBO J. 26:1637-1648.[CrossRef][Medline]
22. Gearhart, M. D., C. M. Corcoran, J. A. Wamstad, and V. J. Bardwell. 2006. Polycomb group and SCF ubiquitin ligases are found in a novel BCOR complex that is recruited to BCL6 targets. Mol. Cell. Biol. 26:6880-6889.
23. Gil, J., and G. Peters. 2006. Regulation of the INK4b-ARF-INK4a tumour suppressor locus: all for one or one for all. Nat. Rev. Mol. Cell Biol. 7:667-677.[CrossRef][Medline]
24. Glinsky, G. V., O. Berezovska, and A. B. Glinskii. 2005. Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. J. Clin. Investig. 115:1503-1521.[CrossRef][Medline]
25. Hemenway, C. S., B. W. Halligan, and L. S. Levy. 1998. The Bmi-1 oncoprotein interacts with dinG and MPh2: the role of RING finger domains. Oncogene 16:2541-2547.[CrossRef][Medline]
26. Hosen, N., T. Yamane, M. Muijtjens, K. Pham, M. F. Clarke, and I. L. Weissman. 2007. Bmi-1-green fluorescent protein-knock-in mice reveal the dynamic regulation of bmi-1 expression in normal and leukemic hematopoietic cells. Stem Cells 25:1635-1644.
27. Jacobs, J. J., B. Scheijen, J. W. Voncken, K. Kieboom, A. Berns, and M. van Lohuizen. 1999. Bmi-1 collaborates with c-Myc in tumorigenesis by inhibiting c-Myc-induced apoptosis via INK4a/ARF. Genes Dev. 13:2678-2690.
28. Kajiume, T., Y. Ninomiya, H. Ishihara, R. Kanno, and M. Kanno. 2004. Polycomb group gene mel-18 modulates the self-renewal activity and cell cycle status of hematopoietic stem cells. Exp. Hematol. 32:571-578.[CrossRef][Medline]
29. Kato, Y., H. Koseki, M. Vidal, H. Nakauchi, and A. Iwama. 2007. Unique composition of polycomb repressive complex 1 in hematopoietic stem cells. Int. J. Hematol. 85:179-181.[CrossRef][Medline]
30. Kondo, M., I. L. Weissman, and K. Akashi. 1997. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell 91:661-672.[CrossRef][Medline]
31. Kotake, Y., R. Cao, P. Viatour, J. Sage, Y. Zhang, and Y. Xiong. 2007. pRB family proteins are required for H3K27 trimethylation and Polycomb repression complexes binding to and silencing p16INK4a tumor suppressor gene. Genes Dev. 21:49-54.
32. Krivtsov, A. V., D. Twomey, Z. Feng, M. C. Stubbs, Y. Wang, J. Faber, J. E. Levine, J. Wang, W. C. Hahn, D. G. Gilliland, T. R. Golub, and S. A. Armstrong. 2006. Transformation from committed progenitor to leukaemia stem cell initiated by MLL-AF9. Nature 442:818-822.[CrossRef][Medline]
33. Kühn, R., F. Schwenk, M. Aguet, and K. Rajewsky. 1995. Inducible gene targeting in mice. Science 269:1427-1429.
34. Kuzmichev, A., K. Nishioka, H. Erdjument-Bromage, P. Tempst, and D. Reinberg. 2002. Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev. 16:2893-2905.
35. Lessard, J., A. Schumacher, U. Thorsteinsdottir, M. van Lohuizen, T. Magnuson, and G. Sauvageau. 1999. Functional antagonism of the Polycomb-group genes Eed and Bmi1 in hemopoietic cell proliferation. Genes Dev. 13:2691-2703.
36. Lessard, J., and G. Sauvageau. 2003. Polycomb group genes as epigenetic regulators of normal and leukemic hemopoiesis. Exp. Hematol. 31:567-585.[CrossRef][Medline]
37. Lessard, J., and G. Sauvageau. 2003. Bmi-1 determines the proliferative capacity of normal and leukaemic stem cells. Nature 423:255-260.[CrossRef][Medline]
38. Leung, C., M. Lingbeek, O. Shakhova, J. Liu, E. Tanger, P. Saremaslani, M. Van Lohuizen, and S. Marino. 2004. Bmi1 is essential for cerebellar development and is overexpressed in human medulloblastomas. Nature 428:337-341.[CrossRef][Medline]
39. Levine, S. S., A. Weiss, H. Erdjument-Bromage, Z. Shao, P. Tempst, and R. E. Kingston. 2002. The core of the Polycomb repressive complex is compositionally and functionally conserved in flies and humans. Mol. Cell. Biol. 22:6070-6078.
40. Levine, S. S., I. F. King, and R. E. Kingston. 2004. Division of labor in Polycomb group repression. Trends Biochem. Sci. 29:478-485.[CrossRef][Medline]
41. Martinez, A. M., and G. Cavalli. 2006. The role of Polycomb group proteins in cell cycle regulation during development. Cell Cycle 5:1189-1197.[Medline]
42. Martinez, A. M., S. Colomb, J. Déjardin, F. Bantignies, and G. Cavalli. 2006. Polycomb group-dependent cyclin A repression in Drosophila. Genes. Dev. 20:501-513.
43. Mijimolle, N., J. Velasco, P. Dubus, C. Guerra, C. A. Weinbaum, P. J. Casey, V. Campuzano, and M. Barbacid. 2005. Protein farnesyltransferase in embryogenesis, adult homeostasis, and tumor development. Cancer Cell 7:313-324.[CrossRef][Medline]
44. Molofsky, A. V., R. Pardal, T. Iwashita, I. K. Park, M. F. Clarke, and S. J. Morrison. 2003. Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation. Nature 425:962-967.[CrossRef][Medline]
45. Molofsky, A. V., S. He, M. Bydon, S. J. Morrison, and R. Pardal. 2005. Bmi-1 promotes neural stem cell self-renewal and neural development but not mouse growth and survival by repressing the p16Ink4a and p19Arf senescence pathways. Genes Dev. 19:1432-1437.
46. Müller, J., C. M. Hart, N. J. Francis, M. L. Vargas, A. Sengupta, B. Wild, E. L. Miller, M. B. O'Connor, R. E. Kingston, and J. A. Simon. 2002. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111:197-208.[CrossRef][Medline]
47. Ogawa, H., K. Ishiguro, S. Gaubatz, D. M. Livingston, and Y. Nakatani. 2002. A complex with chromatin modifiers that occupies E2F- and Myc-responsive genes in G0 cells. Science 296:1132-1136.
48. Oguro, H., A. Iwama, Y. Morita, T. Kamijo, M. van Lohuizen, and H. Nakauchi. 2006. Differential impact of Ink4a and Arf on hematopoietic stem cells and their bone marrow microenvironment in Bmi1-deficient mice. J. Exp. Med. 203:2247-2253.
49. Ohta, H., A. Sawada, J. Y. Kim, S. Tokimasa, S. Nishiguchi, R. K. Humphries, J. Hara, and Y. Takihara. 2002. Polycomb group gene rae28 is required for sustaining activity of hematopoietic stem cells. J. Exp. Med. 195:759-770.
50. Papp, B., and J. Müller. 2006. Histone trimethylation and the maintenance of transcriptional ON and OFF states by TrxG and PcG proteins. Genes. Dev. 20:2041-2054.
51. Park, I. K., D. Qian, M. Kiel, M. W. Becker, M. Pihalja, I. L. Weissman, S. J. Morrison, and M. F. Clarke. 2003. Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells. Nature 423:302-305.[CrossRef][Medline]
52. Pasini, D., A. P. Bracken, and K. Helin. 2004. Polycomb group proteins in cell cycle progression and cancer. Cell Cycle 3:396-400.[Medline]